ID: 1006322627

View in Genome Browser
Species Human (GRCh38)
Location 6:33329181-33329203
Sequence GTCGCACGGGACCCCTGGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 105
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 97}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1006322620_1006322627 -8 Left 1006322620 6:33329166-33329188 CCTTGTCCAAGGCACGTCGCACG 0: 1
1: 0
2: 0
3: 1
4: 26
Right 1006322627 6:33329181-33329203 GTCGCACGGGACCCCTGGGAGGG 0: 1
1: 0
2: 0
3: 7
4: 97
1006322618_1006322627 10 Left 1006322618 6:33329148-33329170 CCAGGAAGATAAAGAAAGCCTTG 0: 1
1: 0
2: 5
3: 20
4: 284
Right 1006322627 6:33329181-33329203 GTCGCACGGGACCCCTGGGAGGG 0: 1
1: 0
2: 0
3: 7
4: 97

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1006322627 Original CRISPR GTCGCACGGGACCCCTGGGA GGG Intronic
900387210 1:2416173-2416195 GTCGCTCAGGACCCCGAGGAGGG + Intergenic
909597490 1:77422669-77422691 GTATCACGGGCCCCCTGAGAAGG - Intronic
916651675 1:166839641-166839663 GCCGCCCGGGACCCGGGGGAGGG - Intronic
916960320 1:169882394-169882416 GTCGCACAGGAGCCCAGGGAGGG - Intronic
923684047 1:236142168-236142190 GTAGCGCGCGGCCCCTGGGATGG + Intergenic
1065963799 10:30754698-30754720 GGCTCACGGGATCCCGGGGAGGG - Intergenic
1067076039 10:43183112-43183134 GTAGCACGAGACACCTGGCATGG - Intronic
1072455069 10:95568346-95568368 GTCACAGGGGTGCCCTGGGAAGG + Intergenic
1074782173 10:116809930-116809952 GTCGCACAGGATCCCTGGGGAGG + Intergenic
1076783137 10:132735463-132735485 GTGGCACGGGCGCCCTGGGGCGG + Intronic
1076859271 10:133132890-133132912 GGAGCACTGGGCCCCTGGGAGGG + Intergenic
1076916397 10:133424753-133424775 GTCGCGGGGGACCGCGGGGACGG - Intergenic
1076936504 10:133569548-133569570 GTCGCGGGGGACCGCGGGGACGG - Intronic
1077394843 11:2315750-2315772 GTGGCACTGGAAGCCTGGGATGG + Intronic
1084791978 11:71480884-71480906 GTGGCCCCTGACCCCTGGGAGGG + Intronic
1084903476 11:72327873-72327895 GTCACAAGGGCCCCCGGGGATGG + Intronic
1085245639 11:75098491-75098513 GCCGCACAGGAGCCCAGGGAGGG - Intergenic
1085311790 11:75521140-75521162 GACACACGGGACCCCAGAGAGGG + Intronic
1089800282 11:121021944-121021966 GTCGCACGGGAGCCCATGGAGGG - Intergenic
1092582718 12:9863108-9863130 GTTGCACAGGTCCCCTGGGCTGG + Intronic
1096470689 12:51873757-51873779 GTCACACAGGACCCCTAGAAAGG + Intergenic
1097182014 12:57177223-57177245 ATCGCACTGGATCCCCGGGATGG + Exonic
1104912484 12:132245908-132245930 GGAGGACGGGACCCCTGGGGTGG - Intronic
1108996038 13:56735847-56735869 GCCGCACAGGAGCCCAGGGAGGG - Intergenic
1114474141 14:22982167-22982189 GTCTGACGGGACCCCCGGGCCGG - Exonic
1119290505 14:73491494-73491516 GTCGTCCGGGGCCCCTGCGACGG + Exonic
1122900169 14:104779126-104779148 GTCAGACGGGAACCCTGGCATGG - Intronic
1123020539 14:105395905-105395927 GTCGATCAGGACCCCTGGGAGGG - Exonic
1131038889 15:89244079-89244101 GTGGGACTGGGCCCCTGGGAGGG + Intronic
1132675167 16:1118401-1118423 GTCCCAGGGGAGGCCTGGGAAGG + Intergenic
1139216474 16:65130129-65130151 GAAGCATGGGACACCTGGGAGGG + Intergenic
1141552713 16:84816858-84816880 GTCCCAAGTGCCCCCTGGGAAGG - Intergenic
1143664237 17:8347195-8347217 GTCGCACAGGAGCCCACGGAGGG + Intergenic
1144668852 17:17120120-17120142 GTCGCACGTGAGACCTGGGTGGG - Intronic
1144850021 17:18239319-18239341 GTGGCCTGGGAGCCCTGGGAAGG + Intronic
1145790750 17:27625130-27625152 GACACACGTGATCCCTGGGAAGG - Exonic
1146797850 17:35795444-35795466 CGCGCCCGGGACCCCGGGGATGG + Exonic
1148085030 17:44988648-44988670 GCCCCACAGAACCCCTGGGAAGG + Intergenic
1148437289 17:47694300-47694322 GCCGCACGGGATGGCTGGGAGGG + Intronic
1150480224 17:65503653-65503675 GTCGCCCGGGCCCTCTGGGTGGG - Intergenic
1151499896 17:74481877-74481899 GTGCCAGGGCACCCCTGGGAGGG + Intronic
1151800169 17:76374540-76374562 GCAGCACGGCACCCCAGGGAGGG - Intronic
1151980611 17:77506371-77506393 GATGCAAGGGGCCCCTGGGATGG + Intergenic
1152641499 17:81451292-81451314 TTCGAACGGCAGCCCTGGGAAGG - Intronic
1155055349 18:22177216-22177238 GCCGCACCTGTCCCCTGGGAGGG - Intronic
1156633436 18:38996878-38996900 ATCTCACTGGACCCTTGGGAAGG - Intergenic
1160134751 18:76262663-76262685 CTCGCAGGGCAGCCCTGGGAGGG + Intergenic
1160824012 19:1071146-1071168 GGCGAACGGGACCCCAGGGCGGG + Intronic
1161811720 19:6475347-6475369 GTCGCCCTGGCCCCCGGGGAAGG - Exonic
1162043787 19:7985667-7985689 GGCAAACGGGGCCCCTGGGATGG + Intronic
1162664159 19:12195428-12195450 ATTGCACGGGAGCCCCGGGAGGG + Intergenic
1163587731 19:18173204-18173226 GTCCCACGGGACCACGGTGAGGG + Intronic
1166942747 19:46376597-46376619 GGCACCCGGGAACCCTGGGATGG + Intronic
1166965177 19:46525618-46525640 GGCACCCGGGAACCCTGGGATGG - Intronic
1167323957 19:48812820-48812842 GTCGCCAGGGGCTCCTGGGAAGG - Intergenic
927904565 2:26847768-26847790 GAGGCACGGGTCCCCAGGGAGGG - Intronic
933754058 2:85623827-85623849 GTCCCCTGGGAGCCCTGGGATGG - Intronic
936507177 2:113116999-113117021 GTGGCAAGAGACCCCTGGGCAGG - Intronic
936935663 2:117836432-117836454 GTCTCCCGGCAGCCCTGGGAAGG + Intergenic
936935677 2:117836480-117836502 GTCTCCCGGCAGCCCTGGGAAGG + Intergenic
937378355 2:121353384-121353406 TTGGCACTGGACCCCAGGGAAGG - Intronic
938369940 2:130762626-130762648 GTCTGACGGGTCCCCTGGGGAGG - Exonic
948201298 2:236131236-236131258 GTCGCACGGGTCCCGGGGGCAGG + Exonic
948992619 2:241562494-241562516 GTCCCATGGGACCTCAGGGAGGG + Intronic
949018767 2:241728685-241728707 GCTGGACGGGACCCCTGGGCGGG + Exonic
1169849226 20:10031964-10031986 GGCGCACGGGAGCCCATGGAGGG - Intronic
1171936180 20:31277482-31277504 GTCACATGGGTCCACTGGGATGG + Intergenic
1173188916 20:40861608-40861630 GTCCCACGTGAACCCTGGGAAGG + Intergenic
1174170851 20:48617456-48617478 GTCCCACGATAACCCTGGGAGGG + Intergenic
1175200438 20:57273225-57273247 GGCTCACAGAACCCCTGGGAAGG - Intergenic
1175592964 20:60207849-60207871 GTGGGACGGCACCCCTGAGAGGG + Intergenic
1175636187 20:60586443-60586465 GTCCCCAGGGACCCCTGGGGAGG - Intergenic
1176072835 20:63235838-63235860 GTGTCACGGGGCCCCTGGCAGGG - Intergenic
1176187016 20:63786074-63786096 GTGGCCTGGGACCACTGGGAGGG + Intronic
1178941992 21:36914142-36914164 GGAGCACGGGAGCCCAGGGATGG + Intronic
1182634348 22:31712513-31712535 GTCCCACGGTTGCCCTGGGATGG - Exonic
1183591581 22:38782194-38782216 GAGGCACGGGAAGCCTGGGATGG - Intronic
1184890340 22:47375299-47375321 CTGGCAGGGAACCCCTGGGAGGG + Intergenic
950475157 3:13210315-13210337 GCCGAACTGGAGCCCTGGGAGGG - Intergenic
954135415 3:48580034-48580056 GTCCCCCAGGACCCCCGGGACGG - Exonic
957277505 3:78108673-78108695 GCCGCACAGGAACCCTCGGAGGG - Intergenic
961788306 3:129360542-129360564 GCCGAACTGGAGCCCTGGGAGGG + Intergenic
988974641 5:36502836-36502858 GTATCACGGGACTCCTGGAAGGG + Intergenic
989425733 5:41293453-41293475 GTCCCATGGGGCCCTTGGGATGG - Intergenic
1001383061 5:171316470-171316492 GTCCCACCGGGCCCCTGGGCAGG + Intergenic
1001766453 5:174251475-174251497 GTCACACAGGCCCCCAGGGAAGG + Intergenic
1006322627 6:33329181-33329203 GTCGCACGGGACCCCTGGGAGGG + Intronic
1006680741 6:35795401-35795423 GGCCCACGGCACCCCTGGGGAGG - Intronic
1009685381 6:66949501-66949523 GCCGCACAGGAGCCCTCGGAGGG - Intergenic
1018064195 6:160114576-160114598 GCCGCACAGGAGCCCAGGGAGGG + Intergenic
1021969327 7:25951302-25951324 GGCGCACGTGACCCCGGGGGAGG - Intergenic
1027228804 7:76260689-76260711 TGGGCACGGGACCCCTGGGAGGG - Intronic
1034632105 7:152538962-152538984 GCCGCACGGGAGCCCATGGAGGG + Intergenic
1034957677 7:155344787-155344809 GGCGCAGGGGAGCCCCGGGAGGG - Intergenic
1034976645 7:155453182-155453204 GTCTCCCGGGAGCCCTGGGAGGG - Intergenic
1038427923 8:27476936-27476958 GCCTCACGTGACCCCTAGGAGGG + Intronic
1040391736 8:46955811-46955833 GTCTCAGGGGACACCTGTGACGG - Intergenic
1042092424 8:65173145-65173167 GTGACACTGAACCCCTGGGATGG + Intergenic
1045431808 8:102122104-102122126 GTAGCATGGCACCTCTGGGAGGG + Intronic
1049192226 8:141294771-141294793 TTGGTGCGGGACCCCTGGGAGGG + Intronic
1049621110 8:143598672-143598694 GGCGCAGGGGACCCCGGGGCGGG + Exonic
1060404431 9:123366217-123366239 GTCGCACCGGAACCTGGGGAGGG - Exonic
1061722950 9:132564929-132564951 GACTCACGGGAGACCTGGGAGGG + Intronic
1195752418 X:108172050-108172072 CTCGCAAGAGACCCTTGGGATGG + Intronic
1202137060 Y:21676739-21676761 GCCGCACAGGAGCCCAGGGAGGG + Intergenic