ID: 1006316566

View in Genome Browser
Species Human (GRCh38)
Location 6:33295261-33295283
Sequence TCCTCAGAAGGCGGGGAAGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 276
Summary {0: 1, 1: 0, 2: 1, 3: 23, 4: 251}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1006316566_1006316580 16 Left 1006316566 6:33295261-33295283 CCCTCTTCCCCGCCTTCTGAGGA 0: 1
1: 0
2: 1
3: 23
4: 251
Right 1006316580 6:33295300-33295322 AATGCCTCAGCCTCCGCACCTGG 0: 1
1: 0
2: 6
3: 24
4: 1133

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1006316566 Original CRISPR TCCTCAGAAGGCGGGGAAGA GGG (reversed) Intronic