ID: 1006318551

View in Genome Browser
Species Human (GRCh38)
Location 6:33305222-33305244
Sequence GAGTGGCGACGCCAGCACCT GGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 120
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 114}

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1006318551_1006318569 27 Left 1006318551 6:33305222-33305244 CCCAGGTGCTGGCGTCGCCACTC 0: 1
1: 0
2: 0
3: 5
4: 114
Right 1006318569 6:33305272-33305294 CAGAGATGAGGCGGCCTCGGAGG 0: 1
1: 0
2: 0
3: 17
4: 154
1006318551_1006318564 18 Left 1006318551 6:33305222-33305244 CCCAGGTGCTGGCGTCGCCACTC 0: 1
1: 0
2: 0
3: 5
4: 114
Right 1006318564 6:33305263-33305285 ACCCGGAGCCAGAGATGAGGCGG 0: 1
1: 0
2: 1
3: 16
4: 200
1006318551_1006318563 15 Left 1006318551 6:33305222-33305244 CCCAGGTGCTGGCGTCGCCACTC 0: 1
1: 0
2: 0
3: 5
4: 114
Right 1006318563 6:33305260-33305282 GGGACCCGGAGCCAGAGATGAGG 0: 1
1: 0
2: 4
3: 18
4: 305
1006318551_1006318558 -6 Left 1006318551 6:33305222-33305244 CCCAGGTGCTGGCGTCGCCACTC 0: 1
1: 0
2: 0
3: 5
4: 114
Right 1006318558 6:33305239-33305261 CCACTCTAGCCCAAAGGGAGGGG 0: 1
1: 0
2: 0
3: 10
4: 128
1006318551_1006318560 1 Left 1006318551 6:33305222-33305244 CCCAGGTGCTGGCGTCGCCACTC 0: 1
1: 0
2: 0
3: 5
4: 114
Right 1006318560 6:33305246-33305268 AGCCCAAAGGGAGGGGGACCCGG 0: 1
1: 0
2: 1
3: 27
4: 284
1006318551_1006318555 -8 Left 1006318551 6:33305222-33305244 CCCAGGTGCTGGCGTCGCCACTC 0: 1
1: 0
2: 0
3: 5
4: 114
Right 1006318555 6:33305237-33305259 CGCCACTCTAGCCCAAAGGGAGG 0: 1
1: 0
2: 0
3: 1
4: 72
1006318551_1006318556 -7 Left 1006318551 6:33305222-33305244 CCCAGGTGCTGGCGTCGCCACTC 0: 1
1: 0
2: 0
3: 5
4: 114
Right 1006318556 6:33305238-33305260 GCCACTCTAGCCCAAAGGGAGGG 0: 1
1: 0
2: 0
3: 6
4: 115
1006318551_1006318570 30 Left 1006318551 6:33305222-33305244 CCCAGGTGCTGGCGTCGCCACTC 0: 1
1: 0
2: 0
3: 5
4: 114
Right 1006318570 6:33305275-33305297 AGATGAGGCGGCCTCGGAGGTGG 0: 1
1: 0
2: 2
3: 9
4: 211
1006318551_1006318559 -5 Left 1006318551 6:33305222-33305244 CCCAGGTGCTGGCGTCGCCACTC 0: 1
1: 0
2: 0
3: 5
4: 114
Right 1006318559 6:33305240-33305262 CACTCTAGCCCAAAGGGAGGGGG 0: 1
1: 0
2: 1
3: 13
4: 173
1006318551_1006318567 24 Left 1006318551 6:33305222-33305244 CCCAGGTGCTGGCGTCGCCACTC 0: 1
1: 0
2: 0
3: 5
4: 114
Right 1006318567 6:33305269-33305291 AGCCAGAGATGAGGCGGCCTCGG 0: 1
1: 0
2: 1
3: 19
4: 215

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1006318551 Original CRISPR GAGTGGCGACGCCAGCACCT GGG (reversed) Exonic
903359331 1:22766975-22766997 GAGTGGCACAGCCAGCAGCTTGG + Intronic
903585212 1:24409854-24409876 GAGTAGTGATGCCAGCACTTTGG + Intronic
905814067 1:40934410-40934432 GAGTGGTGATCCCAGCACTTTGG - Intergenic
906657057 1:47555991-47556013 GAGTGGCGCCACCAAAACCTCGG - Intergenic
907051139 1:51330525-51330547 GGGTTGCGGCGGCAGCACCTGGG - Intronic
908564823 1:65343656-65343678 GAGTAGTGATGCCAGCAACTTGG + Intronic
916661201 1:166923547-166923569 GAGTGGCTAGGCCAGCATTTTGG + Intronic
917106881 1:171501155-171501177 GAGTAGTAACCCCAGCACCTTGG - Intronic
923268645 1:232335369-232335391 CAGTGGCGATGCCAGCACCCCGG - Intergenic
924744838 1:246822314-246822336 GCGTGGCCATGCCAACACCTGGG - Intergenic
1062908370 10:1195184-1195206 GAGTTGCCAAGCCAGGACCTGGG - Intronic
1073094020 10:100969264-100969286 GGGTGGCGAGGCCACCACCAGGG + Intergenic
1075077733 10:119362276-119362298 AACTGGCCATGCCAGCACCTGGG - Intronic
1079611551 11:22438709-22438731 CAGTGGAGACTCCAGCTCCTGGG - Intergenic
1079803135 11:24896289-24896311 GAGAGGCGCCGCCAGAACCGGGG + Intronic
1082760786 11:57124974-57124996 GAGTGGGGACACCAGCTCCTGGG - Intergenic
1084068283 11:66718121-66718143 GCGTGGGGGTGCCAGCACCTGGG - Intronic
1084217752 11:67659574-67659596 TAGTGGTAACACCAGCACCTGGG - Intergenic
1084937292 11:72593801-72593823 CAGTGGCGACGCCATCAGCGAGG - Intronic
1085457073 11:76671122-76671144 GTGCGGCGGCGCCAGCAGCTGGG - Intergenic
1092182770 12:6457516-6457538 GAGTGGCGACTGCAGCACAAGGG + Exonic
1101417373 12:104520073-104520095 CAGTTCCGACGCCAGCAACTAGG - Intronic
1102956363 12:117061588-117061610 GGGTTGTGAAGCCAGCACCTGGG - Intronic
1104833828 12:131773876-131773898 GAGTGGCGGCTCCGGGACCTGGG + Intronic
1107976581 13:45694093-45694115 GCGTGGCTCTGCCAGCACCTTGG + Intergenic
1108524096 13:51271206-51271228 GAGAGGCGGCGCCAGCACACAGG - Intronic
1108856004 13:54793226-54793248 GAGTGCCTCTGCCAGCACCTTGG - Intergenic
1114658076 14:24328117-24328139 TAGCGGTGACGCCAGCATCTGGG + Intronic
1121284906 14:92727562-92727584 GAGGGGCGTGGCCAGCACATCGG - Intronic
1122230469 14:100304313-100304335 GAGGGGCCACCCCAGCACCCTGG + Intronic
1122556849 14:102585227-102585249 GAGTGGGGACACCAGGGCCTGGG + Intergenic
1125641367 15:41233115-41233137 GAGTGGAGACGCAAGCAGTTTGG + Intronic
1129734611 15:77952597-77952619 GAGCTGCGCCTCCAGCACCTTGG - Intergenic
1129840979 15:78743394-78743416 GAGCTGCGCCTCCAGCACCTTGG + Intergenic
1130064243 15:80591624-80591646 CAGTGGCAAAGCCAGCACCATGG + Exonic
1136510808 16:30737344-30737366 GAGTTCCCAGGCCAGCACCTAGG + Exonic
1136716952 16:32288964-32288986 GAGTGGGGACGTCCACACCTGGG - Intergenic
1136835329 16:33495209-33495231 GAGTGGGGACGTCCACACCTGGG - Intergenic
1137494482 16:48959181-48959203 AGGTGGCAACTCCAGCACCTGGG - Intergenic
1138656904 16:58496596-58496618 AAGTGGCGGGGCCAGAACCTAGG - Intronic
1141171156 16:81692600-81692622 GACTGGCCAGGCCAGCACATGGG - Intronic
1141613579 16:85197686-85197708 GAGTGGGGACGCCAGGACCAGGG - Intergenic
1141657349 16:85423273-85423295 GAGTGGCAAGGCCAGGCCCTGGG + Intergenic
1141921040 16:87135663-87135685 GAGTGGCTACGGCAGAACCTAGG - Intronic
1203009474 16_KI270728v1_random:228823-228845 GAGTGGGGACGTCCACACCTGGG + Intergenic
1142981935 17:3677410-3677432 TAGTGGGGAAGCCAGCTCCTGGG - Intronic
1147597758 17:41727689-41727711 GAGTGGGGACCCCAGGCCCTTGG - Intronic
1151731146 17:75912080-75912102 GAGGGGTGACCCCAGCTCCTGGG - Intronic
1152800961 17:82330449-82330471 GGGTGGCAGAGCCAGCACCTGGG - Intronic
1155382355 18:25238088-25238110 CAGTGCCGAGGCAAGCACCTTGG + Intronic
1157824581 18:50801264-50801286 GAGTTGAGACGCCAGACCCTAGG - Intronic
1160385297 18:78493093-78493115 GAGTGGCGTCTCCGGAACCTTGG - Intergenic
1160415813 18:78709879-78709901 GAGTGGCCAGGCCAGGGCCTTGG - Intergenic
1160563548 18:79773149-79773171 GGGTGGCCAGGGCAGCACCTGGG - Intergenic
1160858989 19:1229769-1229791 CAGTGGCTACGCCAGCATCGAGG - Exonic
1160873947 19:1288713-1288735 GAGAGGCGATGCCTGCACCCAGG + Intronic
1162729917 19:12712222-12712244 TAGCGGTGACGCCAGCATCTGGG + Intronic
1163586051 19:18164220-18164242 GAGTGGCTGAGCCAGGACCTGGG + Intronic
1165351964 19:35280410-35280432 GAGTGGCAAGCCCAGCTCCTGGG - Intergenic
1167007917 19:46787531-46787553 GAGCGCCGACGCCAGCAGCGTGG + Exonic
1167971435 19:53189874-53189896 TAGTGGTGACGCCAGCGTCTGGG - Intronic
1167991022 19:53360679-53360701 TAGTGGTGACGCCAGCGTCTGGG - Intergenic
925909448 2:8564078-8564100 GAGTGCCCAGGCCAGGACCTAGG + Intergenic
927858561 2:26543093-26543115 GAGAGGAGACGCCAGGACATGGG - Intronic
929598989 2:43193306-43193328 GTGTGGACACACCAGCACCTTGG - Intergenic
935673321 2:105573605-105573627 GTGTGGCCATGCCAACACCTTGG + Intergenic
936144386 2:109970062-109970084 TAGCGGTAACGCCAGCACCTGGG + Intergenic
936181069 2:110268022-110268044 TAGCGGTAACGCCAGCACCTGGG + Intergenic
936200302 2:110401407-110401429 TAGCGGTAACGCCAGCACCTGGG - Intergenic
938013403 2:127847320-127847342 GAGTGTCGATGACAGCACCTTGG - Exonic
947016491 2:225626317-225626339 CAGTGGCTAAGCTAGCACCTCGG + Intronic
947683446 2:232058287-232058309 GAGTAGCAAAGCCAGTACCTCGG + Intronic
949068897 2:242011558-242011580 CTGAGGCGACCCCAGCACCTCGG - Intergenic
1169014535 20:2280787-2280809 CAGTGGAGAGGCCACCACCTGGG - Intergenic
1169775310 20:9245666-9245688 GTATGGCCATGCCAGCACCTTGG + Intronic
1170763734 20:19273398-19273420 GGGTGGCTAAGCCAGCAGCTGGG - Intronic
1175910371 20:62402504-62402526 GCGTGCCCACGCCAGCACCGGGG + Intronic
1176216222 20:63949220-63949242 GAGTGGTGACGTCAGCAGCAGGG + Intronic
1179346724 21:40565127-40565149 GAGAGGAGAAGCCAGTACCTCGG - Intronic
1179885963 21:44314401-44314423 GGGTGGCGAGGCCAGGAGCTGGG + Intronic
1179892814 21:44345497-44345519 GGGTGGCGAGGCCAGCAACATGG - Intergenic
1185216568 22:49603255-49603277 GAGTGGCCTCGCCAGGGCCTGGG - Intronic
959228134 3:103612948-103612970 GAGTGGTGATGCCAGCAATTTGG - Intergenic
966934446 3:184696695-184696717 GAGTGTCAAGGCCCGCACCTGGG - Intergenic
967896043 3:194396961-194396983 GGGTGGCTGCGGCAGCACCTAGG - Exonic
968132923 3:196202548-196202570 GGGTGGCGAGGGCAGCACCGAGG + Intronic
978529946 4:109703094-109703116 GAGTAGCGACGCCGGCGCCGGGG - Intronic
983011265 4:162550558-162550580 TAGTGGTAACGCCAGCATCTGGG + Intergenic
995354566 5:111223900-111223922 GAGTTGCGCCACCACCACCTAGG + Intronic
1001636511 5:173213810-173213832 GAGTGCCGGCGCAAGCACCACGG + Intergenic
1002191763 5:177481969-177481991 GAGTGACGGCGCCACCACCAAGG + Intergenic
1002372732 5:178767961-178767983 AAGTGGGGGTGCCAGCACCTAGG + Intergenic
1004614907 6:17280901-17280923 GATTGGCCGCGGCAGCACCTGGG - Intergenic
1006318551 6:33305222-33305244 GAGTGGCGACGCCAGCACCTGGG - Exonic
1006916897 6:37600591-37600613 GAGAAGAGAGGCCAGCACCTGGG - Intergenic
1006979759 6:38137697-38137719 GAAGGGGGAGGCCAGCACCTGGG + Intronic
1010001838 6:70956501-70956523 CAGCGGCGGCGCCAGCACTTAGG + Exonic
1013589454 6:111607997-111608019 TAGCGGCGATGCCAGCATCTGGG + Intergenic
1020205873 7:6115324-6115346 GAGGAGCGATGCCATCACCTAGG - Exonic
1020292045 7:6729883-6729905 GAGCGCCTAGGCCAGCACCTAGG + Intergenic
1022782683 7:33602138-33602160 GAGTGGTGCTGCCTGCACCTGGG + Intronic
1031008356 7:116499489-116499511 GGGCGGCGACGCCGGCAGCTGGG - Exonic
1032388145 7:131538643-131538665 GAGTGGCGACGCAGGAATCTTGG - Intronic
1033511118 7:142061117-142061139 GACAGGCAAAGCCAGCACCTTGG + Intronic
1034536345 7:151728095-151728117 GAGGGGAGACGCCACCTCCTGGG + Intronic
1035434639 7:158850192-158850214 GAGTGGCCACAGCTGCACCTGGG + Intergenic
1042989792 8:74626314-74626336 TAGTGGCCAAGCCAGGACCTAGG - Intronic
1045011678 8:97964140-97964162 GAGTGGCAGGGCCAGCTCCTGGG + Intronic
1048241073 8:132741973-132741995 TAGTGGTGACGCCAGCGTCTGGG - Intronic
1049181747 8:141226495-141226517 GAGGGGACAGGCCAGCACCTGGG - Intronic
1049857163 8:144869867-144869889 TAGTGGTAACGCCAGCATCTGGG + Intergenic
1057697944 9:97340688-97340710 TAGCGGTGACGCCAGCATCTGGG + Intronic
1061039247 9:128130135-128130157 TAGCGGTGACGCCAGCATCTGGG - Intergenic
1062484237 9:136766619-136766641 TAGTGGTGACGCCAGCGTCTGGG + Intergenic
1062588510 9:137262350-137262372 TAGCGGTGACGCCAGCATCTGGG - Intronic
1062645461 9:137545820-137545842 TAGTGGTGACGCCAGCGTCTGGG + Intronic
1062647938 9:137559300-137559322 TAGCGGTGACGCCAGCATCTGGG + Intronic
1195418032 X:104641613-104641635 GAGTGGGGACTCCTGCATCTGGG - Intronic
1197759008 X:130014857-130014879 GAATGGGGACCCGAGCACCTGGG + Exonic
1198788297 X:140314484-140314506 GAGTGGACACGCCACCACCGTGG - Intergenic