ID: 1006307818

View in Genome Browser
Species Human (GRCh38)
Location 6:33235250-33235272
Sequence CACCTCACTCAGGGGAACGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1006307818_1006307827 10 Left 1006307818 6:33235250-33235272 CCAGCGTTCCCCTGAGTGAGGTG No data
Right 1006307827 6:33235283-33235305 GCAGACAGTAGCAGTGAGAAAGG No data
1006307818_1006307828 16 Left 1006307818 6:33235250-33235272 CCAGCGTTCCCCTGAGTGAGGTG No data
Right 1006307828 6:33235289-33235311 AGTAGCAGTGAGAAAGGAAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1006307818 Original CRISPR CACCTCACTCAGGGGAACGC TGG (reversed) Intergenic
No off target data available for this crispr