ID: 1006316157

View in Genome Browser
Species Human (GRCh38)
Location 6:33293122-33293144
Sequence GGTGCAGAAGAGGCCTCCGG GGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 235
Summary {0: 1, 1: 0, 2: 4, 3: 20, 4: 210}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1006316157_1006316164 -9 Left 1006316157 6:33293122-33293144 CCCCCGGAGGCCTCTTCTGCACC 0: 1
1: 0
2: 4
3: 20
4: 210
Right 1006316164 6:33293136-33293158 TTCTGCACCCCCACTCAGCGGGG 0: 1
1: 0
2: 0
3: 5
4: 83
1006316157_1006316171 11 Left 1006316157 6:33293122-33293144 CCCCCGGAGGCCTCTTCTGCACC 0: 1
1: 0
2: 4
3: 20
4: 210
Right 1006316171 6:33293156-33293178 GGGAGCCACAGGAGGCTGAGCGG 0: 1
1: 0
2: 7
3: 87
4: 541
1006316157_1006316168 0 Left 1006316157 6:33293122-33293144 CCCCCGGAGGCCTCTTCTGCACC 0: 1
1: 0
2: 4
3: 20
4: 210
Right 1006316168 6:33293145-33293167 CCCACTCAGCGGGGAGCCACAGG 0: 1
1: 0
2: 0
3: 8
4: 158
1006316157_1006316172 14 Left 1006316157 6:33293122-33293144 CCCCCGGAGGCCTCTTCTGCACC 0: 1
1: 0
2: 4
3: 20
4: 210
Right 1006316172 6:33293159-33293181 AGCCACAGGAGGCTGAGCGGCGG 0: 1
1: 0
2: 3
3: 30
4: 326
1006316157_1006316163 -10 Left 1006316157 6:33293122-33293144 CCCCCGGAGGCCTCTTCTGCACC 0: 1
1: 0
2: 4
3: 20
4: 210
Right 1006316163 6:33293135-33293157 CTTCTGCACCCCCACTCAGCGGG 0: 1
1: 0
2: 2
3: 23
4: 263
1006316157_1006316174 28 Left 1006316157 6:33293122-33293144 CCCCCGGAGGCCTCTTCTGCACC 0: 1
1: 0
2: 4
3: 20
4: 210
Right 1006316174 6:33293173-33293195 GAGCGGCGGTGACCTCGAGAAGG 0: 1
1: 0
2: 0
3: 4
4: 34
1006316157_1006316170 3 Left 1006316157 6:33293122-33293144 CCCCCGGAGGCCTCTTCTGCACC 0: 1
1: 0
2: 4
3: 20
4: 210
Right 1006316170 6:33293148-33293170 ACTCAGCGGGGAGCCACAGGAGG 0: 1
1: 0
2: 2
3: 18
4: 208

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1006316157 Original CRISPR GGTGCAGAAGAGGCCTCCGG GGG (reversed) Exonic
900006357 1:56396-56418 GTTGCAGAAGAGACCTCTGTGGG + Intergenic
900979847 1:6040154-6040176 GGTGCAGAAGAGACCGCCCAGGG - Intronic
901004368 1:6164770-6164792 GATGGACAAGAGGCCTCCAGAGG - Intronic
903333768 1:22611669-22611691 GGTGCTGAAGCGGCATCCGCTGG + Intergenic
904358806 1:29959407-29959429 GGTGCAGTAGAGGCTGCCTGTGG + Intergenic
905210943 1:36373898-36373920 GGAGCAGAGCAGGCCTCAGGGGG - Intronic
905409077 1:37755932-37755954 GGTGCAGACTAGCCCTCAGGAGG + Intronic
905654686 1:39678573-39678595 GGGACAGAAGAGGCCTGGGGAGG - Intergenic
906297138 1:44655725-44655747 GGCTCAGAAGTGGCCTCTGGTGG - Intronic
907242387 1:53087971-53087993 GGGGCAGGCGAGGCCTCCAGGGG - Exonic
908490814 1:64642388-64642410 GTGGCAGAAGAGGCTTCAGGTGG - Intronic
911565169 1:99455759-99455781 GGTGCAGCAGAGACTCCCGGAGG + Intergenic
915111519 1:153566980-153567002 GGTGTAGAAGAGGACACTGGGGG - Intronic
915463981 1:156085232-156085254 GGTGCAGAGGAGGCCCAGGGTGG + Intronic
917289272 1:173455466-173455488 GGTGAAGAAGAAACCTCCGGGGG + Intergenic
917969961 1:180199986-180200008 GGTGGAGGAGAGGGCTCCAGGGG + Exonic
920700829 1:208217092-208217114 GGTGTAGAAGAGGTCTCCAGCGG + Exonic
1062835083 10:629993-630015 GGTGCAGGTGTGGCCCCCGGGGG - Intronic
1063484576 10:6407297-6407319 GGGGCATAAGAGGCATCTGGAGG + Intergenic
1066808533 10:39291998-39292020 GGAGCACAAGAGGCCTTTGGTGG - Intergenic
1071976979 10:90964944-90964966 GGTGCAGTAGAGGCCACCCTGGG - Intergenic
1072636326 10:97180814-97180836 GGGGCAGAAGAGAGCTCGGGAGG - Intronic
1074041599 10:109794815-109794837 GGTGCACAAGAGGATTCCTGGGG + Intergenic
1074527947 10:114277988-114278010 GGTGCTGAAGAGGCCGTTGGTGG - Exonic
1076176879 10:128374993-128375015 GGTCAAGAAGAAGCCTCCAGAGG - Intergenic
1076669431 10:132111491-132111513 GGTGCAGAAGAGGTCAGCAGAGG + Intronic
1083201388 11:61123085-61123107 GCTGCACTAGAGTCCTCCGGAGG + Intronic
1083741866 11:64715570-64715592 GGGGCAGAAAAGGCCTCAGAAGG + Intronic
1084406454 11:68976767-68976789 GGGGAAGAAGAGGCCACAGGGGG + Intergenic
1084419390 11:69052783-69052805 GCAGCAGCAGAGGCCTCAGGAGG - Intronic
1087840913 11:102920409-102920431 GGTGCAAAAGTTGCATCCGGTGG + Intergenic
1088783981 11:113164135-113164157 GGTGGAGAAGAGGACTCCATGGG + Intronic
1089814196 11:121158004-121158026 GGTGCGGAAGACGCCGCCGCCGG - Exonic
1091623897 12:2108300-2108322 GCTGCAGAACAGGCCCCCCGAGG + Intronic
1094846769 12:34364766-34364788 GGTGAAGAAGAGGCCTACCACGG - Intergenic
1099019410 12:77384787-77384809 GGTGCAGAAAACTCCTCTGGAGG + Intergenic
1101333708 12:103777903-103777925 GCTGCAGTGGAGTCCTCCGGGGG + Exonic
1101968258 12:109295336-109295358 GGAGCAGAACAGGCCTTGGGAGG - Intronic
1104612758 12:130242879-130242901 ATTGCAGAAGAGGCCTCCTGGGG - Intergenic
1105929008 13:25034384-25034406 GGTGGAGAGGAGGCCCCAGGAGG - Intergenic
1106127737 13:26914135-26914157 GGGGCAGAAGAGGCCTCTGTGGG - Intergenic
1106188289 13:27427619-27427641 GGTGCAGAAGAGTCCTCTTTAGG + Intronic
1110469387 13:75841900-75841922 GGAGCAGAAGCGTCCTGCGGAGG + Exonic
1113055329 13:106260834-106260856 GCTGCAGAAGAGGCCTGGGGTGG - Intergenic
1114032242 14:18587631-18587653 GGTGGACATGAGGCCTCAGGTGG + Intergenic
1114077020 14:19166661-19166683 GGTGGACATGAGGCCTCAGGTGG + Intergenic
1114085140 14:19232907-19232929 GGTGGACATGAGGCCTCAGGTGG - Intergenic
1114341633 14:21751432-21751454 GAAGCAGAAGAAGCCTCTGGTGG + Intergenic
1118373389 14:65156713-65156735 GGGGCAGAAGAGGCTGCCTGAGG + Intergenic
1120178325 14:81318340-81318362 GGAGCAGAAGACGGCTCCAGAGG + Intronic
1122657764 14:103273642-103273664 GGTGCGGCAGAGGCGTCCGCTGG - Intergenic
1122817070 14:104319152-104319174 GGGGCAGCAGAGGGCTCTGGGGG - Intergenic
1128293772 15:66499499-66499521 GAAGCAGAAGAAGCCTCTGGTGG - Exonic
1128311213 15:66632635-66632657 GGGGCAGAAGAGGCCTGTTGGGG - Intronic
1129227772 15:74179898-74179920 GGTGGAGCAGAGCCCTCCTGAGG + Intronic
1129737177 15:77972946-77972968 GGGGCAGAAGAACCCTCAGGAGG + Intergenic
1129848901 15:78780689-78780711 GGGGCAGAAGAACCCTCAGGAGG - Intronic
1131367811 15:91854225-91854247 GGTGCAGAGGCGGCCGCCGGGGG + Intronic
1131961255 15:97792402-97792424 GGGTCAGAGGGGGCCTCCGGTGG - Intergenic
1132209239 15:100008069-100008091 GGCCCAGAAGAGGCCTCAGGGGG + Intronic
1132447164 15:101934562-101934584 GTTGCAGAAGAGACCTCTGTGGG - Intergenic
1135546752 16:23371715-23371737 GGTGCAGAAAGGGCTTCCTGGGG + Intronic
1138220928 16:55249835-55249857 GGTGCAGAAGTGGCCTTCGGGGG + Intergenic
1138436619 16:57004208-57004230 GGTGCAGGAGAGGCCTAGGAGGG + Intronic
1141464318 16:84196252-84196274 GGTTCGGAAGGGGCCACCGGGGG - Exonic
1142614161 17:1125302-1125324 GGAGCAGAAGGGGCCCCCGGAGG - Exonic
1142640195 17:1280974-1280996 GGAGCTGCAGAGGGCTCCGGAGG - Intronic
1142688969 17:1593358-1593380 GGTGAAGAAGGGGCCTCATGGGG - Intronic
1142695012 17:1628727-1628749 GGGGCAGAAGCGGCCGCCGAAGG - Intronic
1143369360 17:6428840-6428862 GGGCCAGAAGAGGCAGCCGGAGG - Intronic
1143481181 17:7228077-7228099 GGGGAAGAGGAGGCCTCAGGAGG + Intronic
1144639234 17:16928371-16928393 GGTGAAGAAGAGGCTTCCTCAGG + Intergenic
1145249174 17:21288070-21288092 GGGGCAGCGGAGGCTTCCGGCGG + Intronic
1146892660 17:36516066-36516088 GGTGGAGAAGAGAGCTCTGGTGG - Intronic
1150830428 17:68513132-68513154 GGTGGCGAGGAGGCCTCAGGGGG - Intronic
1151679208 17:75614887-75614909 GGGGCAGCAGAGGCCCCGGGGGG - Intergenic
1152070704 17:78132350-78132372 TGTGCCGAAGAGGCCTGCAGTGG - Exonic
1152303487 17:79508516-79508538 GGTGCTGCAGAGGCCTGTGGGGG - Intronic
1152719485 17:81915936-81915958 GGTGCCAGAGAGGCTTCCGGAGG - Intronic
1154313703 18:13286828-13286850 TGTGGAGAAGAGGCCTGGGGTGG + Intronic
1156171648 18:34493640-34493662 GGTGCAGAGGAGCCCGCCGCGGG + Intronic
1157359680 18:46965443-46965465 GGTGGAGAAGAAGTCTCTGGTGG + Intronic
1157361273 18:47024962-47024984 GGTGGAGAAGAAGTCTCTGGTGG + Intronic
1157362263 18:47030877-47030899 GGTGGAGAAGAAGTCTCTGGTGG + Intronic
1157504541 18:48217391-48217413 GCTGCAGGAGAGGCCTCCGCGGG - Intronic
1157578167 18:48757919-48757941 GCGGCAGCAGAGACCTCCGGGGG + Exonic
1160638112 19:97971-97993 GTTGCAGAAGAGACCTCTGTGGG + Intergenic
1160968027 19:1755073-1755095 GGGGCAGAAGCGGCGACCGGGGG - Intronic
1161003197 19:1921441-1921463 GGTGCAGCAGGGGCCCCCGGTGG + Intronic
1162861268 19:13507101-13507123 GGAGCAGAAGAGGCAGCCGTTGG - Intronic
1163665144 19:18599731-18599753 GGTCCAGTAGAGGCCCTCGGCGG + Exonic
1165020872 19:32922953-32922975 AGTGCAGAAGGGGCTTTCGGAGG + Intronic
1166852820 19:45768606-45768628 GGTTCGGAAGCGGCCTCGGGGGG + Exonic
925309649 2:2873570-2873592 GGTGCAGAAGAAGCACCAGGTGG + Intergenic
926411523 2:12608042-12608064 GGTGAAGGAGAAGCCTCCTGTGG - Intergenic
926423195 2:12718117-12718139 GGAGCAGACGAGGTATCCGGCGG + Exonic
928130105 2:28643000-28643022 GGTGCAGGAGAGGTGGCCGGAGG + Exonic
928582080 2:32719005-32719027 GGGGCAGAGGAGGCATCCAGAGG + Intronic
930215597 2:48693166-48693188 GGTGAAGAAAAGGCCACTGGAGG + Intronic
932226295 2:70043675-70043697 GGCGCAAAAGAGGCCACCAGTGG - Intergenic
932404219 2:71503069-71503091 GGTGCAGGAGAGCCCTCGTGGGG + Intronic
932768026 2:74483345-74483367 GGTGCAGCAGCGACCTCCAGTGG - Exonic
935702182 2:105822255-105822277 GGAGCAGCAGAGGCCCTCGGGGG - Intronic
936314504 2:111413019-111413041 GATGCAGAGGAGGCCTCAGCTGG + Intergenic
938491626 2:131764171-131764193 GGTGGACATGAGGCCTCAGGTGG + Intronic
938495941 2:131798171-131798193 GGTGGACATGAGGCCTCAGGTGG - Intronic
941678105 2:168365905-168365927 TGAGCAGAAGAGGCATCCTGAGG + Intergenic
941705261 2:168651606-168651628 GGTGCAGGAGAGGTGTCAGGGGG + Intronic
945985392 2:216349639-216349661 GATGGAAAAGAGGCCTCAGGGGG + Intronic
946351865 2:219160582-219160604 GGTCCAGGGCAGGCCTCCGGGGG - Intronic
946422945 2:219575166-219575188 CCTGCTGCAGAGGCCTCCGGAGG + Exonic
948271973 2:236681219-236681241 AGTGCAGAGGGGGCCTCTGGAGG - Intergenic
948336768 2:237214421-237214443 GGTGCAGAAGAGGCTCACGTAGG - Intergenic
948410078 2:237752523-237752545 GGTGCAGCAGAGGCTACCAGGGG - Intronic
948776946 2:240294132-240294154 GGGAGAGCAGAGGCCTCCGGCGG + Intergenic
1171941037 20:31330231-31330253 GTTGCAGCAGAGGCCTCAGCTGG - Intergenic
1172295937 20:33811342-33811364 GGCGGAGGAGAGGCCTGCGGCGG + Exonic
1172772129 20:37388044-37388066 GGTGCAGCAGAGGCCACAGGAGG + Intronic
1176177216 20:63734414-63734436 GGGGCAGGAGAGGGCTGCGGAGG + Intronic
1176936917 21:14877938-14877960 AGTGCACAAGAGGTCTCCGCTGG - Intergenic
1180074627 21:45456304-45456326 GGTGCAGAAGTGGCGTGCGCAGG - Intronic
1180136925 21:45867989-45868011 GGTGCTGAAGAGGCCACAGGAGG + Intronic
1180292831 22:10860286-10860308 GGTGGACATGAGGCCTCAGGTGG + Intergenic
1180456355 22:15514688-15514710 GGTGGACATGAGGCCTCAGGTGG + Intergenic
1180495638 22:15889708-15889730 GGTGGACATGAGGCCTCAGGTGG + Intergenic
1183230153 22:36577077-36577099 GGGGCAGCAGAGGCCCCCGGGGG - Intronic
1183481791 22:38069274-38069296 GGAGCTGGAGAGGCCTCTGGGGG - Intronic
1183564221 22:38601618-38601640 GGTGCAGAAGAGCAGTCAGGAGG + Intronic
1184104567 22:42360003-42360025 GGAGCAGCAGAGGCCTGGGGTGG - Intergenic
1184215210 22:43062130-43062152 GGTACAGATGGGGCCTCCGATGG + Intronic
1184405405 22:44298027-44298049 GGTGCTGAGGCTGCCTCCGGCGG + Intronic
1184572885 22:45337770-45337792 TCTGCAGAAGCGGCCTCAGGAGG - Intronic
1184601858 22:45548634-45548656 GGAGCAGATGTGGCCCCCGGTGG - Exonic
1184686846 22:46100088-46100110 GGAGGAGAAGAGGCCTGCAGGGG + Intronic
1185345673 22:50309545-50309567 TGTGCAGAAGAGGCCTGGGGTGG - Exonic
949844778 3:8358240-8358262 GGTGAACAAGAGCCCTCTGGAGG + Intergenic
950552858 3:13677173-13677195 GGTGCTGAAGAGGCCACATGAGG - Intergenic
951453722 3:22867717-22867739 GGTGCAGCAGAGTCACCCGGAGG + Intergenic
954136900 3:48586052-48586074 GGTTTGGAAGAGGCCTCTGGGGG - Exonic
954302284 3:49706381-49706403 GCTACAGCAGAGGGCTCCGGAGG - Intronic
959559049 3:107758636-107758658 GGTGCTGAAGAGTACTCGGGTGG - Intronic
961491355 3:127258556-127258578 GGTGGACAAGAGGCCCTCGGGGG - Intergenic
962853190 3:139323236-139323258 GGTGCTGCAGAGGCCACAGGGGG - Intronic
964973173 3:162586400-162586422 AGTGCAGGAGAGGGCTCCCGAGG + Intergenic
965571768 3:170180980-170181002 GGTGCACAAGAGGCCTACCCAGG + Intronic
966914095 3:184575477-184575499 GGTGAAGAAGAGACCACCGGTGG - Intronic
967009352 3:185417587-185417609 GAAGCAGAAGAAGCCTCTGGTGG - Intronic
968231511 3:197007502-197007524 GGTGCTGGAGAGGCCTTGGGAGG - Intronic
968592984 4:1468860-1468882 GGTCCAGAGGAGGCCCCCAGTGG + Intergenic
968666098 4:1823169-1823191 GGGGCAGCAGGGGCCTCTGGTGG - Intronic
968689989 4:1985432-1985454 GGTGCAGGACAGGCCTGTGGGGG - Intronic
971465415 4:26953630-26953652 TGTGCAAAACAGGCCTCCCGAGG + Intronic
972358662 4:38305875-38305897 TGTGCAGAAGAGGCCAGGGGTGG - Intergenic
977206656 4:94170702-94170724 GGTGCAGGAGAGGACCCAGGGGG - Intergenic
981116079 4:140992851-140992873 GGTGCAGAAGAGGGCAACTGAGG + Intronic
985641207 5:1064294-1064316 GGTGCGGAAGGGGCCTCCCCGGG + Intronic
985763047 5:1761468-1761490 GGTGCAGAAGAAGCCAGCGGGGG - Intergenic
985776627 5:1847696-1847718 GGTGCAGAAGAGATCTCTGCAGG + Intergenic
985780134 5:1866201-1866223 GATGCAGAGGAGGCCGCTGGAGG + Intergenic
986400914 5:7378725-7378747 GGTGGAGAAGAGGCATCGGTAGG + Intergenic
990595351 5:57307597-57307619 GTTGCACCAGAGGGCTCCGGTGG - Intergenic
992955282 5:81901779-81901801 GGTGCAGAAGAGGCCTGCAGAGG + Intergenic
993719671 5:91310037-91310059 AGTTCAGAAGAGGCCTCCTCTGG + Intergenic
999224478 5:150009755-150009777 GGGGCAGCTGAGGCCTCAGGAGG + Intronic
999269874 5:150290566-150290588 GTTGCAGAGGAGGGCTCTGGAGG - Intergenic
999802000 5:155046898-155046920 GATCCTGAAGAGGCATCCGGTGG + Intergenic
1001936483 5:175709328-175709350 GGTGCAGACGAGGTCACAGGAGG - Intergenic
1002033585 5:176448487-176448509 GGTGCAGCAGATGCCTCCGTGGG + Intronic
1002102776 5:176865505-176865527 GGGGCAGAAGAGGACCCTGGCGG - Intronic
1002868878 6:1147829-1147851 TGAGCCGAAGAGGCCTCCGCAGG + Intergenic
1003471851 6:6443609-6443631 GGTACACCAGAGGCCTCCTGGGG + Intergenic
1004924093 6:20402513-20402535 GGTGTAGAGGAGGCTGCCGGCGG - Exonic
1005960186 6:30688294-30688316 GGTGCAGAAGGGGACCCCTGAGG + Exonic
1006058823 6:31404538-31404560 GGTGCAGGAGGGACCTTCGGTGG - Intronic
1006316157 6:33293122-33293144 GGTGCAGAAGAGGCCTCCGGGGG - Exonic
1006806706 6:36793733-36793755 GGTGGGGAAGGGGCCTCCGGCGG - Intronic
1009409800 6:63352906-63352928 GTTGCAGAAGACACATCCGGTGG + Intergenic
1011033938 6:82953180-82953202 GGTGCAGAGGTGTCCTCTGGAGG - Intronic
1011944113 6:92879906-92879928 GATGCAGAAAAGGCCTTCGATGG - Intergenic
1017764765 6:157597615-157597637 GGTTCAGAGGTGGCCTCTGGAGG + Intronic
1017867586 6:158457329-158457351 GATGCAGAAGAGGCCTGGGCAGG - Intronic
1018950129 6:168373629-168373651 GGTGAAGAAGGGGCCTCCGGAGG - Intergenic
1019395685 7:816638-816660 GGCGCAGACGAGGCCTGAGGCGG + Intronic
1019646887 7:2135612-2135634 GGTGCAGAGGAAGGCTCAGGTGG + Intronic
1020582759 7:10026206-10026228 GGAGCAGAAGAGGACTTTGGAGG + Intergenic
1022800203 7:33769662-33769684 GGTGGAGTAGTGGCTTCCGGGGG + Intergenic
1023013574 7:35944026-35944048 GCTGCAGAAGGGGCCTGAGGAGG + Intergenic
1023864347 7:44231821-44231843 GGAGCAGAGCAGGCCTCCTGGGG - Intronic
1024077554 7:45829808-45829830 GCTGCAGAAGGGGCCTGAGGAGG - Intergenic
1025126856 7:56351604-56351626 GCTGCAGAAGGGGCCTGAGGAGG + Intergenic
1029118968 7:98253543-98253565 GGTGAACAAGAGGCTTCTGGGGG - Intronic
1029131230 7:98332861-98332883 GGTGCAGATGGGGCTTCTGGAGG - Intronic
1029906350 7:104097628-104097650 GGTGAAGAGGAGGCCTCTGTAGG + Intergenic
1030528229 7:110679157-110679179 GATACAAAACAGGCCTCCGGGGG + Intronic
1030617877 7:111757151-111757173 GGTGGAGATGAGGCTTCTGGAGG + Intronic
1032020131 7:128403097-128403119 GGTTCAGAAGAGGCCTGGGAAGG - Intronic
1032239522 7:130149927-130149949 GGTGCAGAAGAGGCAGCCGCAGG + Intergenic
1032875217 7:136031487-136031509 GGTGGAGAATAGGCATGCGGGGG - Intergenic
1034674707 7:152884105-152884127 GGTGCAGGAGAGGCACCCGCAGG + Intergenic
1034965547 7:155388603-155388625 GGTGCAGAGGAGGCCTTCTCTGG - Intronic
1034973496 7:155434144-155434166 GGTACAGAATACGCCTCCTGGGG + Intergenic
1035141231 7:156764245-156764267 GGCACAGTAGAGGGCTCCGGAGG - Intronic
1035598743 8:882397-882419 CGCGCAGGAGAGGCCTCCGCAGG - Intergenic
1035598825 8:882709-882731 CGCGCAGGAGAGGCCTCCGCAGG - Intergenic
1037717043 8:21409474-21409496 AGGGCAGAAGAGGCTTCCTGGGG - Intergenic
1038256744 8:25957451-25957473 GGTGAAGAGGTGGCCTGCGGGGG - Intronic
1038450681 8:27637187-27637209 GGGGCAGGAGGGGCCTCGGGTGG - Intronic
1040303129 8:46198381-46198403 GGGACAGAAGAGGCCTCCTTGGG - Intergenic
1041830147 8:62144372-62144394 GCTCCAGGAGAGACCTCCGGCGG + Intergenic
1048991163 8:139761040-139761062 GGTGCAGTACAGGCCTCCCTGGG + Intronic
1049150872 8:141034739-141034761 GGGGCAGAAGTGGCCTGAGGGGG - Intergenic
1049282968 8:141759848-141759870 GGTGGAGAAGGGCCCTGCGGTGG - Intergenic
1049434846 8:142581756-142581778 TGTGCAGAAGAGGCCTCTGGGGG - Intergenic
1049583039 8:143421379-143421401 GGTGCAGCAGAGGCGTCAAGAGG - Intronic
1049585336 8:143430295-143430317 GGTGAAGAAGGAGCCTCCCGAGG - Exonic
1049612083 8:143560492-143560514 GGTGCAGAGGGGCCCTCCAGAGG - Intronic
1050358405 9:4804618-4804640 GCTGTAGAGGAGGCCTCCGCCGG + Intronic
1050623285 9:7477132-7477154 GAAGCAGAAGAAGCCTCTGGTGG - Intergenic
1052825485 9:33171019-33171041 GGTGCAGAAGAGGGCGCCATAGG - Intergenic
1053366174 9:37524066-37524088 GGTGCACAAGGGGCCTGCAGTGG - Intronic
1056270280 9:84940616-84940638 GGTACAGAAGAGGCCACCTCTGG + Intronic
1057800884 9:98191178-98191200 GGTGGAGAAGAGGCCCCATGGGG + Intronic
1059523052 9:114961980-114962002 GGTGCAAGAGAGGCCTGCAGAGG + Intergenic
1060248851 9:121969472-121969494 GGTGCAGAGGAGTCCTCAGAAGG - Intronic
1061521533 9:131121029-131121051 GGGGCAGCAGAGGGCTTCGGAGG + Exonic
1061561239 9:131405195-131405217 AGTGCAGAAGCGGCCACTGGAGG + Intronic
1062001981 9:134220734-134220756 TGGGCAGCAGAGGGCTCCGGGGG + Intergenic
1062211555 9:135366950-135366972 GGTGCAGAGGAGTCCTCTGCTGG - Intergenic
1062215933 9:135389884-135389906 GGGGGAGAAGAGGCCCCCGGGGG - Intergenic
1186017525 X:5214414-5214436 GGTGCAGCAGGGGTCTCCGCTGG + Intergenic
1187319057 X:18224165-18224187 GATGCAGAAGAGGCCAAAGGAGG + Intergenic
1199609428 X:149600271-149600293 GGGGCTGAAGAGGCTTCCCGTGG + Intronic
1199629689 X:149769083-149769105 GGGGCTGAAGAGGCTTCCCGTGG - Intergenic
1199847886 X:151704264-151704286 GTTGAAAAAGAGGCCTCCCGGGG - Exonic
1202603120 Y:26614694-26614716 GGTGCAGAAGAGGGGTTCTGGGG + Intergenic