ID: 1006317588

View in Genome Browser
Species Human (GRCh38)
Location 6:33299384-33299406
Sequence ATCCCGGCCGGGTTTTCCGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 14
Summary {0: 1, 1: 0, 2: 0, 3: 1, 4: 12}

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1006317574_1006317588 27 Left 1006317574 6:33299334-33299356 CCCCACGGGATTACCCTCCCTAC 0: 1
1: 0
2: 0
3: 2
4: 39
Right 1006317588 6:33299384-33299406 ATCCCGGCCGGGTTTTCCGAAGG 0: 1
1: 0
2: 0
3: 1
4: 12
1006317583_1006317588 -2 Left 1006317583 6:33299363-33299385 CCACGAATGTAGCTGACCGAAAT 0: 1
1: 0
2: 0
3: 3
4: 27
Right 1006317588 6:33299384-33299406 ATCCCGGCCGGGTTTTCCGAAGG 0: 1
1: 0
2: 0
3: 1
4: 12
1006317579_1006317588 10 Left 1006317579 6:33299351-33299373 CCCTACCACAACCCACGAATGTA 0: 1
1: 0
2: 1
3: 5
4: 94
Right 1006317588 6:33299384-33299406 ATCCCGGCCGGGTTTTCCGAAGG 0: 1
1: 0
2: 0
3: 1
4: 12
1006317576_1006317588 25 Left 1006317576 6:33299336-33299358 CCACGGGATTACCCTCCCTACCA 0: 1
1: 0
2: 0
3: 1
4: 68
Right 1006317588 6:33299384-33299406 ATCCCGGCCGGGTTTTCCGAAGG 0: 1
1: 0
2: 0
3: 1
4: 12
1006317575_1006317588 26 Left 1006317575 6:33299335-33299357 CCCACGGGATTACCCTCCCTACC 0: 1
1: 0
2: 0
3: 2
4: 51
Right 1006317588 6:33299384-33299406 ATCCCGGCCGGGTTTTCCGAAGG 0: 1
1: 0
2: 0
3: 1
4: 12
1006317578_1006317588 13 Left 1006317578 6:33299348-33299370 CCTCCCTACCACAACCCACGAAT 0: 1
1: 0
2: 0
3: 9
4: 133
Right 1006317588 6:33299384-33299406 ATCCCGGCCGGGTTTTCCGAAGG 0: 1
1: 0
2: 0
3: 1
4: 12
1006317580_1006317588 9 Left 1006317580 6:33299352-33299374 CCTACCACAACCCACGAATGTAG 0: 1
1: 0
2: 0
3: 13
4: 93
Right 1006317588 6:33299384-33299406 ATCCCGGCCGGGTTTTCCGAAGG 0: 1
1: 0
2: 0
3: 1
4: 12
1006317581_1006317588 5 Left 1006317581 6:33299356-33299378 CCACAACCCACGAATGTAGCTGA 0: 1
1: 0
2: 1
3: 9
4: 74
Right 1006317588 6:33299384-33299406 ATCCCGGCCGGGTTTTCCGAAGG 0: 1
1: 0
2: 0
3: 1
4: 12
1006317577_1006317588 14 Left 1006317577 6:33299347-33299369 CCCTCCCTACCACAACCCACGAA 0: 1
1: 0
2: 0
3: 15
4: 220
Right 1006317588 6:33299384-33299406 ATCCCGGCCGGGTTTTCCGAAGG 0: 1
1: 0
2: 0
3: 1
4: 12
1006317582_1006317588 -1 Left 1006317582 6:33299362-33299384 CCCACGAATGTAGCTGACCGAAA 0: 1
1: 0
2: 0
3: 1
4: 25
Right 1006317588 6:33299384-33299406 ATCCCGGCCGGGTTTTCCGAAGG 0: 1
1: 0
2: 0
3: 1
4: 12

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1006317588 Original CRISPR ATCCCGGCCGGGTTTTCCGA AGG Intergenic
906507995 1:46394261-46394283 ATCCAGTCCGGGTTTTGCGGCGG + Exonic
908950014 1:69548998-69549020 AACCCAGTCGGGTTTTCTGAGGG + Intergenic
1063938592 10:11105094-11105116 ATACCGGTTGGGTTATCCGATGG + Intronic
1077511166 11:2963893-2963915 ATCCCAGCCTGGTTCTCCCAGGG - Intronic
1133127262 16:3655151-3655173 CTCCCGGGCGGGTTTTCTGGTGG + Intronic
1147671641 17:42180168-42180190 ATCCCGGCCAGGGTTCCCGAGGG + Intronic
933923905 2:87075679-87075701 CTCCCGGCCGGGTTTCCGGGTGG + Intergenic
938843686 2:135186555-135186577 TGCCCGGCCGGGTTTACTGAAGG - Intronic
1184688161 22:46105669-46105691 TGCCCGGCTGGGTTTTCCCAGGG - Exonic
967895669 3:194394552-194394574 ATCCCAGCAGGGTTTTTCAATGG + Intergenic
1006317588 6:33299384-33299406 ATCCCGGCCGGGTTTTCCGAAGG + Intergenic
1008743077 6:54633690-54633712 GTCCTTGCCAGGTTTTCCGAGGG - Intergenic
1019709049 7:2510057-2510079 AGCCTGGCAGGGCTTTCCGAGGG + Intergenic
1045222670 8:100213642-100213664 GTCCCCGCCGGGTTTTCCCTTGG + Intronic