ID: 1006331055

View in Genome Browser
Species Human (GRCh38)
Location 6:33391484-33391506
Sequence GGCGGCCGGAGGAGAAGGGG CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 848
Summary {0: 1, 1: 0, 2: 6, 3: 95, 4: 746}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1006331055_1006331061 -8 Left 1006331055 6:33391484-33391506 CCGCCCCTTCTCCTCCGGCCGCC 0: 1
1: 0
2: 6
3: 95
4: 746
Right 1006331061 6:33391499-33391521 CGGCCGCCACCAGTTTCGCTTGG 0: 1
1: 0
2: 0
3: 1
4: 29
1006331055_1006331065 10 Left 1006331055 6:33391484-33391506 CCGCCCCTTCTCCTCCGGCCGCC 0: 1
1: 0
2: 6
3: 95
4: 746
Right 1006331065 6:33391517-33391539 CTTGGCCAGTTGCGTTCGTGCGG 0: 1
1: 0
2: 0
3: 1
4: 42

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1006331055 Original CRISPR GGCGGCCGGAGGAGAAGGGG CGG (reversed) Intergenic