ID: 1006312242

View in Genome Browser
Species Human (GRCh38)
Location 6:33268967-33268989
Sequence TAATGTCCATAGCAGGTGGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 230
Summary {0: 1, 1: 0, 2: 2, 3: 18, 4: 209}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1006312242_1006312248 18 Left 1006312242 6:33268967-33268989 CCATCCACCTGCTATGGACATTA 0: 1
1: 0
2: 2
3: 18
4: 209
Right 1006312248 6:33269008-33269030 ACTCACGTGACCAGAGCAGAAGG 0: 1
1: 0
2: 3
3: 35
4: 232
1006312242_1006312245 -7 Left 1006312242 6:33268967-33268989 CCATCCACCTGCTATGGACATTA 0: 1
1: 0
2: 2
3: 18
4: 209
Right 1006312245 6:33268983-33269005 GACATTATAACCCTTCAAACTGG 0: 1
1: 0
2: 0
3: 3
4: 80

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1006312242 Original CRISPR TAATGTCCATAGCAGGTGGA TGG (reversed) Intronic
900889121 1:5436631-5436653 TTGTGCCCATTGCAGGTGGAAGG + Intergenic
902406603 1:16187388-16187410 TAATGTAAATAGCGGGTTGATGG + Intergenic
908305796 1:62814488-62814510 TAATGTCAATGACAGGTTGATGG + Intronic
908683598 1:66689824-66689846 TGATGTCCATAGCATTTGGCTGG + Intronic
908951331 1:69567069-69567091 GAATGTTCATGGCAGGAGGAGGG + Intergenic
909136864 1:71812202-71812224 TAATGTCCTTTGCAGGGGCATGG - Intronic
909424072 1:75501161-75501183 TAATGTTCATTGGAGTTGGATGG - Intronic
909567245 1:77066946-77066968 TAATGACCATGGTAGGTGGGAGG + Intergenic
911783662 1:101916614-101916636 TACTGTCCTTAGCAGTTGAAAGG - Intronic
911885679 1:103296202-103296224 TGATGTCAAAGGCAGGTGGAAGG - Intergenic
912163980 1:107020519-107020541 AAATGTCCCCTGCAGGTGGAGGG + Intergenic
912611270 1:111047410-111047432 TAATGTACATGACAGGTTGACGG - Intergenic
912970029 1:114272436-114272458 TAATGTGCTTAGGAGGTGGAAGG - Intergenic
915709380 1:157880166-157880188 AAAGGTATATAGCAGGTGGAAGG + Intronic
916565228 1:165969898-165969920 TCATGTCCTTTGCAGGTGCATGG + Intergenic
916840455 1:168595380-168595402 TAATGTAGATGACAGGTGGATGG - Intergenic
918919481 1:190690063-190690085 TAATGTACATGACAGGTTGATGG - Intergenic
919187116 1:194166404-194166426 TTATGTGAATAGCAGATGGAAGG - Intergenic
919520900 1:198585010-198585032 TAATGTCCTTTGCAGGTACATGG - Intergenic
919664679 1:200280542-200280564 AAATGTCCACAACAGGTGAATGG - Intergenic
920291786 1:204928641-204928663 AAAGGTCCATAACAAGTGGATGG + Intronic
921276292 1:213524131-213524153 TTCTGCCCATAGCAGGTTGATGG + Intergenic
921399959 1:214711128-214711150 TAATGTAGATAACAGGTTGATGG - Intergenic
923365960 1:233261691-233261713 TGATATCCATTTCAGGTGGAAGG + Intronic
1063426779 10:5956562-5956584 AAATGTCCTTAGCAGGAGGCTGG - Intronic
1064522905 10:16222455-16222477 TAATGTCCTTTGCAGGTACATGG - Intergenic
1066129852 10:32382186-32382208 TAAGGTCCAGAGAAGGTAGAGGG + Intergenic
1066460137 10:35605918-35605940 CAAAGACCAAAGCAGGTGGAGGG + Intronic
1067679029 10:48415349-48415371 TAATGAGGATAGCAGGTGGCTGG + Intronic
1068028122 10:51674275-51674297 TAATGTACATGACAGGTTGATGG - Intronic
1069170223 10:65218491-65218513 TAATTTCCACAGCAGATGTATGG + Intergenic
1070509694 10:77149269-77149291 TAATGTACATGGCAGGGGCAGGG - Intronic
1074647936 10:115485841-115485863 TAATGTAGATAACAGGTTGATGG - Intronic
1075052006 10:119189309-119189331 TAAAGTCCATCTCAGGTAGATGG - Intergenic
1075984714 10:126774741-126774763 GAATGTCCACAGCAGGCAGAGGG - Intergenic
1076603342 10:131673612-131673634 TGCTGTCCATAGCTGATGGATGG + Intergenic
1078201264 11:9185570-9185592 TAATGTAGATAACAGGTTGATGG + Intronic
1078475948 11:11630264-11630286 TAATGTTCAAAGCTGCTGGAAGG - Intergenic
1078544396 11:12236162-12236184 TCTTGGCCATTGCAGGTGGATGG + Exonic
1080488916 11:32741757-32741779 TAATGTACATGACAGGTTGATGG - Intronic
1081936060 11:46904638-46904660 TGATTACCATAGCATGTGGAGGG - Intronic
1082560864 11:54619043-54619065 TAATGTCCTTTGCAGGGGTACGG - Intergenic
1082971234 11:59023450-59023472 TAATGTAGATGGCAGGTTGATGG + Intronic
1083313298 11:61797390-61797412 AAATGGCCATAGCAGCTAGATGG + Intronic
1086287567 11:85266502-85266524 TAATGTAGATATCAGGTTGATGG + Intronic
1086789190 11:91014373-91014395 AAATGTCCACACCAGGTGAATGG + Intergenic
1086889878 11:92245384-92245406 TAATGTAGATGGCAGGTTGATGG + Intergenic
1090088141 11:123669377-123669399 TGAGGTGCATTGCAGGTGGAGGG + Intergenic
1090577209 11:128118362-128118384 TAATGTCCTTTGCAGGAAGATGG + Intergenic
1091680452 12:2523089-2523111 TAATATGCAAAGCAGGTGGACGG + Intronic
1091959318 12:4678176-4678198 TAATGTAGATGGCAGGTTGATGG + Intronic
1093740131 12:22676107-22676129 TAATGTGCATGACAGGTTGATGG - Intronic
1093881509 12:24409161-24409183 TAATGTCCTTTGCAGGGGCATGG + Intergenic
1095322179 12:40842288-40842310 TATTGTTAATAGCAGGTAGAAGG + Intronic
1097348864 12:58525422-58525444 GAAAGGCCATTGCAGGTGGAGGG - Intergenic
1099107524 12:78515348-78515370 TAATGTAGATAACAGGTTGATGG + Intergenic
1099140577 12:78969407-78969429 TAACATCCAGAGGAGGTGGAGGG + Intronic
1099665864 12:85628518-85628540 TAATGTAGATAACAGGTTGATGG - Intergenic
1100175954 12:92031206-92031228 TAATGTAGATGGCAGGTTGATGG - Intronic
1103001363 12:117387692-117387714 TAATGTCCATACCAAGTGCTAGG - Intronic
1103998437 12:124844778-124844800 AAATGTCCATAACAGGTGCATGG - Intronic
1104741644 12:131179850-131179872 TAATGTAGATGGCAGGTTGATGG + Intergenic
1104827231 12:131721057-131721079 GCATGTCCAGAGCAGGAGGAAGG + Intronic
1105526739 13:21184882-21184904 TAATGTAGATAACAGGTTGATGG + Intergenic
1108136305 13:47366308-47366330 TAATGTAGATGGCAGGTTGAGGG - Intergenic
1109621612 13:64914967-64914989 AAATGTTCATAGAAGGTGGAGGG - Intergenic
1111348754 13:86998429-86998451 GAATGTCAATAGCAGTTGAAGGG - Intergenic
1111600004 13:90460839-90460861 GAATTTCCTTAGTAGGTGGATGG - Intergenic
1111701275 13:91693112-91693134 TAATGTCTGGAGCAGATGGACGG + Intronic
1112073342 13:95879989-95880011 TAATGTAGATGGCAGGTTGATGG - Intronic
1117640730 14:57796729-57796751 TCCTGGCCATAGCAGATGGAAGG + Intronic
1117664322 14:58040469-58040491 TAATGTCCTTTGCAGGAGCATGG - Intronic
1118719318 14:68583043-68583065 TAATGTAGATAACAGGTTGATGG + Intronic
1119129435 14:72157940-72157962 TAATGTAGATGGCAGGTTGATGG - Intronic
1119688022 14:76648485-76648507 CAATATCCAAAGCAGTTGGAAGG + Intergenic
1119822177 14:77626394-77626416 AAATGTCCATCATAGGTGGATGG - Intergenic
1119938277 14:78613644-78613666 TAGTTTCCATACCAGGTGGGAGG + Intronic
1120091618 14:80338915-80338937 TAATGTCCATAATAGGCAGATGG - Intronic
1121470177 14:94146794-94146816 TAATGTAGATGGCAGGTTGATGG - Intronic
1123469497 15:20539631-20539653 TCATATCCCTAGCAGATGGAGGG + Intronic
1123648565 15:22461068-22461090 TCATGTCCCTAGCAGATGGAGGG - Intronic
1123729775 15:23134617-23134639 TCATGTCCCTAGCAGATGGAGGG + Intronic
1123747943 15:23332099-23332121 TCATGTCCCTAGCAGATGGAGGG + Intergenic
1124280310 15:28355951-28355973 TCATATCCCTAGCAGATGGAGGG + Intergenic
1124302388 15:28555661-28555683 TCATATCCCTAGCAGATGGAGGG - Intergenic
1124508784 15:30304551-30304573 AAATGTCCATAGTTGGTGTATGG + Intergenic
1124734774 15:32234111-32234133 AAATGTCCATAGTTGGTGTATGG - Intergenic
1125058010 15:35385657-35385679 TAATGTAGATAACAGGTTGATGG + Intronic
1131378300 15:91943475-91943497 TAGTGTCCATAGCAGATGAATGG - Intronic
1142916021 17:3138886-3138908 GAATGTCAATAGCAGTTTGATGG + Intergenic
1144208443 17:12995363-12995385 GAATGTCCATAGCAGGTGTGTGG - Intronic
1145751138 17:27355894-27355916 CAGTGTCCAAAGCAGGTGCAAGG - Intergenic
1146601079 17:34216927-34216949 TAATGTAGATGGCAGGTTGATGG - Intergenic
1148138389 17:45310472-45310494 TAATGTCAGTAGAAGGTGGGTGG + Intronic
1153000428 18:450455-450477 TAATGGCCAGAGCAGGAGGAAGG - Intronic
1155307003 18:24488251-24488273 TAATGTGGATAGGAGGTGGATGG - Intergenic
1156309353 18:35908215-35908237 TTAAGTCTGTAGCAGGTGGAGGG + Intergenic
1157647647 18:49292923-49292945 TAATGTAGATGGCAGGTTGATGG - Intronic
1160761683 19:788716-788738 TTTTATCCATGGCAGGTGGAAGG - Intergenic
1161383196 19:3977328-3977350 CAGTGTCCAGAGCAGGTGGTCGG - Exonic
1162842875 19:13369161-13369183 CAACATCCATAGCAGCTGGAGGG - Intronic
1163880051 19:19911519-19911541 TAATGCCCATATGAAGTGGAAGG - Intronic
1166039776 19:40194819-40194841 TAAATTCCATAGCTGGGGGAGGG - Intronic
1167161434 19:47769804-47769826 TTATGTCTATGGCGGGTGGATGG - Intergenic
927798636 2:26075826-26075848 AAATGTCCTTAAAAGGTGGAGGG + Intronic
935923123 2:108036283-108036305 TAATGTCCTTTGCAGGTACATGG - Intergenic
937465215 2:122126366-122126388 ACATGTCCAGAGCAGGAGGAAGG - Intergenic
938931372 2:136089244-136089266 GAAAGTCCATTCCAGGTGGAGGG + Intergenic
939357836 2:141126958-141126980 TAATGTAGATGGCAGGTTGATGG - Intronic
939924582 2:148157235-148157257 TAATGTAGATGACAGGTGGATGG - Intronic
940373330 2:152925752-152925774 TGATCACCATAGCAGGGGGAAGG - Intergenic
942997763 2:182285346-182285368 AAATGTCCTTAGCAGAGGGAGGG - Intronic
944671713 2:201999589-201999611 TAATGTCTATGGTAGGTGGGAGG + Intergenic
945389558 2:209247374-209247396 TAATGTACATGACAGGTTGATGG + Intergenic
945831017 2:214784919-214784941 TAATGTACATGACAGGTTGATGG + Intronic
946623950 2:221591155-221591177 TAATGTCATTAGCATGGGGAGGG - Intergenic
947365224 2:229387369-229387391 TAATGTAGATAACAGGTTGATGG + Intronic
1172047973 20:32094321-32094343 AAATGTCCATAGCAGGAGGATGG + Intronic
1172487557 20:35307485-35307507 AAATGTCCTTAGCTGGTGGCTGG - Intronic
1178949592 21:36975282-36975304 TTATTTCCATAGCAGTTGGTAGG + Intronic
1180600765 22:17013703-17013725 TAATGTCCATGACAGATGAATGG + Intergenic
1181011728 22:20044765-20044787 TGATGTCCTTGGAAGGTGGAAGG + Intronic
1181863331 22:25836085-25836107 TAAAGTCCATAGCACTTGGTGGG + Intronic
1182767550 22:32769281-32769303 TGATGACCATAGCAGGTGGAGGG - Intronic
1183044974 22:35212190-35212212 AAATGTCCTCAGCAGCTGGAAGG + Intergenic
1184798398 22:46745434-46745456 TAATGGCCGAGGCAGGTGGAAGG - Intergenic
949222268 3:1650037-1650059 TAATGTAGATGGCAGGTTGATGG - Intergenic
951329898 3:21354009-21354031 TAATGTAGATGGCAGGTTGATGG + Intergenic
951450511 3:22832299-22832321 TAATGTAGATAACAGGTTGATGG + Intergenic
952440529 3:33323408-33323430 TAATGTAGATGGCAGGTTGATGG - Intronic
955997837 3:64696054-64696076 CAAAGTGCATAGCAGGTGGTAGG - Intergenic
957390873 3:79567088-79567110 TAATGTCCATTGCAGGGGCAGGG + Intronic
958729870 3:97950099-97950121 TAATGTCTATACCCGGTGGCTGG - Intronic
961515184 3:127427810-127427832 TCATGTTCATAGAAGGTGGGAGG - Intergenic
966568225 3:181407748-181407770 TAATGTAGATAACAGGTTGATGG + Intergenic
970031046 4:11675140-11675162 AATTGTCAATAGCAGGAGGAAGG + Intergenic
970288621 4:14547655-14547677 TAATATCCATGGCATGTGGTTGG - Intergenic
971274331 4:25181739-25181761 TAATGTACCTAGCAGGTGCCAGG + Intronic
971768772 4:30869382-30869404 TAATGTAGATGGCAGGTTGATGG - Intronic
972123567 4:35736134-35736156 TAATATCCAAAGCAACTGGATGG + Intergenic
973300631 4:48579356-48579378 TAAAGTCCATGGTAGGTTGAAGG + Intronic
974658265 4:64853184-64853206 TAATGTGGATGGCAGGTTGATGG + Intergenic
974851159 4:67406464-67406486 TAATGTAGATAACAGGTTGATGG - Intergenic
974920812 4:68237036-68237058 TAATGTAGATGGCAGGTTGATGG - Intronic
975639341 4:76483828-76483850 TAATGTCCTTTGCAGGGGCATGG + Intronic
975759545 4:77605402-77605424 TCACGTCCCTAGCATGTGGAAGG - Intronic
976809318 4:89083938-89083960 TAATGTACATGACAGGTTGATGG - Intronic
977112371 4:92974523-92974545 TAATGTCCATTGCAGGGACATGG + Intronic
977325202 4:95565800-95565822 AAATGTCCATTGCAGGCGAATGG - Intergenic
978394642 4:108265658-108265680 TAATGTGCACACCTGGTGGAAGG - Intergenic
980664737 4:135916585-135916607 TAATGTAGATAGCAGGTTGATGG + Intergenic
981409171 4:144407524-144407546 TAATGTAGATAACAGGTTGATGG + Intergenic
982712410 4:158769831-158769853 TAATTTCCACATCATGTGGAAGG + Intronic
983080258 4:163376430-163376452 TAATGTTCATATCAGTTGGTAGG + Intergenic
983267318 4:165521481-165521503 TTATGTCCTTAGGTGGTGGAAGG - Intergenic
983526254 4:168763065-168763087 TAATGTAGATAACAGGTTGATGG + Intronic
983587356 4:169370307-169370329 TAATGTCCAAAGCAGCTGGCTGG - Intergenic
983747409 4:171219012-171219034 TAATCTCCAATGCAGGTGGTAGG + Intergenic
985091795 4:186370608-186370630 TAATGTAGATGACAGGTGGATGG + Intergenic
986152917 5:5144019-5144041 TAATGTAGATGGCAGGTTGATGG + Intronic
986339535 5:6777368-6777390 TATGGTCCATCTCAGGTGGATGG - Intergenic
987500816 5:18707561-18707583 TAATGTAGATGGCAGGTTGATGG - Intergenic
988543125 5:32130228-32130250 TAATGTCAATGGCAGGTGTTAGG + Intronic
989705170 5:44321149-44321171 AAATGTCCTTAGCAGCAGGAAGG - Intronic
992949710 5:81846622-81846644 TGATGTGAATACCAGGTGGATGG - Intergenic
993083014 5:83325615-83325637 TCATGTCCTTTGCAGGTGCATGG - Intronic
993793583 5:92237506-92237528 TGCTGGCCATAGCACGTGGATGG + Intergenic
994276622 5:97845981-97846003 TAATGTAGATAACAGGTCGATGG - Intergenic
995684900 5:114761781-114761803 TAATTTTCATAGAAGGTGTAAGG + Intergenic
996960157 5:129237429-129237451 TAATGTAGATAACAGGTTGATGG - Intergenic
997419575 5:133755387-133755409 TCCTGTCTATAGCAGGTGGAGGG - Intergenic
997876473 5:137552676-137552698 TAATGTCCTTTGCAGGGAGATGG + Intronic
998905570 5:146900937-146900959 TCATGTCCTTTGCAGGGGGATGG - Intronic
999921497 5:156326494-156326516 AAATGTACATATCAGGTTGAGGG + Intronic
1005068732 6:21844610-21844632 TAATGGCCAGAGCAGGAGTAGGG - Intergenic
1006312242 6:33268967-33268989 TAATGTCCATAGCAGGTGGATGG - Intronic
1007180204 6:39923982-39924004 TCCTGTCCAAAGCAGCTGGACGG + Intronic
1009755218 6:67930113-67930135 TAATGTAGATGGCAGGTTGATGG + Intergenic
1009845664 6:69131724-69131746 TAATGTAGATAACAGGTCGATGG - Intronic
1011831863 6:91383931-91383953 AAATGTCCATAGCAAGATGATGG - Intergenic
1014790530 6:125667104-125667126 AAATCTCCAGAGCAGGTGGGAGG + Intergenic
1017352622 6:153459604-153459626 AAATGTCCATGGCAGGTGTGAGG + Intergenic
1021535594 7:21701001-21701023 TAATGTAGATAACAGGTTGATGG + Intronic
1024835654 7:53514915-53514937 TAATTTCCATAGGCGGTGCAAGG - Intergenic
1024851381 7:53721235-53721257 CAATGACCATGGGAGGTGGAGGG + Intergenic
1029373096 7:100161769-100161791 TAATGTCCTTTGCAGGTGCATGG + Intronic
1030718905 7:112845902-112845924 TAATGTCCATTGCAGGAACATGG + Intronic
1030919284 7:115361208-115361230 TAATGTAGATGGCAGGTTGATGG - Intergenic
1033485338 7:141783594-141783616 TAAGGTCAACAGCAGGAGGAGGG + Intronic
1035612918 8:980249-980271 AAATATCCATAGAAGGTGCAGGG + Intergenic
1037188528 8:16093801-16093823 TAATGTCATTAGGAGGTGGGAGG - Intergenic
1037243950 8:16809365-16809387 TAATGTCCTGAGCACGTGTAAGG + Intergenic
1037284850 8:17288319-17288341 TAATGTCAATGACAGGTTGATGG - Intronic
1039809581 8:41034391-41034413 TAATGTAGATAACAGGTTGATGG + Intergenic
1042720228 8:71819522-71819544 TAATGGCCATCACAGGTGGGCGG - Intergenic
1043069457 8:75620493-75620515 TATTGTCCAGAGAAGGTGGAAGG - Intergenic
1043319465 8:78965110-78965132 TAATCACCATGGCAGGAGGAAGG - Intergenic
1043619302 8:82168907-82168929 TAATGTCCTTTGCAGGGGCATGG - Intergenic
1043646665 8:82530165-82530187 TAATGTAAATGGCAGGTTGATGG - Intergenic
1044501306 8:92961602-92961624 TATTACCTATAGCAGGTGGAAGG - Intronic
1048910891 8:139134038-139134060 TAATGTAGATAACAGGTTGATGG - Intergenic
1049060823 8:140274756-140274778 TAATGTCATTAGCATGGGGAGGG + Intronic
1049133869 8:140875791-140875813 TAATGCCCAAGGCAGGTGTAGGG + Intronic
1050071544 9:1820237-1820259 TAATGTAGATGACAGGTGGATGG - Intergenic
1050794588 9:9522323-9522345 TAAAGCCCATAGTAGATGGAAGG + Intronic
1052505973 9:29355076-29355098 TAATGTCCTTTGCAGGTACATGG - Intergenic
1052566903 9:30166119-30166141 TAATGTCCTTAGCAGGGACATGG - Intergenic
1052935388 9:34088773-34088795 TCCTGTGCCTAGCAGGTGGAGGG - Intronic
1058092669 9:100823532-100823554 TAATGTAGATAACAGGTTGATGG - Intergenic
1058131888 9:101263047-101263069 TAATGTACATGACAGGTTGATGG + Intronic
1058229136 9:102404689-102404711 AAATGTCCTTAGCAGGAGGCAGG - Intergenic
1062120228 9:134830138-134830160 TACTGACTATACCAGGTGGAAGG - Intronic
1062430585 9:136525335-136525357 TTATGACCACAGCAGGTGGCTGG - Intronic
1188489444 X:30722382-30722404 TAATGTCCAGAGCGGGTATATGG + Intronic
1190993858 X:55585034-55585056 TTCAGTCCATAGCAGGTGGAAGG - Intergenic
1190994741 X:55595312-55595334 TAATGTCCATAGCAAATATAAGG - Intergenic
1191207273 X:57848243-57848265 TAATGTACATGACAGGTTGATGG + Intergenic
1192045619 X:67670695-67670717 TAATGTATATGGCAGGTTGATGG - Intronic
1193342030 X:80359679-80359701 TAATGTAGATGGCAGGTTGATGG + Intronic
1193830507 X:86283564-86283586 TAATGTCCTTTGCAGGGAGATGG + Intronic
1194913838 X:99680452-99680474 TAATGTAGATAACAGGTTGATGG + Intergenic
1195074114 X:101309998-101310020 AAATGTCCATAAGAGGTGAATGG - Intergenic
1195380497 X:104266379-104266401 TAAATTCCATAACAGGTGAATGG - Intergenic
1196272566 X:113729811-113729833 TAATGTACATGACAGGTTGATGG - Intergenic
1196591942 X:117495729-117495751 TAATGTAGATAACAGGTTGATGG + Intergenic
1198135438 X:133745054-133745076 TAATGTAGATAACAGGTTGATGG + Intronic
1199410603 X:147518186-147518208 TAATGTCCTTTGCAGGGAGATGG - Intergenic
1200306943 X:155035904-155035926 AAATGTCCATCAAAGGTGGATGG - Intronic
1201252189 Y:12070494-12070516 TAATGTAGATAACAGGTTGATGG - Intergenic
1201893097 Y:18963849-18963871 TAATGTAGATGACAGGTGGATGG + Intergenic