ID: 1006303485

View in Genome Browser
Species Human (GRCh38)
Location 6:33206267-33206289
Sequence GTGTCTGTGGAGAGGTTTGT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 402
Summary {0: 1, 1: 0, 2: 2, 3: 34, 4: 365}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1006303474_1006303485 14 Left 1006303474 6:33206230-33206252 CCCAAAGTTTGGGGATTTTCTAG 0: 1
1: 0
2: 12
3: 102
4: 452
Right 1006303485 6:33206267-33206289 GTGTCTGTGGAGAGGTTTGTGGG 0: 1
1: 0
2: 2
3: 34
4: 365
1006303475_1006303485 13 Left 1006303475 6:33206231-33206253 CCAAAGTTTGGGGATTTTCTAGG 0: 1
1: 0
2: 1
3: 24
4: 186
Right 1006303485 6:33206267-33206289 GTGTCTGTGGAGAGGTTTGTGGG 0: 1
1: 0
2: 2
3: 34
4: 365
1006303473_1006303485 15 Left 1006303473 6:33206229-33206251 CCCCAAAGTTTGGGGATTTTCTA 0: 1
1: 0
2: 2
3: 32
4: 256
Right 1006303485 6:33206267-33206289 GTGTCTGTGGAGAGGTTTGTGGG 0: 1
1: 0
2: 2
3: 34
4: 365
1006303469_1006303485 30 Left 1006303469 6:33206214-33206236 CCTGAATGAAGAGATCCCCAAAG 0: 1
1: 0
2: 0
3: 20
4: 180
Right 1006303485 6:33206267-33206289 GTGTCTGTGGAGAGGTTTGTGGG 0: 1
1: 0
2: 2
3: 34
4: 365

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1006303485 Original CRISPR GTGTCTGTGGAGAGGTTTGT GGG Intronic
900171646 1:1272219-1272241 TTGTCTGTGGGGATGTTTGAAGG - Intronic
900298031 1:1962108-1962130 CTCTTTGTGGACAGGTTTGTAGG - Intronic
900481112 1:2899776-2899798 GTGTGTGTGAAGGGGGTTGTGGG + Intergenic
900664374 1:3804544-3804566 GGGTCTGGGGAGGGGTGTGTGGG + Intergenic
901233643 1:7655652-7655674 GTGTGTGTGCATAGGTGTGTGGG - Intronic
902538344 1:17134849-17134871 GTGTGTGTGCACAGGTGTGTGGG - Intergenic
902625781 1:17675485-17675507 GTGTGTGTGTATAGGTGTGTGGG + Intronic
903421630 1:23221710-23221732 GTGTCTGGGGACAGGTGTCTGGG + Intergenic
904043153 1:27595617-27595639 GTGTCTCTGGAAAGGTTATTGGG + Intronic
904732368 1:32604361-32604383 GTGTCTGGGGAAAGGTTTGTGGG - Exonic
905546682 1:38805268-38805290 GGGTTTGTGGAGGAGTTTGTGGG - Intergenic
906979304 1:50611825-50611847 GGGTATGTGGGGAGGTTGGTGGG - Intronic
908602859 1:65759653-65759675 GTGTCTGCTGATAGGTATGTGGG + Intergenic
908830208 1:68171071-68171093 GTGTGTGTGCAGGGGTTTGGGGG - Intronic
909016531 1:70385890-70385912 GTGTCTAGGGAGAGGCTGGTAGG - Intergenic
913693938 1:121306107-121306129 GTGTCTGTGGGTACATTTGTAGG + Intronic
914143626 1:144973960-144973982 GTGTCTGTGGGTACATTTGTAGG - Intronic
914333739 1:146696971-146696993 GTGAGTCTGGAGAGGTATGTTGG + Intergenic
915135640 1:153729154-153729176 ATGTCTGTGTAGATGTTTGGGGG + Intronic
915733557 1:158070698-158070720 GTGTGTGTGGTGAGGGTTGTGGG + Intronic
918295147 1:183149558-183149580 GTGTGTGAGGAGAGGGGTGTGGG - Intergenic
918295196 1:183149805-183149827 GTGTGTGAGGAGAGGGGTGTGGG - Intergenic
918295233 1:183150002-183150024 GTGTGTGAGGAGAGGGGTGTGGG - Intergenic
920439072 1:205966556-205966578 GTGTCTGTTGAGAGGCTCGGAGG - Intergenic
920481263 1:206324486-206324508 GTGTCTGTGGGTACATTTGTAGG + Intronic
920849443 1:209618691-209618713 GTATCTCTGGGGAGGTTAGTGGG - Intronic
921113692 1:212065527-212065549 GTGTGTGTAGAGAGATTTTTAGG - Intronic
923925013 1:238616511-238616533 GAGTTTGTGGAGAGATTTGCAGG - Intergenic
1062831481 10:608514-608536 GTGTGTGTGGGGGGGTGTGTGGG - Intronic
1065494334 10:26313290-26313312 GTGTCAGAAGAGAGGTTTCTAGG + Intergenic
1065902043 10:30216975-30216997 GTGTCTGTGGGGGTGTTTCTAGG + Intergenic
1066476477 10:35751911-35751933 GTGTCTGTGGAGGGGAGTGGTGG + Intergenic
1068657952 10:59593709-59593731 GTGTCTGTGATGAGGTGGGTAGG - Intergenic
1069554310 10:69387227-69387249 GTGTCTGTGTTGTGGTTTGGGGG - Intronic
1069752218 10:70751999-70752021 GTACCTGTGGAGAGCCTTGTGGG - Intronic
1070352851 10:75610335-75610357 GTGTTTGTGGTGAGGGATGTGGG - Intronic
1071621466 10:87123689-87123711 GGGTCTGTTGAGAGGTGTTTGGG + Intronic
1072955005 10:99880303-99880325 GTGGCTGCGGCGAGGATTGTAGG + Exonic
1073032671 10:100539907-100539929 GGGTCTGTGGATAGGCTTCTAGG + Intronic
1073048888 10:100655398-100655420 CTCCCTGTGGAGAGGTTTATTGG - Intergenic
1074060173 10:109958190-109958212 GTTTCTGAGCAGAGGTATGTAGG + Intergenic
1074855277 10:117468781-117468803 GTGTCTGTGGAGGTGTTTCTAGG + Intergenic
1074955074 10:118380732-118380754 GTGTTTGAGGAAAGGTTGGTGGG - Intergenic
1075654836 10:124154290-124154312 GTGTATGTAGAGGTGTTTGTGGG - Intergenic
1076624588 10:131813873-131813895 GTGTTTGTGTGTAGGTTTGTAGG - Intergenic
1076632523 10:131859498-131859520 GAGTCTGGGGAGAGGTATGCAGG + Intergenic
1077809734 11:5625059-5625081 AGGTGTGTGGGGAGGTTTGTGGG + Intronic
1078151014 11:8759738-8759760 GGGTCTGAGGAGATGTTTGCTGG - Intronic
1078281443 11:9905645-9905667 GTCTCTGTGGGGACCTTTGTTGG + Intronic
1079133703 11:17764106-17764128 GTGTCTATGGAGACGTGTGGTGG - Intronic
1080685994 11:34515216-34515238 TTCTCAGTGGAGAGGTTTTTAGG + Intergenic
1081210689 11:40330260-40330282 GTGTCTGTGAGGATGTTTCTGGG + Intronic
1081267491 11:41044000-41044022 GTGTATGTGATGAGGTGTGTGGG - Intronic
1083751232 11:64761793-64761815 GTGTCTGTGGAGGTGTATTTTGG - Intergenic
1083752148 11:64766682-64766704 GTGTCTGGGGAGAGGTTCGTGGG - Intronic
1084034097 11:66497508-66497530 GTGCCCCTGGAGAGGTTGGTGGG - Intronic
1085548581 11:77345178-77345200 GTGTGTATTGAGAGGTTTGAGGG + Intronic
1087384875 11:97458396-97458418 GAGTTTTTGGAGAGTTTTGTGGG + Intergenic
1087642663 11:100772019-100772041 GTGATTGTGGAGAGGTATGAAGG - Intronic
1089209590 11:116791266-116791288 GTTTCTTTGGAGAGTGTTGTAGG - Intronic
1089249208 11:117145158-117145180 CTGTCAGCGGAGAGGTTTGGGGG + Intronic
1089775442 11:120832298-120832320 GGCTCTGTGGAGAGGTCTGCGGG + Intronic
1090037901 11:123264632-123264654 ATCACTGTGGAGAGGTTTGCAGG - Intergenic
1095381564 12:41600644-41600666 GTGTCTGTCGAAAGGTAAGTGGG - Intergenic
1096961340 12:55581110-55581132 GTGTCTGTCTAGAAGTTGGTTGG + Intergenic
1097131322 12:56812658-56812680 GTGTGTGTGGATAGGTAGGTAGG - Intergenic
1097638091 12:62146149-62146171 GTTTCTGTGAAGAGGTTTCTTGG + Intronic
1100862172 12:98817862-98817884 GTGCCTGTGGGGAGGATTTTTGG + Intronic
1102029505 12:109731763-109731785 GGGTGTGTGGAGGGGTTTGTCGG + Intronic
1103920901 12:124398737-124398759 GTGTCTGTGAACAGTTTTGATGG - Intronic
1104242767 12:127006828-127006850 GTGTCTGTGTATATGTTTGTAGG - Intergenic
1104242768 12:127006902-127006924 ATGTGTGTGTAGATGTTTGTAGG - Intergenic
1104636286 12:130439709-130439731 GTGTCGGTGGGGGTGTTTGTGGG + Intronic
1105244733 13:18639168-18639190 GTGTGTGTAGAGAGTATTGTTGG + Intergenic
1105610070 13:21960899-21960921 GTGTATGTGGTGAGGGATGTAGG - Intergenic
1106148558 13:27074884-27074906 GTGTGTGTATAGAGGGTTGTTGG - Intronic
1106595520 13:31132163-31132185 GTGTCTGTGCAGAGGATGTTGGG + Intergenic
1106808099 13:33332180-33332202 GTGTCTGTGGATAGGTGGGGAGG - Intronic
1107022112 13:35762825-35762847 GTGTATGTGTATAGGTGTGTAGG - Intergenic
1109040999 13:57336411-57336433 TTCTCAGTGGAGAGGTTGGTTGG + Intergenic
1110588376 13:77222648-77222670 GTGTGTGTTGAAAGGCTTGTGGG - Intronic
1111626055 13:90788502-90788524 GTCTCTATGGAGAGGAATGTGGG - Intergenic
1111644985 13:91021521-91021543 GTGTCTGTGGTGATGGTGGTGGG - Intergenic
1112099862 13:96176579-96176601 TTGTATGTGGACAGGTTTGTTGG - Intronic
1112683874 13:101800023-101800045 GTGTCTGTGGAGAAGTAGGTAGG - Intronic
1113327217 13:109293840-109293862 GTGTGTGTGTAGGGGTGTGTGGG - Intergenic
1113327252 13:109294055-109294077 GTGTGTGTGTAGGGGTGTGTGGG - Intergenic
1113353063 13:109548524-109548546 GTGTCTGTGCTGACGTTGGTTGG - Intergenic
1113468710 13:110530122-110530144 GTGTCTGTGTAGAGGTGGGGTGG - Intronic
1113468727 13:110530169-110530191 GTGTCTGTGTAGAGGTGGGGTGG - Intronic
1113468832 13:110530457-110530479 GTGTCTGTGTAGAGGTGGGGCGG - Intronic
1113468847 13:110530505-110530527 GTGTCTGTGTAGAGGTGGGGCGG - Intronic
1113468862 13:110530553-110530575 GTGTCTGTGTAGAGGTGGGGCGG - Intronic
1113468892 13:110530647-110530669 GTGTCTGTGTAGAGGTGGGGCGG - Intronic
1113468935 13:110530791-110530813 GTGTCTGTGTAGAGGTGGGGTGG - Intronic
1113597896 13:111547488-111547510 GTGTCTGTGGGGAGCCGTGTGGG - Intergenic
1113870597 13:113557456-113557478 GTGTGTGTGCAGTTGTTTGTAGG + Intergenic
1113879657 13:113617041-113617063 GTTTGTATAGAGAGGTTTGTGGG + Intronic
1115068257 14:29292198-29292220 GTGTCAATGGAGAGGTCTGGTGG - Intergenic
1116139251 14:40968567-40968589 CTGTCTGAGGAGGGGTATGTAGG + Intergenic
1117916078 14:60679563-60679585 CTGTCAGTGGAGAGGTTTCTTGG + Intergenic
1119078884 14:71673268-71673290 CTGTCTCTGGGGAGGTTTATTGG + Intronic
1122979771 14:105186273-105186295 GTGTGTGTGGAGGTGTGTGTGGG + Intergenic
1124340854 15:28888411-28888433 GTGGCTGTGGTGAGGGCTGTTGG + Intronic
1126099462 15:45110991-45111013 CTGTCTGGGGAGGGGTTTCTGGG + Intronic
1126104065 15:45136046-45136068 CTGTCTGGGGAGGGGTTTCTGGG - Intronic
1127409247 15:58689082-58689104 GTGACTGTGGTGTGTTTTGTGGG - Intronic
1127414364 15:58743330-58743352 GTTTGTGTGGAGAAGGTTGTGGG - Intronic
1128765946 15:70251157-70251179 GGGGCTGTGGAGAGGCTTCTGGG + Intergenic
1128831911 15:70777220-70777242 CTGTGGGTGGAGAGGGTTGTGGG + Intergenic
1129226476 15:74173419-74173441 GTGTGTGTGTACAAGTTTGTGGG - Intergenic
1132310638 15:100854981-100855003 GTGTTGGTGGAGAGGGTTGGAGG - Intergenic
1133895383 16:9922552-9922574 ATGTCTACAGAGAGGTTTGTGGG - Intronic
1134252732 16:12585897-12585919 GTGTGGGTGGAGAAGTGTGTTGG - Intergenic
1134813908 16:17190122-17190144 GAGACTGAGGAGAGGTTTCTGGG + Intronic
1135395872 16:22131310-22131332 GTGTCTGAGGGAAGGTTTGCAGG + Intronic
1135871431 16:26155020-26155042 GGGTCTGGGGAGAGGGTTGTGGG - Intergenic
1136651609 16:31677768-31677790 GGCTCTGTGGAGAGGCATGTGGG + Intergenic
1137381212 16:48001489-48001511 GTGTCTCTGGGGATGTTTGTGGG + Intergenic
1138197392 16:55061538-55061560 GGGTCTGTGGTGAACTTTGTAGG + Intergenic
1138883726 16:61049545-61049567 GTTTCTGTTGAGAGGTCTGCTGG + Intergenic
1139582711 16:67882852-67882874 GTGGCTGTGGGCAGGTGTGTGGG + Exonic
1139821696 16:69726361-69726383 GTGCCTGTGGAGGAGGTTGTAGG - Intronic
1139999878 16:71014278-71014300 GTGAGTCTGGAGAGGTATGTTGG - Intronic
1140279393 16:73541182-73541204 GGGTCTGTGGAGAGGAGAGTGGG - Intergenic
1140613598 16:76632865-76632887 GAGTCTGTGGAGGGGTTAGTAGG + Intronic
1141833484 16:86523024-86523046 GTATCTGGGGTGAGGTATGTCGG + Intergenic
1144304661 17:13957220-13957242 GTGTCTGTGTATAGGTTGGAGGG - Intergenic
1145024031 17:19454098-19454120 GTGGCTGTGGAGAGGTGTCTGGG - Intergenic
1145400344 17:22526900-22526922 GTGTAAGTGGAGAGATTGGTAGG - Intergenic
1146020079 17:29270222-29270244 GTGTCTGCGCAGAGATTTGATGG - Intronic
1146041734 17:29461483-29461505 GTGTCAGGGCTGAGGTTTGTTGG - Intronic
1146494721 17:33311448-33311470 GTGTGTGTGTAGATGTGTGTAGG + Intronic
1146544727 17:33728300-33728322 GAGTCTGTGGTGAGGTCTGGAGG - Intronic
1147159183 17:38560691-38560713 GGGTCTGTGGAATGGTTTGGGGG - Intronic
1147846272 17:43406233-43406255 GTGTTTGTGTAGAGGTTGGGTGG + Intergenic
1148605697 17:48927427-48927449 GGCCCTGTGGAGAGGTGTGTTGG - Exonic
1150591143 17:66563801-66563823 CTGTCTGTGCAGAGGTACGTTGG + Intronic
1152146684 17:78572692-78572714 GAGTCCATGGAGAGGTGTGTGGG - Exonic
1152191918 17:78893351-78893373 GTGTGTGTGCAGGGGTGTGTAGG + Intronic
1152519589 17:80847408-80847430 GTGTTTGTGGGGAAGTGTGTGGG + Intronic
1152590213 17:81208072-81208094 GTGTGTGTGGTGTGGTGTGTGGG - Intronic
1153132818 18:1876952-1876974 GTGTGTGTGGAGGGGGGTGTAGG - Intergenic
1153317565 18:3739947-3739969 GTGTCTGTGCAATGATTTGTTGG + Intronic
1154444207 18:14420724-14420746 GTGTGTGTAGAGAGTATTGTTGG - Intergenic
1156945968 18:42831986-42832008 GGGTCTGTGTGGATGTTTGTAGG - Intronic
1157181880 18:45505546-45505568 GTTTCTGGGGTGAGGTATGTGGG - Intronic
1157682142 18:49615471-49615493 GTGTCTGTGGATTGGCTTGGTGG + Intergenic
1158969832 18:62656185-62656207 GGGTCTGGGGGGAGGTGTGTGGG - Intergenic
1158971759 18:62674664-62674686 GTGTCAATAGTGAGGTTTGTAGG - Intergenic
1160091936 18:75835115-75835137 GTGTGTGTGCAGAGATTTATGGG - Intergenic
1160513590 18:79466366-79466388 GTATCTGGGGAGAGGGTTGGCGG - Intronic
1161381910 19:3970059-3970081 GTGTCTGGAGAGAGTTTTGCGGG - Intronic
1161783444 19:6308837-6308859 GTGGGCGTGGGGAGGTTTGTGGG + Intronic
1163038285 19:14584268-14584290 GTGTCTGAGGAGGGGTTTCCAGG + Intronic
1163038975 19:14588529-14588551 GTGTCTGAGGAGGGGTTTCCAGG + Intronic
1163765573 19:19161478-19161500 GTGTGTTTGGAGAGCTGTGTGGG - Intronic
1165036763 19:33039312-33039334 GTGTCTGTGGTGGGGTTTGCAGG - Intronic
1165119026 19:33547205-33547227 CTGTTTGTGGGGAGGTTTCTTGG + Intergenic
1166542888 19:43617256-43617278 GTGTGTGTGGTGGGGTTGGTGGG - Intronic
1166766251 19:45253176-45253198 GTGTGTGTGGGGGGGTCTGTCGG - Intronic
1167033501 19:46978945-46978967 GTGTGTGTGGTGGGGTTTGGTGG + Intronic
1167603886 19:50469792-50469814 GTGTCTGTGCACAGGTGTGAGGG - Intronic
1168167008 19:54555526-54555548 GTGTCTGGAAAGATGTTTGTGGG - Intergenic
925291370 2:2750696-2750718 GTGTGTATGGAGTGGTGTGTGGG + Intergenic
925717723 2:6799924-6799946 GTGCCTGTGCAGAGGTGTGGAGG + Intergenic
925958505 2:8993459-8993481 CAGTCTGTGGAGAAGCTTGTTGG + Intronic
926689562 2:15724108-15724130 GTGGCTGTGGTGAGGCGTGTGGG + Intronic
927260390 2:21082466-21082488 GTGTGTGGGGAGGGGATTGTTGG - Intergenic
928024024 2:27725109-27725131 GTGCCTGGGGAGAGGAATGTGGG + Intergenic
928260230 2:29760190-29760212 GTGTGTGTGTAGGGGTGTGTAGG - Intronic
930271285 2:49260549-49260571 GTTTCTGTGGAGAGGTAGGTAGG + Intergenic
931438077 2:62266223-62266245 GGGACTGTGGAAAGGTTTGCAGG + Intergenic
931587363 2:63842256-63842278 CTGACAGTGGAGAGGTTGGTGGG + Intronic
931807461 2:65821361-65821383 GTGTCTGTGAAAAGTTTTATTGG + Intergenic
932266808 2:70374617-70374639 GTGTCTGGTGAGAGCTTTCTGGG - Intergenic
932794300 2:74681327-74681349 GTCTCTGTGGGGAGGTTTTATGG + Exonic
932828847 2:74968676-74968698 CTGCCTGTGGGGAGGGTTGTGGG + Intronic
933172855 2:79142571-79142593 TTGTCTGAGGAAAGGTCTGTGGG + Intergenic
933911734 2:86946592-86946614 GTGTCTGAGGACAGTTTTGGAGG - Intronic
934011262 2:87823303-87823325 GTGTCTGAGGACAGTTTTGGAGG + Intronic
935774824 2:106464008-106464030 GTGTCTGAGGACAGTTTTGGAGG + Intronic
935819251 2:106877792-106877814 GTGTGTGTGGAGAGGTTGTAGGG - Intronic
935905245 2:107831904-107831926 GTGTCTGAGGACAGTTTTGGAGG - Intronic
935991611 2:108723608-108723630 GTGTCTGAGGACAGTTTTGGAGG - Intronic
936127023 2:109796974-109796996 GTGTCTGAGGACAGTTTTGGAGG - Intronic
936217674 2:110574512-110574534 GTGTCTGAGGACAGTTTTGGAGG + Intronic
936426818 2:112429083-112429105 GTGTCTGAGGACAGTTTTGGAGG + Intronic
938446505 2:131384472-131384494 GTGTCAGTGGAGATATTGGTAGG + Intergenic
938781015 2:134584952-134584974 GTGTCTGTGGAGTAGTTGGCAGG - Intronic
942328654 2:174797862-174797884 GTGATGGTGGAGAGGTTTATTGG + Intergenic
942389549 2:175477880-175477902 GTGTCTGTGGAGCCCTTTGTTGG + Intergenic
942717525 2:178910388-178910410 GTGGCTGGAGAGAGTTTTGTTGG + Intronic
942985181 2:182132163-182132185 CTGTCTGAGGAAAGGTTTGATGG + Intergenic
944260157 2:197668068-197668090 GTGTCTGTGGTGGGCTGTGTAGG + Intronic
944420268 2:199522895-199522917 GAGGCTCTGGAGAGGTCTGTGGG - Intergenic
944488858 2:200236877-200236899 ATTTCTTTGGAGAGATTTGTTGG + Intergenic
944962620 2:204892267-204892289 GTGACTGTGGAGAGAGTTGGAGG + Intronic
946164519 2:217855956-217855978 GTGTAGCTGGAGAGGTCTGTAGG - Intronic
946175413 2:217919422-217919444 GTGCCTGTGTACAGGTGTGTGGG - Intronic
946756677 2:222954093-222954115 GTGTCTCTGGAGTGGCTTGCTGG + Intergenic
946925161 2:224619217-224619239 GTGTCAGTGGAGGAGTTTCTGGG - Intergenic
947737924 2:232467313-232467335 GGGTCTGGGCAGAGGTTTCTTGG - Intergenic
1169352963 20:4884503-4884525 GTGTGAGTGGACAGGTCTGTGGG + Intronic
1170681788 20:18532497-18532519 GTGGCTGAGGAAAAGTTTGTAGG + Intronic
1171283477 20:23919874-23919896 GTGCCTGTGGAGATGCATGTGGG - Intergenic
1172865942 20:38097367-38097389 GTTTCTGTGAAGATGTTTTTGGG - Intronic
1173294792 20:41747381-41747403 GGGCCTGTGCAGGGGTTTGTTGG + Intergenic
1173727202 20:45306513-45306535 GTGTGTGTGGAGGGGTCTGGGGG - Intronic
1173839765 20:46149825-46149847 GTGTGTGAGCAGAGGTTTGGGGG - Intergenic
1174273554 20:49387001-49387023 CTGCCTTTGGAGAGGCTTGTGGG - Intronic
1174482015 20:50837957-50837979 GTGTGTGTGTAGAGGTGGGTGGG - Intronic
1174620189 20:51868255-51868277 GAGTTTGAGCAGAGGTTTGTGGG - Intergenic
1175166461 20:57047855-57047877 GTGTCTGGTGACAAGTTTGTTGG + Intergenic
1175631660 20:60544134-60544156 TTGTCTGTGGATAGACTTGTAGG + Intergenic
1176161141 20:63649453-63649475 GTGTCTGTGGAGAGGTGGCCTGG - Intronic
1176451777 21:6869134-6869156 GTGTGTGTAGAGAGTATTGTTGG + Intergenic
1176822313 21:13668837-13668859 GTAGCTGGGGGGAGGTTTGTGGG - Intergenic
1176829949 21:13734185-13734207 GTGTGTGTAGAGAGTATTGTTGG + Intergenic
1177571994 21:22899146-22899168 GTGTCTGTGAGGATGTTTCTGGG + Intergenic
1178153968 21:29830294-29830316 GTGTGTGTGGGGAGGTGGGTGGG - Intronic
1178804748 21:35829646-35829668 TTGTCTGTAGAGAGATCTGTGGG - Intronic
1179348371 21:40583394-40583416 GTGTCTGTGGGTTCGTTTGTGGG - Intronic
1179522688 21:41955371-41955393 GTGTGTGTGGTGTGGTGTGTGGG + Intergenic
1179554383 21:42163094-42163116 ATGTCTGTGCAGGGGTTAGTCGG + Intergenic
1179769570 21:43604418-43604440 GTGTGTGTGGTGTGGTGTGTGGG - Intronic
1180890729 22:19286594-19286616 GTGTGTCTGGAGAGGCTTCTGGG - Intronic
1181835573 22:25605138-25605160 CTGTCTGTGAAGAGGTTCTTTGG + Intronic
1182891097 22:33819522-33819544 GGCTCGGTGGGGAGGTTTGTTGG - Intronic
1182897329 22:33869527-33869549 GGGTCTGTGCAGTGGTTTGCAGG + Intronic
1185015173 22:48338782-48338804 GGGTCTGCGGAGACATTTGTGGG - Intergenic
949155794 3:826407-826429 CCCTCTGTGGTGAGGTTTGTGGG - Intergenic
949722331 3:7004865-7004887 GTGTTTTTAGAGAGATTTGTCGG - Intronic
950019898 3:9779899-9779921 GTGTGGGTGGTAAGGTTTGTGGG - Exonic
950040689 3:9917370-9917392 CTTTCTCTGGAGAGGCTTGTGGG + Exonic
950529249 3:13543616-13543638 GTGTCTGGGGAGAGGAGTGGGGG - Intergenic
950661565 3:14469852-14469874 GGGACAGTGGAGAGGTGTGTGGG - Intronic
951032335 3:17896040-17896062 CCGTCTGTGGCGAGGTTTGCAGG + Intronic
951827969 3:26889577-26889599 GTGTGTGTGGTGAGGGTTGAGGG - Intergenic
952086826 3:29832751-29832773 GAGTCTGTAGAGTGGTTAGTAGG - Intronic
952980425 3:38729533-38729555 GTGTATGAAGAGAGGTGTGTGGG + Intronic
953457836 3:43056693-43056715 GTGTGTGTGTAGAGGTGTGTAGG + Exonic
953544837 3:43856829-43856851 GTGTCTGTGTTGAGGGTTGTGGG - Intergenic
953903306 3:46855392-46855414 GTGTCCGTGGAGGGGTGAGTGGG - Intergenic
955569451 3:60288597-60288619 GTGTGTGTGGAGGGGGGTGTGGG + Intronic
956598531 3:70994493-70994515 GTGACAGTGGAAAGGGTTGTTGG - Intronic
957790128 3:84929923-84929945 GAGTCTGTGGAATGGTTTGAAGG + Intergenic
960019416 3:112932517-112932539 ATGTCTGTGGCCATGTTTGTTGG - Intronic
961435699 3:126915117-126915139 CTGACTGTGGAGGGGTTTTTAGG + Intronic
962326669 3:134440322-134440344 GTGTCTGTGGCTTGGTGTGTGGG - Intergenic
963036358 3:141032893-141032915 ATGTTTGTGGAGAGCTTTGTTGG + Intergenic
963350902 3:144149869-144149891 GTGTGTGTGAAGTGGTTTCTAGG - Intergenic
964629549 3:158795328-158795350 GTGTCTGGGTAGAGGTATGTGGG - Intronic
965215567 3:165860279-165860301 GTTTCTGTGAAAAGGTTTATTGG - Intergenic
965581519 3:170273264-170273286 GTGTCTTTGGAAATGTTTGTAGG + Exonic
966483014 3:180432495-180432517 GTCTTTATGGAGAGGATTGTGGG + Intergenic
967552214 3:190809844-190809866 GTGTCTCTGGACAGCTTTTTTGG - Intergenic
967923857 3:194631771-194631793 GTGTCTTCGGAGTGGTGTGTGGG - Intronic
967936245 3:194730132-194730154 GTGTGTGTGGAGAGGAGAGTAGG + Intergenic
967968589 3:194983340-194983362 GTCCCTGTGGAGACGTTTGCTGG - Intergenic
967970766 3:194997702-194997724 TTGTCTCTGGAGAGGTTGGGAGG - Intergenic
968067014 3:195764321-195764343 GTGTTGGTGGAGAGCTTGGTAGG + Intronic
968263666 3:197345296-197345318 GTGTGTGTGGGGGGGTGTGTGGG - Intergenic
969044196 4:4324714-4324736 GTGTCTGTGAAGACGCTGGTAGG - Intergenic
969146694 4:5130340-5130362 GTGACGGTGGGGAGGTTTGGCGG + Intronic
969585809 4:8090945-8090967 GTGTCCGCGGAGAGGCTGGTTGG - Intronic
972580110 4:40387598-40387620 GTGTATGGGGAGGGGTATGTGGG + Intergenic
973173642 4:47176545-47176567 GTGTAAGTGGAGAGGTTGATTGG + Intronic
973890590 4:55363777-55363799 AGGTCTGTGAAGAGGTCTGTGGG - Intronic
974617356 4:64306963-64306985 GTTTCTGTGGAGAGCTCTATAGG + Intronic
974628733 4:64456602-64456624 TTGTCTGTGGAGTGGGTTTTAGG - Intergenic
976719725 4:88158329-88158351 GTGTGTCTGGAAAGGTTGGTGGG - Intronic
977267276 4:94870313-94870335 GTGTCTGTGGAGTGTCTTGCTGG + Intronic
980226674 4:129996540-129996562 GTGTATGTGGAAAGCTATGTTGG + Intergenic
981901974 4:149876849-149876871 GTGTCTTTGGAAATCTTTGTAGG - Intergenic
984598462 4:181698407-181698429 ATGTCTATGGAAAAGTTTGTTGG - Intergenic
985493006 5:190115-190137 GTGTGTGTGAAGAGGTGGGTGGG - Intergenic
987580029 5:19778101-19778123 GTGTCTATTGAGATTTTTGTGGG - Intronic
988370933 5:30366070-30366092 GTGTTTGTGGAGGGGTCTGCTGG - Intergenic
988428401 5:31090922-31090944 GTGAATGTGAAGAGCTTTGTTGG + Intergenic
991202726 5:64013143-64013165 GTATCTGTGGGGAAGTTTCTAGG - Intergenic
991420956 5:66440935-66440957 CTTTCTGTGGTGAGGTGTGTGGG + Intergenic
993968281 5:94385530-94385552 TTGTCTGTCAAGAGGTTTCTGGG + Intronic
995623418 5:114052801-114052823 GTATCTTTGGAGAGGTTTCTTGG + Intergenic
996175118 5:120347062-120347084 GTGTCTGTGAGGAGGTTTCAGGG + Intergenic
996372829 5:122771471-122771493 GTTTCTGTGAAGATGTTTTTTGG - Intergenic
996460938 5:123742333-123742355 ATGTGTGTGGAAAGGTGTGTGGG + Intergenic
996729577 5:126704293-126704315 GTGTATGTGGAGAGGCTAGCAGG + Intergenic
997336246 5:133110802-133110824 GTGCCAGTGGGGAGCTTTGTAGG + Intergenic
997700226 5:135892595-135892617 GAGTCGGTGGTGAGGATTGTGGG + Intronic
999174982 5:149625748-149625770 GTGTGTGTGGAGAGGTGGGAGGG - Intronic
999925340 5:156369732-156369754 GTCAGTGTGCAGAGGTTTGTGGG + Intronic
1000586814 5:163110311-163110333 TTGTCTGTGGTAAGGGTTGTGGG + Intergenic
1001137544 5:169115044-169115066 GTGTCCCTGGAGAAGTTTGCAGG + Intronic
1002174055 5:177391454-177391476 GTCTCTGTGGGGAGGACTGTGGG - Intronic
1004542158 6:16561381-16561403 GTATCTGTGGAGAGGTGGGTGGG - Intronic
1005414704 6:25587394-25587416 GTGTCTGGACAGAGGCTTGTGGG + Intronic
1006303485 6:33206267-33206289 GTGTCTGTGGAGAGGTTTGTGGG + Intronic
1006379632 6:33690049-33690071 GTGTTTGTGGTGAGCTTCGTGGG + Exonic
1006771747 6:36559358-36559380 GTGACTGTGGAGAAGTTTTGAGG - Intergenic
1007079340 6:39087633-39087655 GTGTCTGGGGAAAGGTTTTGGGG - Exonic
1007311641 6:40951165-40951187 GTGAGTGTTGAGAGTTTTGTGGG - Intergenic
1007421629 6:41723319-41723341 GTGTCTTTGGGGAGGTGGGTGGG - Intronic
1007581679 6:42963721-42963743 GTGCCTGGGCAGAGGCTTGTGGG - Exonic
1007755695 6:44097803-44097825 GTGTCTGTGGACAAGTTACTTGG + Intergenic
1008378815 6:50820421-50820443 GTGTATGTGTGGAGGTATGTAGG + Intronic
1009725696 6:67533255-67533277 GGGTCTGTGGCTAGGGTTGTTGG - Intergenic
1009931365 6:70180439-70180461 GTGTCTGTGGATGTGTTTATAGG + Exonic
1011253126 6:85393834-85393856 ATGTTTGTGGAGAGGTTTTCTGG - Intergenic
1011421389 6:87177002-87177024 GTGTCTGTGGGGAGGAGTGGGGG - Intronic
1011615262 6:89192288-89192310 GTGTATGTGGAGAGGACGGTGGG - Intronic
1012813336 6:103989207-103989229 GTGTATGTGGAGTGGTTATTGGG - Intergenic
1015303754 6:131683359-131683381 GTGTCTGTGGGTAGGTTTTCAGG - Intronic
1015843291 6:137494856-137494878 GTCTCAGTGGAAAGGTTTGAGGG + Intergenic
1015991206 6:138945315-138945337 ATGTGTGTGGAGAAGTTGGTGGG + Exonic
1018049454 6:159996560-159996582 GTGTCTGCGGGGAGGTGTGGGGG + Intronic
1018698510 6:166408993-166409015 GTGTGTGTGCACAGGTGTGTGGG - Intergenic
1020263199 7:6543038-6543060 GAGTCTGTTGAGAAGTTTGGAGG - Intronic
1022317532 7:29259397-29259419 GTGAGTGTGGAGAGATCTGTAGG + Intronic
1023285640 7:38616105-38616127 GTGTCTGTGTAGATGATTGGGGG - Intronic
1023866386 7:44240394-44240416 GTGTCTGTCCAGGCGTTTGTCGG - Intronic
1024048198 7:45599587-45599609 GGGGCTGTGAGGAGGTTTGTGGG + Intronic
1025588626 7:62826168-62826190 GTATCTGTGAAGAGATTTCTAGG + Intergenic
1025731292 7:64110558-64110580 GTGTTAGTGGAGAGATTGGTAGG + Intronic
1025908703 7:65810232-65810254 GTGCCTGGTGAGAGGTGTGTGGG - Intergenic
1026670747 7:72388745-72388767 GTGTCTGTGGTCATGTATGTGGG - Intronic
1026785744 7:73300672-73300694 CTGTCTGAGGAGAGGTTGGGCGG + Intergenic
1026848636 7:73711513-73711535 GTGTCTGTAGGGAGCTTGGTGGG - Intronic
1027108321 7:75419264-75419286 CTGTCTGAGGAGAGGTTGGGTGG - Intronic
1027878547 7:83802305-83802327 GTGTCTGGGGACAGGGTTGGGGG + Intergenic
1028341513 7:89726818-89726840 GTGTCTGTGAGGATGTTTCTGGG + Intergenic
1028735535 7:94207821-94207843 GTGTGTGTGTAGAGGTGTTTAGG - Intergenic
1029796142 7:102896385-102896407 GTGGCTGTGGAGATGGTGGTTGG + Intronic
1029903471 7:104067107-104067129 GTGTCTGTGCAGACTTTTCTAGG + Intergenic
1031650592 7:124284911-124284933 GTGTCAGAGGAGGGGCTTGTTGG + Intergenic
1031808784 7:126340116-126340138 GTTTCTGTGAAGGTGTTTGTTGG - Intergenic
1032311591 7:130792435-130792457 ATGTATGTGCAGAGGTCTGTGGG - Intergenic
1033392203 7:140938841-140938863 GTGTCTGTGAGGATGTTTCTGGG + Intergenic
1033851219 7:145497923-145497945 GTCTTTGTGGAGAGGTTTTCTGG - Intergenic
1034335364 7:150319735-150319757 GGGTCAGGGGAGAGGTTGGTAGG - Intronic
1034352890 7:150428745-150428767 GTGTCTGTGGAGAGTGTGGTTGG - Intergenic
1034385353 7:150736597-150736619 GCCTCTGTGGAGAGGTTTTCTGG + Intronic
1036560645 8:9898377-9898399 GCTTCTGTGGAGAGGGTTGCGGG + Intergenic
1038609398 8:29046217-29046239 GTGTCACTGGAGCAGTTTGTAGG - Intronic
1038829485 8:31041440-31041462 GTGTCTGTGAGGATGTTTCTGGG - Intronic
1040079226 8:43270818-43270840 GAGTTTCTGGAGATGTTTGTTGG - Intergenic
1040537684 8:48323848-48323870 GTTTCTGTGAAGATGTTTCTGGG + Intergenic
1041967286 8:63694172-63694194 AGCTCTCTGGAGAGGTTTGTAGG - Intergenic
1043384032 8:79730903-79730925 GTTTCTCTGGAGAGGTTTGGTGG - Intergenic
1044549075 8:93492375-93492397 GAGACTGTGGAAAGGTTTTTAGG - Intergenic
1045838844 8:106555890-106555912 GTGTCTGTGTATATGTGTGTAGG + Intronic
1046062786 8:109158850-109158872 GTGTGTGGGGAGGGGTGTGTGGG - Intergenic
1047564652 8:126030697-126030719 TTGCCTGTGGTGAGGTATGTGGG + Intergenic
1047902697 8:129441425-129441447 GTGGCTGTTGAGAGAATTGTAGG - Intergenic
1048184752 8:132229557-132229579 GTGTCTGTGGGGAGGCTTCTAGG + Intronic
1049339099 8:142102405-142102427 GTGTCAGTGCACAGGTGTGTGGG + Intergenic
1050852670 9:10307219-10307241 GTGTGTGTGGAGATGTTTGGTGG - Intronic
1050991989 9:12167327-12167349 GTATATGTGCAGAGGTTTTTTGG + Intergenic
1054337865 9:63823799-63823821 GTGTGTGTGGAGTGTATTGTGGG - Intergenic
1055367310 9:75558389-75558411 GTGTCTGTGCAGAGGAGTGGGGG - Intergenic
1056193349 9:84206138-84206160 GTGTGTGTGGGGTGGTGTGTGGG + Intergenic
1056537028 9:87537386-87537408 GTGTATGGGGAGATGTTTCTGGG + Intronic
1056753901 9:89370825-89370847 GTGTCTGGGGTGCGGTGTGTCGG + Intronic
1056754276 9:89372372-89372394 GTGTCTGGGGTGTGGTGTGTCGG + Intronic
1056957176 9:91091773-91091795 GTGGCAGTGGCGAGGTTTGCAGG - Intergenic
1057255242 9:93541083-93541105 GTGTGTGTGGTGGGGTTTGTTGG + Intronic
1057570953 9:96204004-96204026 GTGTGTGTGGAGGGATTTTTCGG - Intergenic
1059078569 9:111222176-111222198 GTGTGTGTAGAGAGATTTGTTGG - Intergenic
1061239014 9:129358512-129358534 GGCTCTGTGGGGATGTTTGTGGG - Intergenic
1061718710 9:132538015-132538037 GGGTGTGTGCAGAGGTTTGGTGG - Intronic
1061902286 9:133679069-133679091 GTGTTTGTGGAGTGGGTGGTGGG - Intronic
1203517404 Un_GL000213v1:15381-15403 GTGTGTGTAGAGAGTATTGTTGG - Intergenic
1185480166 X:440034-440056 GTGTCTGTGTATATGTCTGTGGG - Intergenic
1185519740 X:729524-729546 CTGTCTGTGGTGAGGTTTGCAGG - Intergenic
1185519828 X:729982-730004 ATGTCTGTGGTGAGTTTTGCAGG - Intergenic
1185589824 X:1268631-1268653 GTGTGTGTGTAGATGTGTGTGGG + Intergenic
1185862795 X:3594665-3594687 GTGTCGGTGGGTATGTTTGTAGG - Intergenic
1186001937 X:5022288-5022310 GTGTTGGAGGAGAGGTTTGGTGG + Intergenic
1187146323 X:16640487-16640509 GTGTCTGGCGAGTGCTTTGTGGG + Intronic
1187325471 X:18282658-18282680 TTGTGTGTGTAGAGTTTTGTTGG - Intronic
1187661906 X:21556820-21556842 GTAGCTGGGTAGAGGTTTGTGGG + Intronic
1189438131 X:41010591-41010613 GAGTTCGTGGAGAGGTTTATGGG - Intergenic
1192141854 X:68652844-68652866 GTGTGTGTGGTGTGGTGTGTGGG - Intronic
1192141967 X:68653669-68653691 GTGTGTGTGGTGTGGTGTGTTGG - Intronic
1192190914 X:68990713-68990735 GTGTCTATGGAGAGGCTTCTAGG - Intergenic
1193004752 X:76603118-76603140 GTTTCTGTGGAGAGGATAATTGG + Intergenic
1193846231 X:86474664-86474686 GTGTGTGTGGAGTTGTTTCTGGG + Intronic
1194806567 X:98336225-98336247 GTGTTTTTGGACAGGCTTGTTGG - Intergenic
1195365649 X:104122831-104122853 TTGCCTGTGGAGAGGTTGGGTGG + Intronic
1197028414 X:121783250-121783272 CTCTCGGTGGAGAGGTTTGCAGG + Intergenic
1197639307 X:128950491-128950513 ATGAATGTGGAGAGGTTAGTGGG - Intergenic
1197807942 X:130415464-130415486 TTGTCTGTGGAGGGGTTCGGGGG + Intergenic
1198443667 X:136689748-136689770 GTGTCTGGGGAAAGGTTTTGAGG - Intronic
1198695354 X:139331216-139331238 GTGTCTGGGAAGGGGGTTGTGGG + Intergenic
1199308780 X:146298160-146298182 CTCTCCGTGGAGAGGCTTGTGGG + Intergenic
1201352034 Y:13054560-13054582 GTGTCTGTAGCCAGGCTTGTAGG - Intergenic
1201707800 Y:16956030-16956052 GGGTCTGGGGAGGGGTGTGTAGG - Intergenic
1202024178 Y:20502601-20502623 CCCTCTATGGAGAGGTTTGTGGG + Intergenic
1202273787 Y:23095477-23095499 ATGTCTGTGGGGAGGTTAGTGGG + Intergenic
1202292239 Y:23325200-23325222 ATGTCTGTGGGGAGGTTAGTGGG - Intergenic
1202426783 Y:24729222-24729244 ATGTCTGTGGGGAGGTTAGTGGG + Intergenic
1202444008 Y:24940872-24940894 ATGTCTGTGGGGAGGTTAGTGGG - Intergenic