ID: 1006309790

View in Genome Browser
Species Human (GRCh38)
Location 6:33249574-33249596
Sequence CAGCAGCCTCCGCTCCGCGG CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1006309787_1006309790 -3 Left 1006309787 6:33249554-33249576 CCACTCTCAGCCTCAGGAAGCAG No data
Right 1006309790 6:33249574-33249596 CAGCAGCCTCCGCTCCGCGGCGG No data
1006309784_1006309790 9 Left 1006309784 6:33249542-33249564 CCGGAGCCGGATCCACTCTCAGC No data
Right 1006309790 6:33249574-33249596 CAGCAGCCTCCGCTCCGCGGCGG No data
1006309785_1006309790 3 Left 1006309785 6:33249548-33249570 CCGGATCCACTCTCAGCCTCAGG No data
Right 1006309790 6:33249574-33249596 CAGCAGCCTCCGCTCCGCGGCGG No data
1006309780_1006309790 26 Left 1006309780 6:33249525-33249547 CCGCCAATTAGGAGAGCCCGGAG No data
Right 1006309790 6:33249574-33249596 CAGCAGCCTCCGCTCCGCGGCGG No data
1006309781_1006309790 23 Left 1006309781 6:33249528-33249550 CCAATTAGGAGAGCCCGGAGCCG No data
Right 1006309790 6:33249574-33249596 CAGCAGCCTCCGCTCCGCGGCGG No data
1006309783_1006309790 10 Left 1006309783 6:33249541-33249563 CCCGGAGCCGGATCCACTCTCAG No data
Right 1006309790 6:33249574-33249596 CAGCAGCCTCCGCTCCGCGGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1006309790 Original CRISPR CAGCAGCCTCCGCTCCGCGG CGG Intergenic