ID: 1006318272

View in Genome Browser
Species Human (GRCh38)
Location 6:33303990-33304012
Sequence CTGTGGGGAAAGATTGAGAA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 490
Summary {0: 1, 1: 0, 2: 2, 3: 36, 4: 451}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1006318267_1006318272 1 Left 1006318267 6:33303966-33303988 CCTTGCAGGTGGACAGGTAGACA 0: 1
1: 0
2: 1
3: 17
4: 280
Right 1006318272 6:33303990-33304012 CTGTGGGGAAAGATTGAGAAGGG 0: 1
1: 0
2: 2
3: 36
4: 451
1006318264_1006318272 13 Left 1006318264 6:33303954-33303976 CCTTCTTTGAATCCTTGCAGGTG 0: 1
1: 0
2: 1
3: 13
4: 175
Right 1006318272 6:33303990-33304012 CTGTGGGGAAAGATTGAGAAGGG 0: 1
1: 0
2: 2
3: 36
4: 451

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1006318272 Original CRISPR CTGTGGGGAAAGATTGAGAA GGG Intronic
901102060 1:6726527-6726549 ATGTGGGGACAGGCTGAGAATGG - Intergenic
901162514 1:7190125-7190147 CTCGGGGGAAAGGGTGAGAAGGG + Intronic
901892887 1:12283217-12283239 CTGAGGGGCAAGACTGAGAAAGG - Exonic
901957577 1:12797623-12797645 CTGTGGGGAAACACAGAGAGAGG + Intergenic
902276469 1:15343448-15343470 AGCTGGGGAAAGATGGAGAAGGG - Intronic
903917169 1:26773042-26773064 ATGGGGGGAAATCTTGAGAATGG + Intronic
904163177 1:28536191-28536213 CTGTGGGAGGAGATTGAGAAGGG + Intronic
904254183 1:29244092-29244114 CTGGGGAGAAAGATTGAGATGGG + Intronic
904573074 1:31482525-31482547 CTGTGGGGAATAAGGGAGAAAGG + Intergenic
904941824 1:34169126-34169148 CTGTGAGGAAAGGGTAAGAAAGG + Intronic
905112240 1:35604240-35604262 CTTTGGGTATAGATGGAGAATGG - Intronic
905143811 1:35870738-35870760 CAGAGGGGAAAGAATGGGAATGG - Intronic
905341431 1:37280679-37280701 AGGTGGGGAAAGAGTGACAAAGG - Intergenic
906264749 1:44419927-44419949 CTGTGGGAAAACATTTGGAAAGG - Intronic
906387829 1:45386978-45387000 CTGGGGGGAAAGGTTGGGAGGGG - Intronic
907406768 1:54258560-54258582 AGGTGGGGAAAGATCGGGAAGGG + Intronic
907611909 1:55879711-55879733 CTTGGGGCGAAGATTGAGAAAGG - Intergenic
908117806 1:60957519-60957541 CTGTGTGGAAAGCTTGGGACAGG - Intronic
908962809 1:69721123-69721145 GTGTGGGGATAGATGGTGAATGG - Intronic
910028828 1:82690507-82690529 CAGTGGGGAGAGAGAGAGAAAGG - Intergenic
911445631 1:97988147-97988169 CTGTGGGGTAAGAGGGAGAGAGG + Intergenic
911658740 1:100475929-100475951 CTGTGGCGAGGGATTGACAAAGG + Intronic
912570443 1:110617379-110617401 CGATGGGGGAAGACTGAGAAAGG + Intronic
912977265 1:114342039-114342061 CTGCTGGGAACGGTTGAGAAAGG - Intergenic
915226991 1:154418788-154418810 CTGTGGGGGAAGGGAGAGAAAGG + Intronic
915486576 1:156225447-156225469 CTGTGGGGAAAGGGTGGGAGGGG - Intronic
915548313 1:156616386-156616408 CAGTGAGGACAGAATGAGAAAGG - Intergenic
915637293 1:157195700-157195722 CTGTGGGGAAAGGCAGAGAAGGG + Intergenic
916264041 1:162871843-162871865 CTTGGGGGGAAGAGTGAGAAGGG + Intergenic
916511783 1:165478565-165478587 TTGTGGGGGAAGGTTGAGAGGGG + Intergenic
916626651 1:166565335-166565357 CTATGGAGAAAGATGGAGCAGGG - Intergenic
916982639 1:170154760-170154782 CTTTGGGGGACTATTGAGAAGGG + Intronic
917195130 1:172456560-172456582 CTGTGGGGAGAGATAGTGACGGG + Intronic
917355828 1:174125296-174125318 CTTTGGGGGATGGTTGAGAAGGG + Intergenic
918303733 1:183227396-183227418 CTTTGGGGAAGGCTTCAGAAAGG + Intronic
919775892 1:201193852-201193874 CTGGGAAGAAAGAGTGAGAAAGG - Intronic
920090136 1:203446897-203446919 TTTTGGTGAAAGATTGAGCAAGG - Intergenic
920155212 1:203944045-203944067 CTGTGGGAAAAAGATGAGAAAGG - Intergenic
920491599 1:206419945-206419967 AGGTGGGGAAAGATTGGGAGGGG - Intronic
920830150 1:209457222-209457244 CAGTGTGGAAAGAAAGAGAAAGG - Intergenic
921165821 1:212506240-212506262 CTCAGGGGAAAGGTTGGGAAGGG - Intergenic
921274238 1:213502247-213502269 CTGGGATGACAGATTGAGAATGG + Intergenic
922035147 1:221840452-221840474 GTCTGGGGAAAGAAAGAGAAAGG + Intergenic
922482295 1:225947448-225947470 CTGTGGGGAAAGATACAAAAGGG - Intergenic
923035220 1:230280754-230280776 CTTTGGGGAAAGAATTAGGAAGG + Exonic
923096046 1:230775965-230775987 CTATGGGAAAAGAATGAAAAAGG - Intronic
923991902 1:239447394-239447416 ATGTGGGGAGAGAGAGAGAATGG + Intronic
924108176 1:240670562-240670584 CTCTGGGGAAAGGTTGGGAGGGG - Intergenic
1062998142 10:1888019-1888041 TTGGGGGGAAAGGGTGAGAAAGG - Intergenic
1063169359 10:3493379-3493401 CAGTGGGAAAAGTTTGGGAATGG - Intergenic
1064454936 10:15478517-15478539 CTGTGGCAAAAGGTTGAGAAAGG + Intergenic
1064898662 10:20269604-20269626 CTATGGGCAAATATTGAAAATGG + Intronic
1064965099 10:21007198-21007220 CTGTGGGGAGAGAGGGTGAATGG - Intronic
1065316338 10:24467647-24467669 CTGTGGGGAAAAAGTGTCAATGG + Intronic
1065619653 10:27567969-27567991 CTGTGGGCTAAGATACAGAAAGG - Intergenic
1065928331 10:30456354-30456376 CTGCAGGGAAAGCTTGAGAACGG + Intronic
1066040894 10:31547298-31547320 CTTTGGGGAACTATTGAGAAGGG - Intergenic
1066041100 10:31548654-31548676 CTTTGGGGAACTATTGAGAAGGG + Intergenic
1066283525 10:33941517-33941539 ATGGGTGGAAAGTTTGAGAAAGG - Intergenic
1066797144 10:39135038-39135060 CTATGGGGAAAAACTGAGTATGG + Intergenic
1067013862 10:42740836-42740858 CTCTGGGAAAAAATTGAGCATGG + Intergenic
1067294183 10:44965342-44965364 ATGTGGGGAAAGATCTGGAAAGG + Intronic
1067517280 10:46962067-46962089 TTGTGGGGCAAGCTTGGGAAGGG - Intronic
1067644968 10:48089762-48089784 TTGTGGGGCAAGCTTGGGAAGGG + Intergenic
1067794837 10:49313388-49313410 ATGAGGGGAAAGATGGAGCAAGG + Intronic
1068419618 10:56773276-56773298 CTATGAGGTAGGATTGAGAATGG + Intergenic
1068489820 10:57709189-57709211 ATATCGGGAAAGATTGTGAAAGG - Intergenic
1068632765 10:59314662-59314684 AAGGGGAGAAAGATTGAGAAGGG - Intronic
1069465127 10:68631611-68631633 CTGTGGGGAAAGAGCCAGCAGGG + Intronic
1070076052 10:73137265-73137287 CTCTGGGGAGAGAGTGAGATTGG - Intronic
1070406851 10:76104875-76104897 TGGTTGGGACAGATTGAGAAAGG - Intronic
1071859636 10:89659068-89659090 CTTTGGGGAAAGCTGGAGATTGG - Intergenic
1074218963 10:111417362-111417384 CTATCGGGAATGATGGAGAAGGG - Intergenic
1074278742 10:112029956-112029978 CAGTGAGGAAAGAAAGAGAATGG - Intergenic
1074281734 10:112058501-112058523 TTGTGAGGCAAGAGTGAGAAAGG - Intergenic
1075303865 10:121350061-121350083 CTGTCTGAAAAGTTTGAGAATGG + Intergenic
1075909032 10:126107629-126107651 CTGTGGGGACAGTGTGAGAAGGG - Intronic
1076213500 10:128673365-128673387 CTCTGGGGATAGATGGAAAAAGG - Intergenic
1076680258 10:132168066-132168088 CCGTGGAGGAAGAGTGAGAAGGG + Exonic
1077978694 11:7276592-7276614 CTGAGGGGACAGCTTAAGAATGG - Intronic
1079186511 11:18242898-18242920 CTGTTAGAAAAGTTTGAGAAAGG - Intronic
1079332285 11:19543528-19543550 CTTTTGGGAAAGGTTCAGAATGG + Intronic
1079980738 11:27149365-27149387 CTGTGGGGGACTGTTGAGAAGGG - Intergenic
1081691989 11:45084956-45084978 CTTTGGGGAGAGAATCAGAAAGG + Intergenic
1081923888 11:46806497-46806519 CTGGGAGGAAAGAATGGGAAGGG - Intronic
1082728891 11:56771055-56771077 CTCTGGGGAAAGAGTGGGAAGGG - Intergenic
1083877627 11:65532634-65532656 CTATGGGGATAGAGTGGGAAGGG + Intronic
1084611522 11:70206166-70206188 ATGTGGGGAAAGATTGGAGAAGG + Exonic
1084868820 11:72081713-72081735 ATCTGGGGACAGATTGAGAAGGG - Intronic
1085527003 11:77170142-77170164 GTATGGGGAAAGATTAAGGAGGG + Intronic
1085915578 11:80883799-80883821 CTCTGGGGAATGATTGAGGGAGG - Intergenic
1086265108 11:84988714-84988736 CAGTGGGGAAAGGATGGGAAGGG + Intronic
1086564600 11:88211604-88211626 CTTTGGGGGACTATTGAGAAGGG - Intergenic
1087753367 11:102029484-102029506 GTATGGGGAAAGATAGCGAAGGG + Intergenic
1088206921 11:107403097-107403119 CTTTAGGGAAAGAGTGTGAAGGG + Intronic
1089185572 11:116612436-116612458 CTGTGGGGAGAGCTGGAGACAGG + Intergenic
1089890052 11:121871749-121871771 CTGAAGGGAAAGAATGAGCAAGG + Intergenic
1090221115 11:125026885-125026907 CTTTGGGGGAAGAGTGGGAAGGG - Intronic
1090766462 11:129880331-129880353 CTGTGGGGAATGAAGGAGAATGG - Intronic
1091137301 11:133203386-133203408 CTGTGAGGCAAGGTTGAGAGAGG - Intronic
1092246831 12:6868419-6868441 CTCTGGGGAATGAACGAGAAGGG - Intronic
1094303064 12:28987874-28987896 CGGTGGAGAAAGAGAGAGAATGG - Intergenic
1096496941 12:52044147-52044169 CTGTGGGGAAGCTCTGAGAAAGG - Intronic
1096679457 12:53245677-53245699 CTGGGGGAAAAAAATGAGAAGGG + Intergenic
1096782963 12:54001362-54001384 TGGAGGGGAAGGATTGAGAATGG + Intronic
1096826412 12:54281496-54281518 CTGTGTGGTAAGATTTGGAAGGG + Exonic
1097143924 12:56926509-56926531 CTGTGGGTGATGATTGAGGAGGG - Intronic
1099541865 12:83920554-83920576 CTGTGGAGAAATATGTAGAAGGG - Intergenic
1100443137 12:94635991-94636013 CTGAGGGGAGAGGTTGGGAAGGG + Intronic
1100469255 12:94874829-94874851 CTGCGGGAAAAAAATGAGAAGGG + Intergenic
1100593236 12:96049100-96049122 CTTTGGGAACAGAGTGAGAAAGG - Intergenic
1100682777 12:96947332-96947354 CTGTGGGGGCAGATTTAGAAAGG + Intronic
1100765947 12:97865820-97865842 CTGGGGGGATAGATTGAGGAGGG - Intergenic
1103415384 12:120739234-120739256 GCGTGGGGAAAGCTGGAGAAGGG - Intronic
1104109266 12:125689929-125689951 CTGAGGGGAAAGCCTGTGAAGGG - Intergenic
1104498706 12:129264908-129264930 CTTGGGGGTAAGAGTGAGAAGGG + Intronic
1105600852 13:21885794-21885816 CTGGAGGGAGAGATTAAGAAGGG + Intergenic
1106653937 13:31721950-31721972 TTGGGGGCTAAGATTGAGAATGG - Intergenic
1106870901 13:34019589-34019611 CTGTCTGTAAATATTGAGAAAGG - Intergenic
1107705853 13:43104194-43104216 CTGTGGGGAGGGATTGGCAATGG - Intronic
1107764823 13:43723041-43723063 GTGTGGGGACAGTTTGGGAAGGG - Intronic
1108474452 13:50800007-50800029 CTGTGAAGAAAGATTGGCAAGGG + Intronic
1109649283 13:65305057-65305079 CTGAGGGGAATGGTAGAGAAGGG + Intergenic
1110037601 13:70708009-70708031 CTTGGGGGAAAGATTGGGAGTGG + Intergenic
1112088011 13:96052310-96052332 CTCGGGGGAAAGGTTGAGAAGGG + Intronic
1112609943 13:100946212-100946234 CTGTGGGGAAGGAATGAGCTTGG - Intergenic
1113006541 13:105709407-105709429 CTGTGGGGAAACACCTAGAATGG + Intergenic
1113172598 13:107522309-107522331 CTATATGGAGAGATTGAGAAAGG - Intronic
1113820019 13:113206894-113206916 ATGATGGGAAAGACTGAGAAGGG - Intronic
1114926203 14:27402689-27402711 CTATGGGGAACTATTGGGAAGGG + Intergenic
1115535444 14:34368808-34368830 TAGTGGGCAAAGATTGAGAAAGG - Intronic
1115595029 14:34901140-34901162 CTGTGGGGAGAGAGAAAGAAAGG + Intergenic
1115992393 14:39163535-39163557 CTGTGGAGACAGATTAAGCAAGG - Intronic
1116215513 14:42012003-42012025 CTTTGGGGAAAGAATGGGAGAGG + Intergenic
1116487792 14:45471916-45471938 CAGTGAGCAAAGATTAAGAAAGG + Intergenic
1117431759 14:55672865-55672887 TTGTGGGGAAATATTATGAAAGG + Intronic
1117890216 14:60413261-60413283 TTGGGGGGAAAGTTTGAAAAGGG - Intronic
1117967371 14:61219867-61219889 CTTTGGTGTAATATTGAGAAAGG + Intronic
1118611209 14:67541756-67541778 CTGTGGGGAAAGAACGGGAGGGG - Intronic
1118728093 14:68644653-68644675 CTGTGAGGGGAGATTGAAAACGG - Intronic
1121662764 14:95647706-95647728 CAGTGTGGAAATTTTGAGAATGG - Intergenic
1122075961 14:99234700-99234722 GAGTGGGGAAAGTTTCAGAATGG - Intronic
1122451130 14:101808433-101808455 CTCTGGGGAAAGAGGGGGAAGGG + Intronic
1123461004 15:20471672-20471694 GTGAGGGGAAACATGGAGAAAGG + Intergenic
1123657056 15:22528708-22528730 GTGAGGGGAAACATGGAGAAAGG - Intergenic
1123887539 15:24741829-24741851 GTGTGGGGAAAAATAGAGAGTGG - Intergenic
1124135564 15:27032918-27032940 CTCTGGGGAACGATGCAGAAAGG - Intronic
1124310969 15:28623884-28623906 GTGAGGGGAAACATGGAGAAAGG - Intergenic
1126123956 15:45278701-45278723 CAGTGTGGCAATATTGAGAATGG - Intergenic
1126196280 15:45935621-45935643 CGGTGGGGAGAGATAGAGGAGGG + Intergenic
1126369742 15:47933241-47933263 CTGTGGGAAGAGAGTGAGTAAGG - Intergenic
1126778475 15:52119180-52119202 GAATGGGGGAAGATTGAGAAGGG + Exonic
1127041181 15:54978589-54978611 CTCGGGGGAAAGAGTGGGAACGG + Intergenic
1127733319 15:61819699-61819721 CTGAGAGGAAGGATGGAGAAGGG - Intergenic
1128445767 15:67758749-67758771 TTGTGGGGAAAGAATGTGACAGG - Intronic
1129149771 15:73681201-73681223 CTTTGGGGAAAGCTTGTTAAAGG - Intergenic
1129227310 15:74177476-74177498 CTGTGGGGAAAGATTCCTACAGG - Intergenic
1129578346 15:76778042-76778064 CTGTTGGGTAAGATTCAGCATGG + Intronic
1129852471 15:78801548-78801570 CTGTGGGGAAAAATAAAGCAAGG - Intronic
1130010752 15:80151873-80151895 GTGTGTGGAAAGAGAGAGAAGGG - Intergenic
1130424972 15:83787839-83787861 CTGGAGGGAGAGGTTGAGAAAGG - Intronic
1130853500 15:87820656-87820678 CTAAGAGGAAAGATGGAGAATGG - Intergenic
1131215567 15:90532721-90532743 CAGTGGGAAAATTTTGAGAAGGG + Intronic
1131379749 15:91954109-91954131 CATGAGGGAAAGATTGAGAAAGG + Intronic
1131773770 15:95771151-95771173 CTGTGGAGCAAAATGGAGAAAGG + Intergenic
1133420110 16:5638698-5638720 CTGTGGGGACAGACAGGGAATGG - Intergenic
1134203908 16:12221697-12221719 TTGTGGGGAAGTATTGGGAAGGG + Intronic
1134624367 16:15713477-15713499 CTGTGGGAAAAGGTGGAGAGTGG + Intronic
1135533193 16:23272261-23272283 CTGAGTGGAAAAATTAAGAAAGG - Intergenic
1136048661 16:27635295-27635317 CTGTGAGGACAGCTTTAGAAAGG + Intronic
1137385908 16:48042425-48042447 ATGTGGGGAGAGATCGGGAAGGG + Intergenic
1138412154 16:56849269-56849291 CAGCAGGGAAACATTGAGAAGGG + Intronic
1138628121 16:58269030-58269052 CTGTGGGGAAGGATTTCTAATGG - Intronic
1140305919 16:73802550-73802572 CTCAGGGAAAAGAATGAGAAAGG + Intergenic
1143014338 17:3883677-3883699 CTGAGGGGAAAGCTCCAGAAAGG - Intronic
1143410364 17:6704839-6704861 GTAGGGGGAAGGATTGAGAAGGG - Intronic
1143727155 17:8856987-8857009 CTGTGGGGAAAGCTGGGGGAAGG - Intronic
1144180191 17:12744464-12744486 CTGTGGGCAGAGGTTGGGAAGGG + Intronic
1144611772 17:16725619-16725641 TTGTGGGGAAAGAGTGGGAGGGG + Intronic
1144703917 17:17355162-17355184 CTGTGGGGAAAGAAGGGGGAAGG + Intergenic
1144780798 17:17807516-17807538 GAGTGGGGAAAGGTTGAGACAGG - Intronic
1144900967 17:18589767-18589789 TTGTGGGGAAAGAGTGGGAGGGG - Intergenic
1145116486 17:20214976-20214998 ATGTGGGGCAGGCTTGAGAAGGG + Intronic
1145131539 17:20356300-20356322 TTGTGGGGAAAGAGTGGGAGGGG + Intergenic
1146246914 17:31293686-31293708 AGGTGGGAAAAGATAGAGAAAGG - Intronic
1146750842 17:35378221-35378243 CTCTGGGGAAAGCGTGGGAAGGG - Intergenic
1148502070 17:48099653-48099675 CAGTTTGGAAAGATTGTGAAAGG - Intronic
1148642828 17:49201123-49201145 CTGTGGGAAATGAGGGAGAAGGG + Intergenic
1149663105 17:58346337-58346359 CTGTGAGGTAAGATTCAGAAGGG + Intronic
1150887818 17:69108244-69108266 CTGTGTGGATAGATGGAGACAGG - Intronic
1151157850 17:72139224-72139246 TGGTGGGGAGAGAGTGAGAAAGG + Intergenic
1151762503 17:76113818-76113840 TGGTGGGGAAAGAGGGAGAAGGG + Intronic
1152457963 17:80426927-80426949 CGGTGGGGTAAGATGGGGAAGGG - Intronic
1152939946 17:83163450-83163472 CTGATGGGAAATATTGATAAGGG - Intergenic
1155394539 18:25373050-25373072 CAGAAGGGAAAGATTGAGAAAGG - Intergenic
1155820264 18:30366116-30366138 GAGAGGGGACAGATTGAGAAGGG - Intergenic
1156041117 18:32824072-32824094 CTATGGGGAAGAATTGATAACGG + Intergenic
1156463276 18:37333541-37333563 CTGTGGGGAAGAGCTGAGAATGG + Intronic
1157226008 18:45865440-45865462 CAGTGGGGAAGGATTGACACTGG - Intronic
1157357575 18:46949585-46949607 CTATGGGGAAAGACTGGGAAAGG - Intronic
1159625134 18:70684373-70684395 CTCTGGGGACAGGATGAGAAAGG - Intergenic
1160630001 18:80240272-80240294 CTTTTGGGAACTATTGAGAAGGG - Intronic
1161485613 19:4534096-4534118 CTGCGGGGCAGGATTGAGTAAGG + Intronic
1162389935 19:10383592-10383614 CTGAGGTGGAAGATTGTGAATGG - Intergenic
1162535465 19:11261216-11261238 GTGGGGGGAAAGAGTGGGAAGGG - Intronic
1164628867 19:29747830-29747852 CTGAGGGCAGAGATTGAGCATGG + Intergenic
1164746295 19:30617279-30617301 CTGTGGGGAAAGGGTGGGAGGGG - Intronic
1164876550 19:31694623-31694645 CTGTGATGAAAGATGAAGAAAGG + Intergenic
1165864053 19:38925338-38925360 CTGTGGGGAAGGAGGAAGAAGGG - Intronic
1166864228 19:45826374-45826396 CTGAGGAGGAAGATGGAGAAGGG + Intronic
1168314696 19:55479541-55479563 CTGTGGGGAAGGATTGCGCAGGG + Intronic
1168596726 19:57683525-57683547 CAGTGAGGAGAGATTCAGAATGG + Intronic
925037873 2:705251-705273 CTTTGGGGGAAGAATGGGAAGGG + Intergenic
925594366 2:5540407-5540429 CTGTGGGGACTCAGTGAGAAAGG - Intergenic
927237242 2:20885453-20885475 CTGTGAAGAAATACTGAGAATGG - Intergenic
927631776 2:24780753-24780775 CTGTGGAGAAAAATTAAGTAGGG + Intergenic
928270672 2:29852040-29852062 CTGCAGGGGAAGATAGAGAACGG + Intronic
928549105 2:32354595-32354617 CTGTGGGGCTGGAGTGAGAAGGG - Intergenic
928794571 2:35001255-35001277 TGGAGGGGAAAGAATGAGAAAGG - Intergenic
930635620 2:53802534-53802556 CTGTGTGGGAAGAATTAGAAAGG - Intronic
931170621 2:59799877-59799899 CTGTGGAGATAGATGGAGGACGG + Intergenic
931457614 2:62424571-62424593 CTGTGTGACAAGATGGAGAAGGG + Intergenic
933581258 2:84129471-84129493 CTTTGGGGAAGGGTTAAGAAGGG + Intergenic
933805317 2:85994895-85994917 TTTTGGGGAACTATTGAGAAAGG - Intergenic
935540312 2:104340582-104340604 CGGAGGGGAAAGAGTGAGGAAGG - Intergenic
935791993 2:106601350-106601372 CTTTGGGGAACTATTGAGAATGG - Intergenic
935842719 2:107130986-107131008 CTGTAGGGAAGGGATGAGAAAGG - Intergenic
936165066 2:110114169-110114191 CTGGGGGGAAAGAGAGGGAAAGG - Intronic
936697596 2:114968808-114968830 CTCTGGGGAAAGAATCTGAATGG - Intronic
936953848 2:118004742-118004764 CTGTGGGCAAAGCTGGAGACGGG - Intronic
937052880 2:118906610-118906632 CTCTGGGGATAGAATGACAAAGG + Intergenic
938185103 2:129224637-129224659 CTGTGGGGAGGGATTCAGACAGG + Intergenic
938873468 2:135507337-135507359 CTATAGGGAGAGATAGAGAATGG + Intronic
938926747 2:136050167-136050189 CTGTAGGGGAAGCTTGAGCAGGG - Intergenic
938949658 2:136244680-136244702 CTGAGGGAAAAGATTCAGAGAGG - Intergenic
939152894 2:138494145-138494167 CTGGGGGAAAAAAATGAGAAAGG + Intergenic
939173714 2:138725417-138725439 TCTTGGGGAAGGATTGAGAAAGG + Intronic
939358182 2:141131984-141132006 CTCTGGGGCAAGAGTGGGAAGGG - Intronic
941819877 2:169833686-169833708 CTGAGGGGTAGGATGGAGAAAGG - Intronic
942428902 2:175888622-175888644 CTGGGGGGAAATTTGGAGAAGGG + Intergenic
942803053 2:179898231-179898253 CTGTTTGGAAAGAGTGAAAATGG - Intergenic
943338407 2:186646663-186646685 CTGTGGGGAAAAAAAGAGGAGGG - Intronic
943904527 2:193480841-193480863 ATTTGGGGAAATATTGGGAAAGG + Intergenic
944400990 2:199326229-199326251 TCTTGGGTAAAGATTGAGAAAGG - Intronic
944473951 2:200085090-200085112 CTATGGGGAAAAATGGAGATGGG - Intergenic
944685074 2:202110802-202110824 CTCTGGGGAGAGAATGAGAAGGG - Intronic
944861263 2:203817930-203817952 CTGAGTGGTAAGTTTGAGAATGG - Intergenic
945673209 2:212826799-212826821 CTGTGGTGAAAAATTAAGACTGG + Intergenic
945707261 2:213250648-213250670 TTCTGGGGAAAGACTGAGACTGG + Intergenic
946056050 2:216902700-216902722 CTTTGGGGGACTATTGAGAAGGG + Intergenic
947544275 2:231000343-231000365 CTGTGGGGACAGAAGGAGAGAGG - Intronic
948159895 2:235814959-235814981 CTATGGGGACAGAGTAAGAAGGG - Intronic
1168837259 20:885457-885479 CTGTAGGCACAGATTGAGGAGGG + Intronic
1169347195 20:4838172-4838194 ATGTGGTGATAGATTGAGTATGG + Intergenic
1170255536 20:14339016-14339038 ATGCAGGGAAAAATTGAGAAAGG - Intronic
1170347859 20:15406942-15406964 CCTTGGAGAAAGATTGAGCAAGG + Intronic
1171051309 20:21861879-21861901 CTCGGGGGAAAGTATGAGAAGGG + Intergenic
1171242178 20:23580511-23580533 CTTGGGGGGAAGAGTGAGAAGGG - Intergenic
1173878760 20:46394533-46394555 CTGGGGAGAAAGAATCAGAAAGG + Intronic
1174146205 20:48454449-48454471 CTTTGGGGAAGAATTGAGACAGG - Intergenic
1174738610 20:52989689-52989711 CTCTAGGGAGAGACTGAGAAAGG - Intronic
1177143756 21:17385130-17385152 CTCGGGGGAAAGAGTGGGAAGGG - Intergenic
1177158508 21:17522818-17522840 ATGTGGGTAAAGTTGGAGAAGGG - Intronic
1177377586 21:20293236-20293258 CTATGTGGAAAGAGTGATAAAGG - Intergenic
1178334017 21:31727925-31727947 GTGTTGTGAAAGATTGAAAAGGG - Intronic
1179005234 21:37508072-37508094 GTGTGGGGAAAGAGGGAGAGAGG - Intronic
1181331796 22:22098578-22098600 CTGTGGGGAGACCTTGAGAGAGG - Intergenic
1181428726 22:22863465-22863487 CTTTGGGGGATTATTGAGAAGGG - Intronic
1182046182 22:27275887-27275909 CTGAGGGGAAAAATAGAGACAGG + Intergenic
1182246276 22:28960405-28960427 CAGTGGGGACTGATTGGGAAGGG - Intronic
1182277899 22:29201971-29201993 CTCTGGGGAAAGAATGAGCTGGG + Intergenic
1182367700 22:29789872-29789894 CAGTGAGGAAACATTGAGAGGGG - Intronic
1182428619 22:30287700-30287722 ATGTGTGCAAAGACTGAGAAAGG + Intronic
1185021753 22:48380514-48380536 GTGCTGGGAAAGAGTGAGAATGG + Intergenic
951421470 3:22490949-22490971 CTATTGGGAAATAGTGAGAAAGG - Intergenic
951508279 3:23473580-23473602 CAGTGGGGAAAGGGTGGGAAGGG - Intronic
952671051 3:35969072-35969094 CTGGGGGGAAGATTTGAGAAAGG + Intergenic
953187808 3:40654608-40654630 CTGTGGGGAGAGCTGGGGAAAGG + Intergenic
953202269 3:40788057-40788079 CTTTGGGAAACTATTGAGAAGGG + Intergenic
953546707 3:43868875-43868897 CTCTGGGGAGAGATTGGGAGAGG - Intergenic
954037498 3:47859487-47859509 TTTAGAGGAAAGATTGAGAATGG - Intronic
955237989 3:57156795-57156817 ATGTGGGCAAAGCTGGAGAAGGG - Intronic
955723708 3:61910208-61910230 CTGTGGGGAATGGGTAAGAATGG - Intronic
955796753 3:62645192-62645214 CTCAGGGGAAAGAGTGGGAAGGG + Intronic
956639112 3:71397957-71397979 GAGTGGGGAAAGAGAGAGAAGGG + Intronic
957172524 3:76756908-76756930 ATGTGGAGAAAGACTGTGAAGGG + Intronic
957485040 3:80849978-80850000 CTGTGTGAAAAGACAGAGAAGGG + Intergenic
957711925 3:83872321-83872343 CTGTGGGGGAATGTTGATAATGG + Intergenic
958066850 3:88554800-88554822 CTTGGGGGAAAGAGTGGGAAGGG + Intergenic
958270555 3:91493786-91493808 GTGTGGGGAAATAATTAGAAAGG + Intergenic
958491441 3:94779278-94779300 CTGTTGGAAAAGATAGAGATGGG + Intergenic
958772843 3:98446806-98446828 CTGAGGTGAAAGACTGAAAAGGG - Intergenic
959027873 3:101262033-101262055 CTGAGGAGAAAGAATAAGAAAGG - Intronic
959874023 3:111360689-111360711 CTTTGGGGAACTATTGAGAAGGG + Intronic
960352421 3:116609691-116609713 ATTTGGGGAAAGATTAAAAAAGG - Intronic
960729491 3:120710535-120710557 ATGTGGGCACAGATGGAGAAAGG - Intronic
961092611 3:124127462-124127484 GTTTGGGGTCAGATTGAGAAGGG - Intronic
961525369 3:127493517-127493539 CTTTTGGGAATTATTGAGAATGG - Intergenic
961994383 3:131226096-131226118 GAGTGGGGAAAGAGGGAGAATGG + Intronic
964080086 3:152743855-152743877 CTATGGAGAAAGATAAAGAAGGG - Intergenic
965599445 3:170440922-170440944 CTGTGTGGAAAGAGTGAGTCTGG + Intronic
967213139 3:187186602-187186624 CTGTGTGGAAAGAACAAGAAAGG - Intergenic
967371949 3:188756583-188756605 CTTTAGGGAGAGATTCAGAATGG - Intronic
969275141 4:6129649-6129671 GTGTAGGGAAATATTGAGAACGG - Intronic
970329436 4:14964063-14964085 TTGTGGGGTAAGAGTGAAAAGGG - Intergenic
971146757 4:23985306-23985328 CTGATGAGAAAGAGTGAGAAGGG + Intergenic
973154022 4:46925873-46925895 ATGTGGCCAAAGAATGAGAAAGG - Exonic
973535250 4:51875031-51875053 GAATGGGGAAAGATGGAGAAAGG - Intronic
973840062 4:54852256-54852278 CTGTGAGGGAACAGTGAGAAAGG + Intergenic
974755512 4:66201913-66201935 TTCTTGGGAAATATTGAGAATGG - Intergenic
975609968 4:76193826-76193848 CTTTGGGGGACTATTGAGAAGGG + Intronic
975736733 4:77388689-77388711 CTGAGGGTAAAGATTGAGGATGG - Intronic
975974138 4:80075660-80075682 CAGTTGGCAAAGAGTGAGAAGGG - Intronic
976152219 4:82103954-82103976 CTTGGGGGAAAGGGTGAGAAGGG + Intergenic
976196889 4:82541207-82541229 CTTTGGGGAAATACAGAGAAAGG - Intronic
976308141 4:83581998-83582020 ATTTGGGGAAAAATTGTGAAAGG - Intronic
976685840 4:87813765-87813787 CTTGGGGGGAAGAGTGAGAAGGG - Intergenic
977904258 4:102457422-102457444 GAGTGGGGAAAGCTAGAGAAGGG + Intergenic
977912003 4:102548132-102548154 ATGTGGAGAAAGAGAGAGAAAGG + Intronic
980748400 4:137053644-137053666 GTCTGGGAAAAGATTGAAAAAGG + Intergenic
981130136 4:141149384-141149406 CTCTGGGGAAAGAGTGGGAGGGG - Intronic
981591643 4:146370648-146370670 CTGTGGGGGAAGATTAAAAAAGG - Intronic
981835605 4:149049962-149049984 CAGTGTGGGAAGGTTGAGAAGGG + Intergenic
982149367 4:152435493-152435515 CAGTGTAGAAAGATTGAGAAAGG - Intronic
982294687 4:153814986-153815008 CCGGGGGGAAAGATCGAGATTGG + Intergenic
982298338 4:153853226-153853248 CTCAGGGGAAAGAGTGGGAAGGG - Intergenic
982830263 4:160050660-160050682 CTCTGGGGAAAGAGTGGGAGGGG + Intergenic
982919051 4:161250834-161250856 CTTGGGTGAAAGAATGAGAAAGG + Intergenic
983839569 4:172439858-172439880 CTGTTGGGAAACATTGATAATGG - Intronic
985299751 4:188475459-188475481 CTATGGGGAATCAATGAGAATGG + Intergenic
986135135 5:4969786-4969808 ATGGGGGGAGAGATAGAGAAAGG + Intergenic
987641437 5:20616899-20616921 CTGAGGCAAAATATTGAGAATGG + Intergenic
988196730 5:28014161-28014183 CTTTAGGGAAAGACTGAGAGTGG + Intergenic
989151376 5:38303024-38303046 TTGTGAGGAAAGATAGGGAAGGG + Intronic
989690289 5:44135405-44135427 CTCTGGGGAAAGAGTGGGAAGGG - Intergenic
989714817 5:44450686-44450708 CTGTGGGGAGACATTGGGGAGGG - Intergenic
989983872 5:50673168-50673190 CTGTGGGGAGGGAGTGTGAAGGG + Intronic
990196038 5:53317426-53317448 GGGTTGGGAAAGATTAAGAATGG + Intergenic
990714273 5:58619245-58619267 CTTTGGGGAATGATGGAGCAGGG - Intronic
990716206 5:58639957-58639979 CTGTGGATAAAGAAAGAGAATGG - Intronic
990814709 5:59770450-59770472 CTCTGGGTAAAGTTTAAGAAGGG + Intronic
991259464 5:64651116-64651138 CTTTGGGGGACTATTGAGAAGGG + Intergenic
991509765 5:67363825-67363847 CTTGGGGGAAAGAGTGAGGAAGG + Intergenic
992226293 5:74622335-74622357 GTGTGGGAGAAGAATGAGAAAGG - Intergenic
992433575 5:76733242-76733264 CTGTGGTGGAAGTGTGAGAAAGG - Exonic
992480890 5:77151712-77151734 CTGTCTGGAAGGAGTGAGAAGGG - Intergenic
992877719 5:81074300-81074322 CTGTGGAGAAAAATAAAGAAGGG + Intronic
993444783 5:87997939-87997961 GACTGGGGAAAGATTGTGAAAGG + Intergenic
993857348 5:93092951-93092973 CTGTGGAGACAGATAGAAAAGGG - Intergenic
993859739 5:93120784-93120806 CTCTTGGGAATTATTGAGAATGG - Intergenic
994304493 5:98186324-98186346 CTCAGGGGAAAGAGTGACAAGGG + Intergenic
994570477 5:101507348-101507370 CTTTGGAGGATGATTGAGAAGGG + Intergenic
995414040 5:111889544-111889566 CTTTGGGGTACTATTGAGAAGGG - Intronic
996387512 5:122925017-122925039 ATGTGGGGAGAGAAGGAGAAGGG - Intronic
996605125 5:125312870-125312892 CTGTTGGGAAGGAATGAGATTGG - Intergenic
996836639 5:127801056-127801078 CTGTGTGTAAAGATTTGGAATGG + Intergenic
996903862 5:128575502-128575524 CTATGGGGATGGATTGAGAGGGG + Intronic
997602167 5:135148075-135148097 ATATGGGGAAGGATTGAGATTGG - Intronic
997666830 5:135636248-135636270 CTGTGGGGAAACAGTGAGTGAGG + Intergenic
998171425 5:139874011-139874033 GTGTGGGGAAAGAGTGACCACGG + Intronic
999835402 5:155364867-155364889 CTGTTGGGAAGAAATGAGAAAGG + Intergenic
999958873 5:156732632-156732654 CTGTGACAAAAAATTGAGAAGGG - Intronic
1000198912 5:158988323-158988345 GTATAGGGAAAGAGTGAGAATGG - Intronic
1000565706 5:162844805-162844827 GTTTGGGGAAATATAGAGAATGG + Intergenic
1000847631 5:166301184-166301206 CTGATGGGATAGATTGAGAAAGG - Intergenic
1001090372 5:168735890-168735912 GTGTGCTGAAAGCTTGAGAAGGG - Intronic
1002540887 5:179906271-179906293 CAGTGGGGAGAGATTGGGAGAGG + Intronic
1002839484 6:893749-893771 CTGTGGGGACAGAGGAAGAAAGG - Intergenic
1003454662 6:6270708-6270730 CTGTGGAGGAAGGTGGAGAATGG + Intronic
1004149935 6:13107120-13107142 CTGTCTGGAAAGAGTGAGAGAGG - Intronic
1004972154 6:20922554-20922576 CTGTGGTGAATGAATGGGAAAGG + Intronic
1005228413 6:23671016-23671038 CTCTGGGGAACTATTGAGAAGGG - Intergenic
1005457656 6:26036536-26036558 CTGTGGAGAAAAATAAAGAAAGG + Intergenic
1006108113 6:31728784-31728806 CTTTGGGGAAGAATTGAGGATGG - Intronic
1006318272 6:33303990-33304012 CTGTGGGGAAAGATTGAGAAGGG + Intronic
1007276668 6:40679230-40679252 CTGTGGAGAAAGACTGTGGATGG - Intergenic
1007307236 6:40916747-40916769 ATGTGGGTCAAGACTGAGAACGG + Intergenic
1008984590 6:57527558-57527580 GTGTGGGGAAATAATTAGAAAGG - Intronic
1009172637 6:60420446-60420468 GTGTGGGGAAATAATTAGAAAGG - Intergenic
1011078560 6:83464268-83464290 CTGTGAAAAAAGATTGATAAGGG + Intergenic
1011402573 6:86979972-86979994 TTATGGGGAGAGAGTGAGAATGG - Intronic
1012020502 6:93912456-93912478 CTGTGGAGGAAGATTGTGACAGG - Intergenic
1015021988 6:128487531-128487553 CTTTAGGGAAGGATGGAGAAGGG - Intronic
1015721933 6:136251301-136251323 CACTGGGGAAAGATAGAGCATGG - Intergenic
1016350939 6:143166421-143166443 TTGTCAGGAAAGACTGAGAAGGG - Intronic
1016804250 6:148196998-148197020 GACTGGGGAAAGATAGAGAATGG + Intergenic
1017174344 6:151489043-151489065 GTATGGGGAAAGATAGAAAATGG + Intergenic
1018102943 6:160457365-160457387 CTGTTGAGAAAGAATAAGAAAGG - Intergenic
1018381095 6:163259290-163259312 CTATGGGGAGAGATTGGAAAGGG + Intronic
1018603111 6:165567589-165567611 ATATGGGGAGAGATTGGGAATGG - Intronic
1019480792 7:1265811-1265833 TTGTGGGGACAGATTGTGTAGGG + Intergenic
1020055794 7:5116974-5116996 AGGTGGGGACAGAGTGAGAAAGG + Intergenic
1021132491 7:16927994-16928016 CTGTGGAGATAGATTAAGCAGGG - Intergenic
1022437046 7:30397501-30397523 CTTTGGGGATAGAATGAGATTGG + Intronic
1022797509 7:33743976-33743998 ATGAAGGGAAAGATTGAGGAAGG - Intergenic
1022953387 7:35360023-35360045 CTTGGGGGAAAGAGTGGGAAGGG - Intergenic
1024228118 7:47343903-47343925 CTATGGAGAAAGAGAGAGAATGG + Intronic
1025736109 7:64148249-64148271 CTGTGGGGAAAGAGACAGCAGGG + Intronic
1026292217 7:69018033-69018055 CTTTGGGGAGCTATTGAGAAGGG - Intergenic
1026955798 7:74375864-74375886 CTGTGGGGAGAGAGGGAGACAGG - Intronic
1027304310 7:76876519-76876541 GTGTTAGGAAAGATTCAGAATGG + Intergenic
1027469596 7:78556702-78556724 GTAAGGGGAAAGCTTGAGAAGGG - Intronic
1027886220 7:83909299-83909321 CACTGGGGAAAGTTTGGGAAGGG - Intergenic
1028784049 7:94772281-94772303 CTTTGGGGAAAGGGTGGGAAGGG + Intergenic
1029379538 7:100203998-100204020 CTGAGGGGAAAGAGTGGGGAAGG - Intronic
1029647640 7:101868444-101868466 CTGGGGGAAAAGACTGAGACAGG - Intronic
1030187729 7:106779972-106779994 CTGTGGGAAAAGAGGGAGCATGG - Intergenic
1031158676 7:118140589-118140611 CTCTGGGGAGAGATCCAGAAGGG - Intergenic
1031543085 7:123019174-123019196 TTTTGAGAAAAGATTGAGAATGG + Intergenic
1031614353 7:123863868-123863890 CTTTGGGGAAGGAGTGAGAAGGG + Intronic
1034089768 7:148352893-148352915 CTTTGGGGAAAGGTAAAGAAGGG - Intronic
1034316060 7:150134381-150134403 CAGTGGTGAAAGAGAGAGAAGGG - Intergenic
1034790828 7:153966400-153966422 CAGTGGTGAAAGAGAGAGAAGGG + Intronic
1035942567 8:3918871-3918893 TTGTGGGGAAAGAATAGGAAGGG + Intronic
1036282127 8:7409249-7409271 CTTTGGGGAGTGATTGGGAAGGG + Intergenic
1036339342 8:7902322-7902344 CTTTGGGGAGTGATTGGGAAGGG - Intergenic
1036518600 8:9469147-9469169 CTTTGGGGAACTGTTGAGAAGGG + Intergenic
1036521543 8:9495912-9495934 ATATGGTGAAAGCTTGAGAAAGG - Intergenic
1038368527 8:26962787-26962809 CTGAGGGGAGAGAGTGGGAAGGG - Intergenic
1038419199 8:27421461-27421483 CTCTGGGGAAAGAGTGGGAAGGG - Intronic
1041491594 8:58438747-58438769 CTTTGGGGGACTATTGAGAAGGG + Intronic
1042181715 8:66095063-66095085 CAGTAAGGAAAGTTTGAGAAAGG - Intronic
1043859160 8:85296023-85296045 TTCAGGGGAAAGATTGGGAATGG - Intergenic
1043978776 8:86614442-86614464 CAGTGGGGAGAGAGAGAGAATGG - Intronic
1043988413 8:86721406-86721428 CTATGGGGAAAGAGTGGGAAGGG + Intronic
1044731635 8:95233059-95233081 CTGTTGGCAGGGATTGAGAATGG - Intergenic
1045365934 8:101476253-101476275 TTGGGGAGTAAGATTGAGAAAGG + Intergenic
1045802917 8:106122770-106122792 CTGAGTGGAAAAATTGATAATGG + Intergenic
1046109945 8:109710554-109710576 CTATGGGAAAAAATTGAGACAGG - Intergenic
1046224813 8:111264000-111264022 CTCTGGGAAAAAAATGAGAAAGG + Intergenic
1047481926 8:125292003-125292025 CCATGGGGAAAGAATGAGATTGG + Intronic
1047526446 8:125638198-125638220 TTGTGGAGAAAGACTGGGAAGGG + Intergenic
1047624681 8:126644453-126644475 CTGTGAGGACACAATGAGAAGGG + Intergenic
1049181680 8:141226189-141226211 CAGAGGGGAAAGATGGAGAAAGG - Intronic
1049326262 8:142023096-142023118 CTGTGGGGGAAGATTGGGGCAGG - Intergenic
1049445877 8:142631267-142631289 GTGTGGGGACAGGTGGAGAAGGG - Intergenic
1049517218 8:143066815-143066837 CTTTGGGGAACTACTGAGAAGGG + Intergenic
1050024684 9:1321434-1321456 CTGAGTGGAAAGATGAAGAATGG - Intergenic
1050193071 9:3050260-3050282 CAGTGGGGAATGACTGGGAAAGG + Intergenic
1050409176 9:5343728-5343750 CGGGGGGGAAAGGGTGAGAAGGG + Intergenic
1050781739 9:9344977-9344999 TGGTGGGGAAAAATTGATAAGGG + Intronic
1051123321 9:13775575-13775597 ATGTGGGGAAAGAATGAATAAGG + Intergenic
1051183796 9:14438542-14438564 CTGTGGGGAAAGCTGGAAAGGGG + Intergenic
1051962060 9:22778719-22778741 TTCTGAGGATAGATTGAGAATGG + Intergenic
1052415593 9:28172638-28172660 CTTCAGGGAAAGATGGAGAAAGG + Intronic
1052616055 9:30843310-30843332 TGGTGGGGAAAGGATGAGAAAGG + Intergenic
1052636634 9:31115058-31115080 CTGGTGGGAAATATTGATAATGG + Intergenic
1052683424 9:31724016-31724038 CCTTGGGGAAAGCTTGGGAAGGG - Intergenic
1053091662 9:35283819-35283841 CTCTGGGGAAAGAGTGTGATAGG + Intronic
1055048781 9:71958720-71958742 ATCTGGGGAAAGAAAGAGAAAGG - Intronic
1056262679 9:84864346-84864368 CTGTGGGGAAAGGGTGGGAGGGG + Intronic
1056445851 9:86665701-86665723 GTGTGGTGAAAGTTTGATAAAGG - Intergenic
1056670355 9:88622665-88622687 CTTTGGGGGACTATTGAGAAGGG - Intergenic
1057826350 9:98375179-98375201 GTGAGGGGAAAGACTGAGCAGGG - Intronic
1058061968 9:100507014-100507036 CAGTGGGGAGAGAGGGAGAAAGG - Intronic
1058839314 9:108890884-108890906 CTGTGGGGAAGGAAGGAGAGTGG - Intronic
1058858641 9:109092111-109092133 CTGAAGAGAAAGAATGAGAAAGG - Intronic
1059305718 9:113351557-113351579 CTGGGTGGAAAGATTTACAAGGG + Intronic
1059367292 9:113796696-113796718 CAGAGGGGAATGATTCAGAATGG + Intergenic
1059824684 9:118016109-118016131 CTTTTGGGAAAGCATGAGAAGGG - Intergenic
1059973838 9:119694915-119694937 CTAGGGGCAAAGATTCAGAAGGG + Intergenic
1059983119 9:119794990-119795012 CTGTGAAGAAGGCTTGAGAAGGG + Intergenic
1060026068 9:120172620-120172642 TTGAGGGGAAAGAGTGGGAAGGG + Intergenic
1060328391 9:122641490-122641512 TGGTGGGGAAAGAGTAAGAATGG + Intergenic
1060771941 9:126338182-126338204 CTGGGGGGAAGGAGGGAGAACGG + Intronic
1062439929 9:136565130-136565152 TTTTGGGGAATGATTCAGAAGGG - Intergenic
1186163708 X:6804929-6804951 CCATGGGGAAAAATTGAGAGGGG + Intergenic
1186987666 X:15034254-15034276 GTGTGAGGACAGATGGAGAATGG + Intergenic
1187441828 X:19327823-19327845 CTGTGGGGTTGGGTTGAGAAAGG - Intergenic
1187454693 X:19430917-19430939 CTATGGGGAAAGGTTAAGCAGGG - Intronic
1187613209 X:20965308-20965330 CTGTGAGACAAGATTGACAAAGG - Intergenic
1189962680 X:46339459-46339481 CTTGGGGGAAAGAGTGAGATGGG + Intergenic
1190148216 X:47918022-47918044 CTCTGTGGGAAGATAGAGAATGG + Exonic
1190209428 X:48433110-48433132 CTGTGGGGAAAGATGGTGTGGGG - Intergenic
1190420919 X:50283556-50283578 TTGAGGGGAAAGTTTAAGAAAGG - Intronic
1190833505 X:54080047-54080069 CTGTGGGAAAAGCTTGAGGCAGG + Intronic
1192695960 X:73416438-73416460 CTTTGGGGGATTATTGAGAAGGG - Intergenic
1193490476 X:82143152-82143174 TTATGGGGGAAGAGTGAGAAGGG - Intergenic
1193939142 X:87658461-87658483 CAGTGGGGAGACCTTGAGAAGGG - Intronic
1194093424 X:89604746-89604768 CTTTGGGGAAATATTGAGAAGGG + Intergenic
1194104124 X:89747338-89747360 CTGAGGGGAAAGGGTGGGAAGGG - Intergenic
1196188489 X:112770765-112770787 CAGTGGGACAAGATTGAGCATGG + Intergenic
1196224505 X:113149463-113149485 GTGTGTGGAATGATTGAAAAGGG - Intergenic
1197308865 X:124879261-124879283 ATATGGGGAAAGATCAAGAAAGG - Intronic
1197923507 X:131621668-131621690 CTGGAGGGAAAGATTCATAAAGG - Intergenic
1199038132 X:143078104-143078126 CTTTGGGGGACTATTGAGAAAGG - Intergenic
1199247074 X:145617785-145617807 TTGTGAGGAAAGATTGGAAATGG - Intergenic
1199294391 X:146140836-146140858 ATTTAGGGAAAGAATGAGAATGG + Intergenic
1199584634 X:149401346-149401368 CTTGGGGGAAAGAGTGGGAATGG + Intergenic
1200446053 Y:3260849-3260871 CTTTGGGGAAATATTGAGAAGGG + Intergenic