ID: 1006316272

View in Genome Browser
Species Human (GRCh38)
Location 6:33293666-33293688
Sequence ACCAGGTGGCTCCACCTCAC AGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 191
Summary {0: 1, 1: 0, 2: 2, 3: 13, 4: 175}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1006316268_1006316272 1 Left 1006316268 6:33293642-33293664 CCGTGGGGCAGGAGGGTCACTGG 0: 1
1: 0
2: 4
3: 52
4: 389
Right 1006316272 6:33293666-33293688 ACCAGGTGGCTCCACCTCACAGG 0: 1
1: 0
2: 2
3: 13
4: 175
1006316264_1006316272 10 Left 1006316264 6:33293633-33293655 CCGAAGCACCCGTGGGGCAGGAG 0: 1
1: 0
2: 1
3: 9
4: 190
Right 1006316272 6:33293666-33293688 ACCAGGTGGCTCCACCTCACAGG 0: 1
1: 0
2: 2
3: 13
4: 175
1006316259_1006316272 20 Left 1006316259 6:33293623-33293645 CCAATGTTGGCCGAAGCACCCGT 0: 1
1: 0
2: 0
3: 1
4: 15
Right 1006316272 6:33293666-33293688 ACCAGGTGGCTCCACCTCACAGG 0: 1
1: 0
2: 2
3: 13
4: 175
1006316267_1006316272 2 Left 1006316267 6:33293641-33293663 CCCGTGGGGCAGGAGGGTCACTG 0: 1
1: 1
2: 5
3: 34
4: 243
Right 1006316272 6:33293666-33293688 ACCAGGTGGCTCCACCTCACAGG 0: 1
1: 0
2: 2
3: 13
4: 175

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1006316272 Original CRISPR ACCAGGTGGCTCCACCTCAC AGG Exonic