ID: 1006318435

View in Genome Browser
Species Human (GRCh38)
Location 6:33304686-33304708
Sequence AAACTGAGGGTCTCTTAGGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 156
Summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 147}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1006318435_1006318444 12 Left 1006318435 6:33304686-33304708 CCTCCCTAAGAGACCCTCAGTTT 0: 1
1: 0
2: 0
3: 8
4: 147
Right 1006318444 6:33304721-33304743 CCTCAGAACTAAAGAAGGTTAGG 0: 1
1: 0
2: 0
3: 6
4: 168
1006318435_1006318442 7 Left 1006318435 6:33304686-33304708 CCTCCCTAAGAGACCCTCAGTTT 0: 1
1: 0
2: 0
3: 8
4: 147
Right 1006318442 6:33304716-33304738 GGCTTCCTCAGAACTAAAGAAGG 0: 1
1: 0
2: 3
3: 8
4: 165

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1006318435 Original CRISPR AAACTGAGGGTCTCTTAGGG AGG (reversed) Intronic
900202072 1:1412724-1412746 AAAGTGAGAGTCTCAAAGGGGGG - Intergenic
902581516 1:17410655-17410677 AAACAGAGGGTCCCACAGGGCGG + Intronic
903797832 1:25943524-25943546 AAAGTGAGAGTCTCAAAGGGGGG + Intergenic
905081956 1:35330613-35330635 AAATTGAGGCTCTCTTAGTAAGG + Intronic
906498939 1:46326043-46326065 AAAGTGAGAGTCTCAAAGGGGGG - Intergenic
908784705 1:67723364-67723386 AAACAGAGGGAGTGTTAGGGAGG + Intronic
917432632 1:174986470-174986492 AAACTCAGGGTCTGTTAGTAAGG + Intronic
920603508 1:207354540-207354562 AAACTGAAGAGCTCTTAGGTGGG - Intronic
921125044 1:212170116-212170138 AGAATGAGGGTATCTCAGGGCGG - Intergenic
922079183 1:222278195-222278217 AGACTGAGGTTCTGTTAGTGAGG - Intergenic
922694101 1:227719155-227719177 AAAGTGAGAGTCTCAAAGGGGGG + Intergenic
1063668440 10:8080614-8080636 AAACTGATGGCCTCTAGGGGCGG + Intergenic
1066451969 10:35537837-35537859 GAAATGAGGGACTATTAGGGAGG + Intronic
1067367555 10:45648138-45648160 AAACTGAGGTTTTTTTAGAGTGG - Intronic
1069622807 10:69848129-69848151 AGACTGAGGGGCTCTGGGGGAGG + Intronic
1071288147 10:84167673-84167695 AAACTGAGAGTCTCAAAGGGGGG - Intergenic
1072688788 10:97555946-97555968 AAAGTGAGAGTCTCAAAGGGGGG - Intronic
1072873485 10:99146449-99146471 AAACTGAGTTTCTCTTAGTGAGG - Intronic
1073329654 10:102661790-102661812 AAGATGAGGGTGTCTTAGGAAGG - Intergenic
1073340131 10:102738016-102738038 AAGCTGAGGCCCTCTCAGGGAGG + Exonic
1073491569 10:103855958-103855980 AAACTCAGGGTGGCTTCGGGGGG + Intergenic
1077394128 11:2312818-2312840 GAACTGAGGGCCTCTGAGGCAGG + Intronic
1078416840 11:11172989-11173011 AAACCCAGGTTCTCTGAGGGAGG + Intergenic
1078426383 11:11254271-11254293 CAACCCAGGGTCTCTTAGGAAGG + Intergenic
1085553909 11:77402298-77402320 AGACTGAAGTTCTCTTAGGCTGG + Intronic
1085999031 11:81956311-81956333 AAAGTGAGAGTCTCAAAGGGGGG + Intergenic
1089158873 11:116422900-116422922 AAACTGTGGGGCTCCTATGGAGG - Intergenic
1090067713 11:123517908-123517930 AAACTCAGGTTCTCTCCGGGAGG - Intergenic
1090951724 11:131479487-131479509 AAACTAAGGGTCGCCTAAGGTGG + Intronic
1091350932 11:134893453-134893475 ACACAGAGGGTCTTTTGGGGTGG + Intergenic
1095120985 12:38418666-38418688 AAACTTCAGGTTTCTTAGGGAGG + Intergenic
1096905298 12:54930167-54930189 AAAGTGAGAGTCTCAAAGGGGGG + Intergenic
1098045750 12:66398587-66398609 AAGCTGTGGGTCTCATAGGAAGG - Intronic
1098639162 12:72818792-72818814 AAAGTGAGAGTCTCAAAGGGGGG - Intergenic
1100137875 12:91576792-91576814 AAACTGTGGGTGTCTTTGAGAGG + Intergenic
1107990526 13:45815065-45815087 AAAATGAAGGTCTATTAGGTTGG - Intronic
1112261225 13:97880042-97880064 AAACTGAGGGACTTTAAGGAAGG - Intergenic
1113642754 13:111969892-111969914 AAGCTGAGGCTCTCTCAGGCTGG + Intergenic
1114655292 14:24311902-24311924 AAACTGAGGGATTATGAGGGTGG + Exonic
1114678314 14:24460491-24460513 AACCTGAGGGGTTCCTAGGGAGG + Intergenic
1114884957 14:26837509-26837531 AAACAGAGTCTCTCTTTGGGAGG + Intergenic
1115782829 14:36788764-36788786 AAGATGAGGTTCTCTTAGGAAGG - Intronic
1116201374 14:41801984-41802006 AAATTGAGGATGTCTTATGGTGG + Intronic
1117160864 14:52988104-52988126 AAACTGAGGGTCAAATATGGTGG - Intergenic
1117162941 14:53006955-53006977 AAGCTGAGGTTCTATTAGGAAGG + Intergenic
1118648747 14:67867678-67867700 AAACTGGGGCTCTCATAGCGAGG + Intronic
1119576244 14:75725193-75725215 AACCTGAGGTTCTTATAGGGAGG + Intronic
1119584503 14:75820302-75820324 AAAATGAGGCTCTCTTAGTCAGG - Intronic
1119654318 14:76406264-76406286 TCTCTGAGGGTCTCTGAGGGTGG + Intronic
1119863647 14:77955399-77955421 AAACTGAGGTTCTGTTGTGGAGG + Intergenic
1123116697 14:105898106-105898128 AAACTCAGGGTGTCTCAGAGAGG + Intergenic
1123403695 15:20008551-20008573 AAACTCAGGGTGTCTTGGAGAGG + Intergenic
1123513032 15:21015197-21015219 AAACTCAGGGTGTCTTGGAGAGG + Intergenic
1126292661 15:47099653-47099675 AAGCTGAGGGGATCTGAGGGTGG - Intergenic
1127484631 15:59407744-59407766 AAACAGGTGGTCTCTTAGTGGGG + Intronic
1137532864 16:49293565-49293587 AAAATGAAGCTCTCTTTGGGTGG - Intergenic
1138535623 16:57658808-57658830 AAACTGAGAGTCTCAAGGGGAGG + Intronic
1140951041 16:79817773-79817795 AAACTCAAGGTCTCTTAGCAAGG - Intergenic
1142114691 16:88350493-88350515 AAACTGAGGCTCTGAGAGGGAGG - Intergenic
1147592839 17:41695957-41695979 AAACTGAGTGTTTCTTAAGATGG + Intergenic
1148625534 17:49066395-49066417 AAACTGTGGGTCTTTTTTGGGGG - Intergenic
1150346986 17:64411902-64411924 AAACTCAGAGTCTCTTAGTGTGG - Intronic
1152019560 17:77773250-77773272 AAACTGAAGGTCTGCAAGGGAGG - Intergenic
1154045529 18:10901276-10901298 ACCCTGAGGGTCTCTGATGGTGG - Intronic
1157727789 18:49978201-49978223 AACATCAGGGCCTCTTAGGGAGG - Intronic
1157863485 18:51161701-51161723 AAACTCAGGGAATCTTATGGTGG + Intergenic
1160948598 19:1654905-1654927 AAACTGAAGGGCTCCTCGGGAGG - Intergenic
1161219934 19:3113802-3113824 AAACCCAGGGTCTCCTAGGAGGG + Intronic
1162967865 19:14164487-14164509 CGACTGAGGGTCCCTCAGGGGGG + Intronic
926702844 2:15815349-15815371 AAACTGAGGGTCTACTAGGTAGG + Intergenic
928022718 2:27716298-27716320 AAACAGAGGGGCCCTTGGGGAGG - Intergenic
930486613 2:52018393-52018415 AAACTGAAGGTCTGTTTGAGAGG - Intergenic
933805112 2:85993422-85993444 AAGCTGAGGGGCACTTTGGGAGG + Intergenic
939599663 2:144173560-144173582 TAACTGAGGGTCAGTTGGGGAGG - Intronic
940010453 2:149049175-149049197 AAACTGATAGTCTCTTAGAATGG + Intronic
942826361 2:180181602-180181624 AAACTGAGGGTAACTTAGCAAGG + Intergenic
943551973 2:189352198-189352220 AAACTGATGGTCTTTTGGGTTGG + Intergenic
1171185197 20:23119947-23119969 AAACTGAGGATCTGTTGGGAGGG + Intergenic
1171536713 20:25898940-25898962 AAGCTGAGGGGGTCTGAGGGTGG + Intergenic
1174988567 20:55483621-55483643 AGACTGAGGGTTGCTTAGGTAGG - Intergenic
1175383356 20:58578603-58578625 AAATTGAGGGATTCCTAGGGAGG - Intergenic
1176121025 20:63454680-63454702 AAACTGAGGCTCACTGAGGCAGG + Intronic
1178365106 21:31983629-31983651 AACCTCAGGGTCTCTTAGGAAGG + Intronic
1180102353 21:45594833-45594855 ATGATGAGGGGCTCTTAGGGTGG - Intergenic
1182241058 22:28916760-28916782 GCACTGAGGGTCTCTTTGTGGGG - Intronic
1182558439 22:31141361-31141383 AAACTGAGGCTCAGTGAGGGTGG + Intergenic
1182683119 22:32098570-32098592 AAAATGAGATTCTCTTATGGTGG + Intronic
950021590 3:9791747-9791769 AAACTGAGACTCTGTAAGGGTGG + Intronic
950038430 3:9903610-9903632 AAACTGAGGGTCAGTTGGAGGGG - Intronic
956770969 3:72525707-72525729 AAACTGAGGCTCTCATAGCTTGG - Intergenic
956901963 3:73726225-73726247 AAACTGGGGCTCTGTGAGGGAGG + Intergenic
958783172 3:98566967-98566989 AAACTGCGGCTCTATTAGGCAGG + Intronic
960299429 3:115983992-115984014 AAACTGAGGGAATGTTAGAGAGG + Intronic
961553942 3:127685032-127685054 AAACTGAGAGACTCTCAGGATGG - Intergenic
961874792 3:130014047-130014069 AAAATGAGGTTCTCTGAGGAAGG - Intergenic
963567687 3:146949820-146949842 AATCTGTGGATCTCTTTGGGTGG + Intergenic
964434006 3:156633454-156633476 AGTCTGTGGGACTCTTAGGGTGG + Intergenic
966472788 3:180310808-180310830 GAACTGAGGGTCTAGTATGGGGG + Intergenic
971973419 4:33651351-33651373 AAAATGTGGGCCTCTTTGGGTGG - Intergenic
972077891 4:35108743-35108765 TAAGTGAGGGTCTCAAAGGGGGG + Intergenic
972275324 4:37551960-37551982 AAAGTGAGAGTCTCAAAGGGGGG + Intronic
973238669 4:47933195-47933217 AAACTGAGTCTCACTGAGGGAGG - Intronic
976989939 4:91353601-91353623 AAAGTGAGAGTCTCAAAGGGGGG - Intronic
977268631 4:94886802-94886824 AAACTGGGAATCACTTAGGGAGG + Intronic
981533869 4:145779287-145779309 AAACTGAGTTTCTCTAAGAGAGG - Intronic
982445234 4:155483323-155483345 AAACTGAGGGTCAGTTAGCAAGG + Intergenic
987029239 5:13960721-13960743 ATACTGAGGGACTCCCAGGGAGG - Intergenic
991991465 5:72344086-72344108 AACGTGAGGGGCCCTTAGGGCGG + Intronic
992989302 5:82267753-82267775 AAAGTGAGAGTCTCAAAGGGGGG - Intronic
997329435 5:133048534-133048556 AAAATGAGGATCTCTTAGCCAGG - Intergenic
997517492 5:134501374-134501396 AAACTGAGCATCTCTTTCGGTGG + Intergenic
998115094 5:139531060-139531082 AAAGTGAGAGTCTCAAAGGGGGG + Intronic
1000604481 5:163313525-163313547 AAAGTGAGAGTCTCAAAGGGGGG - Intergenic
1000881557 5:166703694-166703716 AAACTGAGGCTGCCTTAGGCAGG + Intergenic
1001798890 5:174526388-174526410 AAACTGAAAGTCTCCTAGAGTGG + Intergenic
1002377784 5:178800728-178800750 CCACTGAGGGTTTCTTTGGGCGG - Intergenic
1004431020 6:15543479-15543501 AACCTGAGGGAGTCTTACGGTGG - Intronic
1005838487 6:29724841-29724863 AAAGTTAGAGTCTCTGAGGGGGG - Intronic
1006318435 6:33304686-33304708 AAACTGAGGGTCTCTTAGGGAGG - Intronic
1007276759 6:40679772-40679794 AAACTGGGGCTCTCTGAGGATGG - Intergenic
1011596268 6:89019752-89019774 AAACTGGGAGTCTGTTAGGATGG - Intergenic
1013854742 6:114558740-114558762 AAACTAAGGGTCTCTTCAAGTGG + Intergenic
1014694294 6:124599577-124599599 AAACTGAGCATCTCTTAAGATGG + Intronic
1014964736 6:127733509-127733531 AGACTGAGTGTCTCTGAGGCTGG - Intronic
1016267522 6:142249763-142249785 CAGCTGACGGTCTCTTAGGAAGG - Intergenic
1016363604 6:143292873-143292895 AAGCTGAGGCTCTCTTAGGATGG - Intronic
1016890812 6:149005225-149005247 ACACAGAGGGTCTGTTGGGGAGG - Intronic
1017277185 6:152583259-152583281 AAAATGAAGGTCACTCAGGGTGG + Intronic
1018331887 6:162738085-162738107 AAGCTGTGGCTCTCTTAGTGAGG - Intronic
1018373063 6:163186319-163186341 AATCTGAGGGTGTCTGAGAGTGG - Intronic
1020420354 7:7996879-7996901 AAACTGAAGCTCTCTCAGTGTGG - Intronic
1022833482 7:34091638-34091660 AAAGTGAAGGCATCTTAGGGAGG - Intronic
1032979240 7:137263001-137263023 AAAGTGAGAGTCTCGAAGGGGGG - Intronic
1038443704 8:27588616-27588638 AAAGTGAAGGTCTCTCAGAGGGG + Intergenic
1040724946 8:50370932-50370954 AAGCTGAGATTCTATTAGGGAGG + Intronic
1040992496 8:53367643-53367665 AAAGTGAGAGTCTCAAAGGGGGG - Intergenic
1048255131 8:132899973-132899995 AAACTGAAGATCTCTCAGAGAGG - Intronic
1048977077 8:139679107-139679129 AAACTGGGGTTCTCTTAGTGAGG - Intronic
1049699308 8:144001319-144001341 AGGCTGAGGGTCTCTGAGGTAGG - Intronic
1049926964 9:418810-418832 AAACCAAGGCTCTCTGAGGGTGG + Intronic
1050029610 9:1371814-1371836 AAACTGAGGGCCTCTAAGAGAGG + Intergenic
1050368375 9:4894930-4894952 AAACTGAGGTTCTGTTAGTAAGG + Intergenic
1051358979 9:16265266-16265288 AAACTGAGGTTCTGTCAGGAAGG + Intronic
1051467742 9:17399864-17399886 AAACTGGGGGACACTTAGTGTGG - Intronic
1055480098 9:76701215-76701237 AAACTGTGGTTCTCTAAGTGGGG - Intronic
1057437462 9:95055621-95055643 AACCTGAGGGTCTGCTAAGGTGG + Intronic
1061821303 9:133228399-133228421 AAAATGAGGGTCTCCTTGGATGG + Intergenic
1061834144 9:133317964-133317986 AAAATGAGGGTCTCCTTGGATGG - Intergenic
1062518628 9:136948095-136948117 AAAGTGAGGGTCTCATCTGGGGG + Intronic
1186265589 X:7830234-7830256 AAACTGAGGGTGTTTTCTGGTGG + Intergenic
1186558433 X:10585287-10585309 AAAGTGAGAGTCTCAAAGGGGGG - Intronic
1192532031 X:71896351-71896373 AAAGTGAGGTTCTGTTAGGAAGG - Intergenic
1194552547 X:95319749-95319771 CAACTGGGGGGCTCTTAGGCAGG + Intergenic
1196559185 X:117125588-117125610 AATCTGAGGGTTTCATAAGGAGG + Intergenic
1196763938 X:119225872-119225894 AGAGTGAAGGTCTCTGAGGGTGG - Intergenic
1197094189 X:122574161-122574183 AGACTGAGGGACTGTTAGGAGGG - Intergenic