ID: 1006313846

View in Genome Browser
Species Human (GRCh38)
Location 6:33279033-33279055
Sequence GAGGCCATTCTAGGATCGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 50
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 44}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1006313846_1006313851 -10 Left 1006313846 6:33279033-33279055 CCCTCCGATCCTAGAATGGCCTC 0: 1
1: 0
2: 0
3: 5
4: 44
Right 1006313851 6:33279046-33279068 GAATGGCCTCATGCTTGGCAAGG 0: 1
1: 0
2: 0
3: 23
4: 142
1006313846_1006313854 -7 Left 1006313846 6:33279033-33279055 CCCTCCGATCCTAGAATGGCCTC 0: 1
1: 0
2: 0
3: 5
4: 44
Right 1006313854 6:33279049-33279071 TGGCCTCATGCTTGGCAAGGGGG 0: 1
1: 0
2: 0
3: 16
4: 225
1006313846_1006313859 4 Left 1006313846 6:33279033-33279055 CCCTCCGATCCTAGAATGGCCTC 0: 1
1: 0
2: 0
3: 5
4: 44
Right 1006313859 6:33279060-33279082 TTGGCAAGGGGGAGGGGAACAGG 0: 1
1: 0
2: 8
3: 49
4: 665
1006313846_1006313858 -2 Left 1006313846 6:33279033-33279055 CCCTCCGATCCTAGAATGGCCTC 0: 1
1: 0
2: 0
3: 5
4: 44
Right 1006313858 6:33279054-33279076 TCATGCTTGGCAAGGGGGAGGGG 0: 1
1: 0
2: 2
3: 15
4: 270
1006313846_1006313857 -3 Left 1006313846 6:33279033-33279055 CCCTCCGATCCTAGAATGGCCTC 0: 1
1: 0
2: 0
3: 5
4: 44
Right 1006313857 6:33279053-33279075 CTCATGCTTGGCAAGGGGGAGGG 0: 1
1: 0
2: 1
3: 19
4: 206
1006313846_1006313853 -8 Left 1006313846 6:33279033-33279055 CCCTCCGATCCTAGAATGGCCTC 0: 1
1: 0
2: 0
3: 5
4: 44
Right 1006313853 6:33279048-33279070 ATGGCCTCATGCTTGGCAAGGGG 0: 1
1: 0
2: 0
3: 11
4: 144
1006313846_1006313852 -9 Left 1006313846 6:33279033-33279055 CCCTCCGATCCTAGAATGGCCTC 0: 1
1: 0
2: 0
3: 5
4: 44
Right 1006313852 6:33279047-33279069 AATGGCCTCATGCTTGGCAAGGG 0: 1
1: 0
2: 0
3: 11
4: 132
1006313846_1006313856 -4 Left 1006313846 6:33279033-33279055 CCCTCCGATCCTAGAATGGCCTC 0: 1
1: 0
2: 0
3: 5
4: 44
Right 1006313856 6:33279052-33279074 CCTCATGCTTGGCAAGGGGGAGG 0: 1
1: 0
2: 0
3: 14
4: 170

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1006313846 Original CRISPR GAGGCCATTCTAGGATCGGA GGG (reversed) Intronic
905861700 1:41356320-41356342 GAGGTCATTCTAGAATGGAATGG + Intergenic
907594976 1:55711406-55711428 AAGGCCATCCTAGAATGGGATGG + Intergenic
909035102 1:70588315-70588337 GAGGCAATTCAAGGATAAGATGG + Intergenic
1081690695 11:45075871-45075893 CAGGCCATCATAGGATCTGAGGG + Intergenic
1085736552 11:79044106-79044128 GAGGCCATTCTTTAATCTGATGG - Intronic
1098366408 12:69707799-69707821 AATGCCCTTCTAGGATAGGAGGG + Intergenic
1100283165 12:93138147-93138169 CAGCCCATTCTAGGCTGGGAAGG - Intergenic
1117562263 14:56952907-56952929 GAGCCCTTTCTAGGAGGGGAGGG - Intergenic
1119780664 14:77274896-77274918 GAGGCCTTTCTGGGAGCAGAGGG + Intergenic
1129762457 15:78138061-78138083 GAGGCCATTCTAGAAGCAGTTGG - Intronic
1145771640 17:27497460-27497482 GAGGCCATTCAAGGACTGAAAGG - Intronic
1146372697 17:32275366-32275388 GGGGCCATTCTGGAATGGGAAGG + Intronic
1149072026 17:52555058-52555080 GAGGAACTTCTAGGATCTGAGGG + Intergenic
1158706544 18:59797455-59797477 GAGGCCAGTGTAGGATCAAATGG + Intergenic
1162105226 19:8366188-8366210 GAGGCCAAACTAGGATGGGACGG - Exonic
934965434 2:98717450-98717472 GAGTCCAATCTAGGATCCCATGG - Intronic
940561702 2:155305175-155305197 AAGGCCATTCTATGATCTGACGG - Intergenic
941027274 2:160470875-160470897 GAGACCATTCTTGGAACTGAAGG - Intronic
1172160268 20:32863144-32863166 GAGGGCACTCTAGGATGGCAGGG - Intronic
1178374659 21:32056865-32056887 GAGGACATTCTTGGAAGGGACGG + Intergenic
1180604702 22:17048648-17048670 CAGGGCATTCTAGGACAGGATGG + Intergenic
1180962525 22:19768410-19768432 GAGGCCAGTCTAGGGTGGGAGGG + Intronic
1182300758 22:29335660-29335682 GAGGCCATTGCAGGATTGGAAGG - Intronic
1183090762 22:35520285-35520307 GAGGCCAATCTGGGCTCGGCAGG + Intergenic
1184902396 22:47456072-47456094 GTGGCCACCCTAGGATGGGATGG + Intergenic
949291049 3:2466093-2466115 GAGGCCATCCTATGTTCTGATGG - Intronic
950466364 3:13157451-13157473 GAGGCCATTCAAGGGTCTCAGGG + Intergenic
952846310 3:37690674-37690696 GAGGCCATGCTAGGAGAGAAGGG + Intronic
977112477 4:92975426-92975448 GTGGCCATTATAGGTTAGGAAGG - Intronic
985277698 4:188254559-188254581 GAGGCCATTCTGGAGTAGGATGG - Intergenic
986499442 5:8383739-8383761 GAGGCAATTCAAGGTTCTGAAGG + Intergenic
993344586 5:86766687-86766709 GTGGCCATGCTAGGATTAGAAGG - Intergenic
994023099 5:95050833-95050855 GAGGTCATCCTAGGGTAGGATGG + Intronic
995418538 5:111936530-111936552 GAGGTCATACTGGGATAGGATGG - Intronic
999410003 5:151342412-151342434 GAGGGCTTTCTAGGATGGAACGG - Intronic
1001238710 5:170051483-170051505 GACGCCAAGCTAGGATCTGATGG - Intronic
1004690762 6:17990221-17990243 GAGGCCATACTGGGTTAGGATGG + Intergenic
1006313846 6:33279033-33279055 GAGGCCATTCTAGGATCGGAGGG - Intronic
1019774508 7:2904488-2904510 GAGGCCATGCTAGGGCCGGAAGG - Intergenic
1022655743 7:32318298-32318320 GAGGCCATTCGGGGTTTGGAGGG - Intergenic
1035637550 8:1157788-1157810 AAGGTCATCCTGGGATCGGAGGG + Intergenic
1043961918 8:86426606-86426628 GAGGCCCTTGTAGGATCTCAGGG + Intronic
1044208358 8:89519251-89519273 GAGGCCATTCTGGGTTAGGGTGG - Intergenic
1046629651 8:116610679-116610701 GATGCCATGCGAGGATCAGATGG + Intergenic
1046986577 8:120395149-120395171 GAGTCTATTGTAGGATGGGAAGG - Intronic
1047863094 8:128990567-128990589 GAGGTCATGCTGGGATAGGATGG + Intergenic
1057733092 9:97628910-97628932 GAGGCCAATCTGGAATCTGAAGG - Intronic
1057973585 9:99580435-99580457 GTGGCCATTCTATGATCTGCAGG - Intergenic
1188657647 X:32717657-32717679 GAGACCATTCTAGGCTCTGGAGG - Intronic
1192450773 X:71243401-71243423 AAGCCCATTCTAGGAGGGGAGGG - Intronic