ID: 1006320218

View in Genome Browser
Species Human (GRCh38)
Location 6:33315574-33315596
Sequence TGGTTCCCTGGTGGTTGGCC AGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 211
Summary {0: 1, 1: 0, 2: 0, 3: 14, 4: 196}

Found 13 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1006320199_1006320218 28 Left 1006320199 6:33315523-33315545 CCCAGGCTCCCCACCGACGTGCC 0: 1
1: 0
2: 0
3: 12
4: 111
Right 1006320218 6:33315574-33315596 TGGTTCCCTGGTGGTTGGCCAGG 0: 1
1: 0
2: 0
3: 14
4: 196
1006320204_1006320218 18 Left 1006320204 6:33315533-33315555 CCACCGACGTGCCCCCCACGGTC 0: 1
1: 0
2: 0
3: 3
4: 87
Right 1006320218 6:33315574-33315596 TGGTTCCCTGGTGGTTGGCCAGG 0: 1
1: 0
2: 0
3: 14
4: 196
1006320213_1006320218 -10 Left 1006320213 6:33315561-33315583 CCCGTGTTCTGCTTGGTTCCCTG 0: 1
1: 0
2: 0
3: 15
4: 228
Right 1006320218 6:33315574-33315596 TGGTTCCCTGGTGGTTGGCCAGG 0: 1
1: 0
2: 0
3: 14
4: 196
1006320212_1006320218 -9 Left 1006320212 6:33315560-33315582 CCCCGTGTTCTGCTTGGTTCCCT 0: 1
1: 0
2: 0
3: 12
4: 170
Right 1006320218 6:33315574-33315596 TGGTTCCCTGGTGGTTGGCCAGG 0: 1
1: 0
2: 0
3: 14
4: 196
1006320209_1006320218 4 Left 1006320209 6:33315547-33315569 CCCACGGTCACTGCCCCGTGTTC 0: 1
1: 0
2: 1
3: 7
4: 85
Right 1006320218 6:33315574-33315596 TGGTTCCCTGGTGGTTGGCCAGG 0: 1
1: 0
2: 0
3: 14
4: 196
1006320210_1006320218 3 Left 1006320210 6:33315548-33315570 CCACGGTCACTGCCCCGTGTTCT 0: 1
1: 0
2: 0
3: 15
4: 95
Right 1006320218 6:33315574-33315596 TGGTTCCCTGGTGGTTGGCCAGG 0: 1
1: 0
2: 0
3: 14
4: 196
1006320207_1006320218 6 Left 1006320207 6:33315545-33315567 CCCCCACGGTCACTGCCCCGTGT 0: 1
1: 0
2: 0
3: 9
4: 120
Right 1006320218 6:33315574-33315596 TGGTTCCCTGGTGGTTGGCCAGG 0: 1
1: 0
2: 0
3: 14
4: 196
1006320205_1006320218 15 Left 1006320205 6:33315536-33315558 CCGACGTGCCCCCCACGGTCACT 0: 1
1: 0
2: 0
3: 17
4: 85
Right 1006320218 6:33315574-33315596 TGGTTCCCTGGTGGTTGGCCAGG 0: 1
1: 0
2: 0
3: 14
4: 196
1006320208_1006320218 5 Left 1006320208 6:33315546-33315568 CCCCACGGTCACTGCCCCGTGTT 0: 1
1: 0
2: 0
3: 8
4: 87
Right 1006320218 6:33315574-33315596 TGGTTCCCTGGTGGTTGGCCAGG 0: 1
1: 0
2: 0
3: 14
4: 196
1006320206_1006320218 7 Left 1006320206 6:33315544-33315566 CCCCCCACGGTCACTGCCCCGTG 0: 1
1: 0
2: 1
3: 9
4: 127
Right 1006320218 6:33315574-33315596 TGGTTCCCTGGTGGTTGGCCAGG 0: 1
1: 0
2: 0
3: 14
4: 196
1006320200_1006320218 27 Left 1006320200 6:33315524-33315546 CCAGGCTCCCCACCGACGTGCCC 0: 1
1: 0
2: 0
3: 22
4: 190
Right 1006320218 6:33315574-33315596 TGGTTCCCTGGTGGTTGGCCAGG 0: 1
1: 0
2: 0
3: 14
4: 196
1006320203_1006320218 19 Left 1006320203 6:33315532-33315554 CCCACCGACGTGCCCCCCACGGT 0: 1
1: 0
2: 0
3: 3
4: 31
Right 1006320218 6:33315574-33315596 TGGTTCCCTGGTGGTTGGCCAGG 0: 1
1: 0
2: 0
3: 14
4: 196
1006320201_1006320218 20 Left 1006320201 6:33315531-33315553 CCCCACCGACGTGCCCCCCACGG 0: 1
1: 0
2: 0
3: 8
4: 75
Right 1006320218 6:33315574-33315596 TGGTTCCCTGGTGGTTGGCCAGG 0: 1
1: 0
2: 0
3: 14
4: 196

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1006320218 Original CRISPR TGGTTCCCTGGTGGTTGGCC AGG Exonic