ID: 1006332855

View in Genome Browser
Species Human (GRCh38)
Location 6:33404835-33404857
Sequence TGTTCTCTTCTGGGCAGAGG AGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 1083
Summary {0: 1, 1: 0, 2: 19, 3: 318, 4: 745}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1006332848_1006332855 26 Left 1006332848 6:33404786-33404808 CCACAGTTTGTTCTTCTTCTTGG 0: 1
1: 0
2: 2
3: 52
4: 455
Right 1006332855 6:33404835-33404857 TGTTCTCTTCTGGGCAGAGGAGG 0: 1
1: 0
2: 19
3: 318
4: 745
1006332847_1006332855 27 Left 1006332847 6:33404785-33404807 CCCACAGTTTGTTCTTCTTCTTG 0: 1
1: 0
2: 4
3: 47
4: 544
Right 1006332855 6:33404835-33404857 TGTTCTCTTCTGGGCAGAGGAGG 0: 1
1: 0
2: 19
3: 318
4: 745
1006332850_1006332855 -7 Left 1006332850 6:33404819-33404841 CCCTCTGTGTATGTTGTGTTCTC 0: 1
1: 0
2: 4
3: 18
4: 270
Right 1006332855 6:33404835-33404857 TGTTCTCTTCTGGGCAGAGGAGG 0: 1
1: 0
2: 19
3: 318
4: 745
1006332846_1006332855 28 Left 1006332846 6:33404784-33404806 CCCCACAGTTTGTTCTTCTTCTT 0: 1
1: 0
2: 7
3: 98
4: 985
Right 1006332855 6:33404835-33404857 TGTTCTCTTCTGGGCAGAGGAGG 0: 1
1: 0
2: 19
3: 318
4: 745
1006332851_1006332855 -8 Left 1006332851 6:33404820-33404842 CCTCTGTGTATGTTGTGTTCTCT 0: 1
1: 0
2: 2
3: 35
4: 392
Right 1006332855 6:33404835-33404857 TGTTCTCTTCTGGGCAGAGGAGG 0: 1
1: 0
2: 19
3: 318
4: 745

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1006332855 Original CRISPR TGTTCTCTTCTGGGCAGAGG AGG Exonic
900072831 1:787520-787542 TGTTCTCTGGTGGGCAGGGACGG - Intergenic
900486845 1:2926714-2926736 TGTGCTGTTCTGGGCTGAGCTGG + Intergenic
900521356 1:3106873-3106895 TGTTCTCTAGTGGGCAGGTGTGG + Intronic
901815448 1:11791032-11791054 TGTTTATTTCTGGGCAGGGGTGG - Intronic
901947273 1:12713939-12713961 TTTTCTCTTACGGGCAGGGGCGG - Intergenic
902007311 1:13242677-13242699 TGTTCTCTGGTGGGCAGGGGTGG + Intergenic
902822944 1:18954643-18954665 TCTTCTCTTATGGGAAGAGGAGG + Intronic
903052560 1:20612507-20612529 TGTTTTCTTGTGGGCAGGGGCGG - Intronic
905332286 1:37213563-37213585 TGTTCTCTGGTGGGCAGGGGCGG + Intergenic
905499439 1:38425326-38425348 TGTTCTCTGGTGGGCAGAGTGGG - Intergenic
905500233 1:38430581-38430603 TGTTCTCTGGTGGGCAGAGTGGG - Intergenic
905920742 1:41717022-41717044 TCTTCTCTTTTGGGGAGAGCTGG + Intronic
906035559 1:42748369-42748391 AGCTCTCTTCTTGGCAGGGGAGG + Intronic
906744061 1:48209178-48209200 TGTTCTCTTGCGGGCAGAGTGGG + Intergenic
907159905 1:52362231-52362253 TGTTCTCATCTGGGCTGTGGAGG + Intronic
907293692 1:53434980-53435002 TGTTCTCTTGCGGGCAGGGGCGG - Intergenic
907295477 1:53449627-53449649 TGTTCTCTGGCGGGCAGAGTGGG - Intergenic
907373915 1:54020284-54020306 TGTTCTCTGGCGGGCAGAGTGGG + Intergenic
908378589 1:63572875-63572897 TGTTCTCTGGCGGGCAGGGGCGG + Intronic
908461239 1:64350119-64350141 TGTTCTCTGGCGGGCAGGGGCGG + Intergenic
908591652 1:65643382-65643404 TGTTCTCTGGTGGGCAGGGGCGG + Intergenic
908592396 1:65647778-65647800 TGTTCTCTGGTGGGCAGGGGCGG + Intergenic
908851993 1:68386238-68386260 TGTTCTCTGGTGGGCAGGGGCGG - Intergenic
908852873 1:68391797-68391819 TGTTCTCTGGTGGGCAGGGGCGG - Intergenic
909035134 1:70588597-70588619 TGTTCTCTGGCGGGCAGAGTGGG - Intergenic
909035923 1:70593795-70593817 TGTTCTCTGGAGGGCAGAGTGGG - Intergenic
909300138 1:74002550-74002572 TGTTCTCTGGCGGGCAGGGGCGG + Intergenic
909777009 1:79493889-79493911 TGTTCTCTGGCGGGCAGAGTGGG + Intergenic
909787813 1:79638935-79638957 TGTTCTCTTGTGGGCAGGAGTGG + Intergenic
909788602 1:79644256-79644278 TGTTCTCTGGTGGGCAGGAGTGG + Intergenic
909792512 1:79696519-79696541 TGTTCTCTGGTGGGCAGGGTTGG + Intergenic
909793324 1:79701807-79701829 TGTTCTCTGGTGGGCAGGGGCGG + Intergenic
909977976 1:82067698-82067720 TGTTCTCTGGTGGGCAGGGGTGG + Intergenic
910002233 1:82354740-82354762 TGTTCTTTGGCGGGCAGAGGTGG + Intergenic
910516760 1:88070062-88070084 GGATGTCTTCTGGGCAGTGGCGG + Intergenic
910614401 1:89181282-89181304 TGTTCTCTGGCGGGCAGAGGTGG + Exonic
910946551 1:92598126-92598148 TATTCTCTTTTGGGCAGTGGTGG - Intronic
911148363 1:94572558-94572580 TGTTCTCTGGTGGGCAGGGATGG + Intergenic
911158332 1:94657668-94657690 TGTTCTCTGGTGGGCAGGGGCGG + Intergenic
911570039 1:99509765-99509787 TGTTCTCTGGTGGGCAGGAGTGG - Intergenic
911570853 1:99515172-99515194 TGTTCTCTGGTGGGCAGGAGTGG - Intergenic
911760062 1:101603260-101603282 TGTTCTCTGGTGGGCAGGGGCGG + Intergenic
912813274 1:112809882-112809904 TGTTCTCTGGTGGGCAGGGGCGG - Intergenic
912815622 1:112825836-112825858 TGTTCTCTGGTAGGCAGGGGCGG + Intergenic
912939465 1:114032285-114032307 TGTCCTCTGGTGGGCAGGGGTGG - Intergenic
913039832 1:115011503-115011525 TTTTCTCTTGTGGACAGGGGTGG + Intergenic
914455672 1:147834097-147834119 TGTTCTCTGGCGGGCAGAGTGGG - Intergenic
916248073 1:162708278-162708300 TGATCTCTTCTGGGTTCAGGAGG + Intronic
916941498 1:169683282-169683304 TTTTCACTTGTGGGCAGGGGTGG - Intronic
917092934 1:171372190-171372212 TTATCTCTTGTGGGCAGGGGCGG - Intergenic
917242780 1:172966962-172966984 TGTTTTCCACTGGTCAGAGGTGG - Intergenic
917256821 1:173124659-173124681 TTTTCTCTTGCGGGCAGGGGTGG - Intergenic
917863952 1:179175405-179175427 TTTTCTGTTCTGGGCAGGGCAGG - Intronic
918042390 1:180921198-180921220 TTTTCTCTTACGGGCAGGGGCGG + Intronic
918222273 1:182445641-182445663 TGTTCTCTGGCGGGCAGGGGTGG + Intergenic
918347585 1:183619174-183619196 TGTTCTCTGGTGGGCAGGGGCGG - Intergenic
918567195 1:185948455-185948477 TGTTCTCTGGTGGGCAGGAGTGG + Intronic
918568060 1:185953940-185953962 TGTTCTCTGGTGGGCAGGAGTGG + Intronic
918645759 1:186902717-186902739 TGTTCTCTTGTGGGCAGGGGCGG - Intronic
919147939 1:193658519-193658541 TTTTTTCTCCTTGGCAGAGGTGG - Intergenic
919306623 1:195848311-195848333 TGTTCTCTGGAGGGCAGGGGCGG + Intergenic
919458788 1:197851572-197851594 TGTTCTCTGGTGGGCAGGGGTGG + Intergenic
919476024 1:198034862-198034884 TGTTCTCTGGAGGGCAGAGTGGG - Intergenic
919476919 1:198040795-198040817 TGTTCTCTGGTGGGCAGAGTGGG - Intergenic
919825543 1:201500653-201500675 GGTCCTCTTGTGGGCAGAGGGGG - Intronic
919827765 1:201515888-201515910 TGTTCATTCCTGGGCATAGGTGG - Intergenic
920026889 1:203005616-203005638 TGTTCTCTGGTGGGCAGGAGTGG + Intergenic
920096696 1:203491193-203491215 TGTTCTCTGGTGGCCAGGGGTGG - Exonic
920297619 1:204968646-204968668 TGATCTTTCCTGTGCAGAGGAGG - Intronic
920629046 1:207633925-207633947 TGTTCTCTGGCGGGCAGAAGTGG + Intronic
920756342 1:208737631-208737653 TGTTATATTCAGGGCAGAGCAGG - Intergenic
920901090 1:210111265-210111287 TGTTCTCTGGTGGGCAGGGGTGG + Intronic
920901802 1:210116017-210116039 TGTTCTCTGGTGAGCAGGGGCGG + Intronic
921211953 1:212908487-212908509 TGTTCTCTGGCGGGCAGAGTGGG + Intergenic
921914982 1:220597380-220597402 TGCTATTTTCTGGGCAGAGTTGG + Intronic
922048070 1:221966156-221966178 TGTTCTCTGGTGGGCAGGGGCGG - Intergenic
922048863 1:221971435-221971457 TGTTCTCTGGTGGGCAGGGGCGG - Intergenic
922049068 1:221973254-221973276 TGTTCTCTGGTGGGCAGGAGTGG + Intergenic
922049904 1:221978685-221978707 TGTTCTCTGGTGGGCAGGAGTGG + Intergenic
922154411 1:223029878-223029900 TGTTCTCTGGTGGGCAGGAGTGG + Intergenic
922268418 1:224010451-224010473 TGTTCTCTGGTGGGCAGGGACGG - Intergenic
922821325 1:228487596-228487618 GGTGCGCTTCTGGGCCGAGGAGG + Exonic
922877532 1:228951690-228951712 TGTTCTCTGGTGGGCAGGGGTGG - Intergenic
923047402 1:230365602-230365624 AGTGCTCTGCTAGGCAGAGGTGG + Intronic
923074871 1:230601450-230601472 TGTTCTCTGGTGGGCAGGGGCGG - Intergenic
923075968 1:230608895-230608917 TGTTCTCTGGTGGGCAGGGGCGG - Intergenic
923256865 1:232229804-232229826 TGTTCTCTGGTGGGCAGGGGCGG + Intergenic
923408162 1:233683624-233683646 TGTTCTCTGGTGGGCAGGGGCGG + Intergenic
923408988 1:233688948-233688970 TGTTCTCTGGTGGGCAGGGGCGG + Intergenic
923829707 1:237541751-237541773 TGTTCTCTGGTGGGCAGGAGTGG + Intronic
923905519 1:238379615-238379637 TGTTCTCTGGTGGGCAGGAGTGG + Intergenic
924237295 1:242009889-242009911 TGTTCTCTTCTGGGTCCTGGGGG + Intergenic
924727626 1:246684917-246684939 TGTTCTCTTGCGGGCAGGGGCGG - Intergenic
924895665 1:248335936-248335958 TGTTCTCTGGCAGGCAGAGGGGG + Intergenic
924896359 1:248340872-248340894 TGTTCTCTGGCGGGCAGAGTGGG + Intergenic
1062931269 10:1354383-1354405 TGTTCTCTGGTGGGCAGGGGTGG - Intronic
1063414741 10:5864285-5864307 TGTTTCCTTCTGGGCAGGGGAGG - Intronic
1065498299 10:26352664-26352686 TTTTCTCTTGTGGGCAGGGGCGG - Intergenic
1067304274 10:45045638-45045660 TGTTCTCTGGTGGGCAGGAGTGG + Intergenic
1068360509 10:55971703-55971725 TGTTCTCTGGCGGGCAGTGGTGG - Intergenic
1068522628 10:58094256-58094278 TGTTCTCTGGTGGGCAGGGCGGG + Intergenic
1068687834 10:59887824-59887846 TGTTAGCTCCTTGGCAGAGGAGG - Intronic
1069115976 10:64507013-64507035 TGTTCTCTGGTGGGCAGGGGTGG - Intergenic
1070474489 10:76818462-76818484 TGTTCTCTGGTGGGCAGGGGTGG - Intergenic
1070475306 10:76823537-76823559 TGTTCTCTGGTGGGCAGGGGTGG - Intergenic
1070595350 10:77829201-77829223 TGTGCTTTTCTGGCAAGAGGTGG - Intronic
1070671663 10:78381608-78381630 TGTTCTCTGCTGGCGACAGGAGG - Intergenic
1071178968 10:82960808-82960830 TGTTCTCTGGTGGGCAGGGGTGG - Intronic
1071187781 10:83063167-83063189 TGTTCTCTTGCGGACAGGGGTGG - Intergenic
1071291532 10:84192888-84192910 TTTTCTCTGCTTTGCAGAGGAGG - Intergenic
1071590201 10:86865403-86865425 TGTTCTCTGGCGGGCAGAGTGGG - Intronic
1071789828 10:88941964-88941986 TGACCTGTTCTGGGCAGAGGAGG + Intronic
1071822274 10:89290701-89290723 TGTTCTCTGGCTGGCAGAGGTGG - Intronic
1071826370 10:89329945-89329967 TGTTCTCTGGTGGGCAGGTGTGG + Intronic
1071915866 10:90295217-90295239 TGTTCTCTGGTGGGCAGGGGCGG - Intergenic
1071916675 10:90300529-90300551 TGTTCTCTGGTGGGCAGGGGTGG - Intergenic
1071924029 10:90384765-90384787 TGTTCTCTGGTGGGCAGGTGTGG - Intergenic
1072011644 10:91307094-91307116 TGTTCTCTGGTGGGCAGGAGTGG + Intergenic
1072580075 10:96733239-96733261 TGTTCTCTGGGGGGCAGGGGCGG - Intergenic
1072580566 10:96736419-96736441 TGTTCTCTGGGGGGCAGGGGCGG - Intergenic
1072626936 10:97118597-97118619 TGTGTTCTCCTGGGCAGAAGAGG - Intronic
1072657331 10:97339157-97339179 CGTTCTCTGGTGGGCAGGGGTGG - Intergenic
1072849420 10:98872005-98872027 GTTTCTCTTCTGGATAGAGGTGG - Intronic
1073242843 10:102069408-102069430 CCTTCTCTCCTGGGCACAGGAGG - Intergenic
1073394297 10:103205676-103205698 TTTTCTCTTGTGGGCAGGGGCGG - Intergenic
1073395436 10:103213466-103213488 TTTTCTCTTGTGGGCAGGGGCGG - Intergenic
1073708900 10:106016915-106016937 TGTTCTCTGGTGGGCAGGAGTGG + Intergenic
1073709760 10:106022823-106022845 TGTTCTCTGGTGGGCAGGTGTGG + Intergenic
1073844498 10:107538443-107538465 TGTCCTCTTCTGGGAAATGGAGG - Intergenic
1074019538 10:109568090-109568112 TGTTCTCTGGTGGGCAGGAGTGG - Intergenic
1074445736 10:113519821-113519843 TGGTCCCTTCTGTGAAGAGGTGG + Intergenic
1074741257 10:116486322-116486344 TGTTCTCTGACGGGCAGAGTGGG - Intergenic
1075248386 10:120845204-120845226 TGTTCTCTGGTGGGTAGGGGTGG - Intergenic
1075249162 10:120850366-120850388 TGTTCTCTGGTGGGCAGGGGTGG - Intergenic
1075464230 10:122639480-122639502 TGTTCTCTGGCGGGCAGGGGCGG + Intronic
1075727413 10:124617626-124617648 TGTTCACCTCAGGGCAGAGGTGG + Exonic
1075754520 10:124800618-124800640 TGTTCTCTGGTGGGAAGGGGCGG - Intergenic
1076164654 10:128271988-128272010 AGTGCTCCTCTGGGCAGATGGGG - Intergenic
1076380492 10:130021832-130021854 CGTTCTCCTCTGGGGAGGGGAGG - Intergenic
1076624306 10:131812101-131812123 TTTGCCCTTGTGGGCAGAGGGGG + Intergenic
1076832652 10:133004416-133004438 TGTTCTCTGGTGGGCAGGGGTGG - Intergenic
1077002940 11:333941-333963 TGTTCTCTGGCGGGCAGGGGTGG + Intergenic
1077078692 11:713023-713045 TGTTGGCCTCTGGGCAGACGAGG - Intronic
1077397316 11:2331420-2331442 TTTTCTTTTGTGGGCAGGGGCGG + Intergenic
1077678599 11:4219463-4219485 TGTTCTCTGGTGGGCAGGAGTGG + Intergenic
1077679449 11:4225037-4225059 TGTTCTCTGGTGGGCAGGAGTGG + Intergenic
1077688003 11:4315866-4315888 TGTTCTCTGGTGGGCAGGAGTGG + Intergenic
1077688867 11:4321621-4321643 TGTTCTCTGGTGGGCAGGAGTGG + Intergenic
1077836699 11:5932731-5932753 GGTCCTTTTCTGGGCAGGGGAGG - Intronic
1077850336 11:6069998-6070020 TGTTCTCTGGTGGGCAGGAGTGG + Intergenic
1077851187 11:6075610-6075632 TGTTCTCTGGTGGGCAGGAGTGG + Intergenic
1077883051 11:6366241-6366263 TGTTCTCTGGCGGGCAGGGGTGG - Intergenic
1077883857 11:6371463-6371485 TGTTCTCTGGTGGGCAGGGGTGG - Intergenic
1078019906 11:7648398-7648420 TGTGCTCCACTGGGCAAAGGGGG - Exonic
1078046470 11:7917643-7917665 TGTTCTCTGGTGGGCAGGAGTGG + Intergenic
1078529177 11:12123350-12123372 TGTTCTCTTCTAGTCAGGTGGGG + Intronic
1079252616 11:18798065-18798087 CGTTCTCTTCTAGGCACAGCAGG + Intergenic
1079308805 11:19346614-19346636 TCTTTTCTTCAGGGAAGAGGCGG + Intergenic
1079725851 11:23879894-23879916 TGTTCTCTGGTGGGCAGGGGCGG + Intergenic
1079726627 11:23887426-23887448 TGTTCTCTGGTGGGCAGGAGTGG + Intergenic
1080227014 11:29973344-29973366 TGTTCTCTGGTGGGCAGGGGTGG + Intergenic
1080994617 11:37583236-37583258 TGTTTTCTGGTGGGCAGGGGCGG + Intergenic
1081357157 11:42125153-42125175 TGTTCTCTGGTGGGCAGGGGAGG - Intergenic
1082197179 11:49320759-49320781 TGTTCTCTGGTGGACAGGGGTGG + Intergenic
1082201029 11:49367634-49367656 TGTGCTTTTCTGGGAAGAGGTGG + Intergenic
1082237988 11:49842965-49842987 TGTTCTCTGGTGGGCAGGGGTGG + Intergenic
1082673127 11:56059445-56059467 TGTTCTCTGGTGGGCAGGAGTGG + Intergenic
1082692501 11:56323639-56323661 TGTTCTCTTGTGGGCAGGGGTGG - Intergenic
1083534993 11:63459315-63459337 TGTTCTCTGGTGGGCAGGGGTGG - Intergenic
1084013701 11:66366556-66366578 CGTTCTCATCTGGGGTGAGGGGG + Exonic
1084046836 11:66573848-66573870 TGTTCTCTGGCGGGCAGAGTGGG - Intergenic
1084047321 11:66576759-66576781 TGTTCTCTGGCGGGCAGAGTGGG - Intergenic
1084122385 11:67077356-67077378 CCTTCTTCTCTGGGCAGAGGGGG - Intergenic
1084231959 11:67759897-67759919 TGTTCTCTGGTGGGCAGAGTGGG - Intergenic
1084232756 11:67765168-67765190 TGTTCTCTGGCGGGCAGAGTGGG - Intergenic
1084654266 11:70506055-70506077 TACTCTTTTCTGGGCAGGGGAGG + Intronic
1084873085 11:72110671-72110693 GGTTGTCTTCTGGGCAGAATGGG - Exonic
1085120693 11:73965570-73965592 TCTCCTCTGCTGGGCAAAGGTGG - Intronic
1085181203 11:74538132-74538154 TGCTCTCTTGTGGGCAAGGGTGG + Intronic
1085281138 11:75331595-75331617 TGTTCTCTGGCGGGCAGGGGTGG - Intronic
1085281209 11:75332044-75332066 TGTTCTCTTGCGGGTAGGGGCGG - Intronic
1085569916 11:77550416-77550438 TGTTCTCTTGTGGGCAGGAGTGG - Intronic
1085901059 11:80700219-80700241 TGTTCTCTTGTGGGCAGGGGCGG - Intergenic
1085934743 11:81127292-81127314 TGTTCTCTGGTGGGCAGGAGTGG - Intergenic
1085987321 11:81802445-81802467 TGTTCTCTGGTGGGCAGGAGTGG - Intergenic
1086004743 11:82025661-82025683 TGTTCTCTGGTGGGCAGGAGTGG - Intergenic
1086005510 11:82030812-82030834 TGTTCTCTGGCGGGCAGGGGTGG - Intergenic
1086136616 11:83448361-83448383 TGTTCTCTGATGGGCAGTAGTGG + Intergenic
1086504905 11:87494849-87494871 TGTTCTCTGGTGGGCAGGAGTGG + Intergenic
1086654649 11:89338571-89338593 TGTGCTTTTCTGGGAAGAGGTGG - Intronic
1086950730 11:92887802-92887824 TGTTCTCCCCAGGGCAGGGGAGG + Intronic
1087099548 11:94351224-94351246 TGTTCTCTGGCGGGCAGAGTGGG - Intergenic
1087196543 11:95309691-95309713 TGTTCTCTGGTGGGCAGGGGTGG - Intergenic
1087197734 11:95317605-95317627 TGTTCTCTGGTGGGCAGGGGTGG - Intergenic
1088984283 11:114891934-114891956 TGTTCTCTCCTTGGCATAGGGGG + Intergenic
1089063226 11:115643082-115643104 AGTGCTCTCCTGGCCAGAGGAGG - Intergenic
1089349459 11:117814132-117814154 TGTTCTCTGGTGGGCAGGGAAGG - Intronic
1089408282 11:118217014-118217036 TGCTGTTTTCTGGGCAGAGGAGG - Intronic
1089866504 11:121637527-121637549 TGTTCTCTGGTGGGCAGGAGTGG + Intergenic
1089867372 11:121643286-121643308 TGTTCTCTGGTGGGCAGGAGTGG + Intergenic
1089954177 11:122555406-122555428 TGTTCTCTGGTGGGCAGGAGTGG - Intergenic
1089987053 11:122824635-122824657 TGTTCTCTGGTGGGCAGAGTGGG - Intergenic
1089988130 11:122832627-122832649 TGTTCTCTGGCGGGCAGAGTGGG - Intergenic
1090387390 11:126364930-126364952 TGTTCTCTTTGGGGCACAGCTGG + Intronic
1090389956 11:126382128-126382150 TGTTCTCTTTGGGGCACAGCTGG + Intronic
1090850128 11:130564564-130564586 TGTTCTCTGGTGGGCAGGGGTGG + Intergenic
1090850939 11:130569858-130569880 TGTTCTCTGGTGGGCAGGGGTGG + Intergenic
1090872282 11:130758864-130758886 TGTTCTCTGGTGGGCAGGAGTGG + Intergenic
1091549283 12:1525705-1525727 ACTTCTCTTTTGGGGAGAGGTGG + Intergenic
1092106052 12:5922420-5922442 TGCCCTGTTCTGGTCAGAGGAGG - Intronic
1092474936 12:8810382-8810404 TGTTCTCTGGCGGGCAGAGTGGG - Intergenic
1092475196 12:8813138-8813160 TGTTCTCTGGCGGGCAGAGTGGG - Intergenic
1093072929 12:14725065-14725087 TTTTCTCTTGCGGGCAGGGGTGG + Intergenic
1093584836 12:20822362-20822384 TGTTCTCTGGTGGGCAGGGGCGG + Intronic
1093812330 12:23506006-23506028 TGTTCTCTGGTGGGCAGGAGTGG + Intergenic
1093951641 12:25169319-25169341 TGTTCTCTAGTGGGCAGGAGTGG - Intronic
1094467943 12:30773894-30773916 TGTTCATTCCTGGGCACAGGTGG - Intergenic
1094495969 12:30989536-30989558 TGTTTTCCTATTGGCAGAGGGGG + Intronic
1094723348 12:33088025-33088047 TTTTCTCTTGCAGGCAGAGGCGG + Intergenic
1094825418 12:34265844-34265866 TGTTCTCTGGCGGGCAGAGTGGG - Intergenic
1094826601 12:34274059-34274081 TGTTCTCTGGTGGGCAGAGTGGG - Intergenic
1095173295 12:39060499-39060521 TGTCCTCTTGTTGGCAGGGGCGG - Intergenic
1095739543 12:45592198-45592220 TCTTCTTTTCTGGCCATAGGAGG - Intergenic
1095805943 12:46321475-46321497 TGCTCTCTGGTGGGCAGGGGTGG + Intergenic
1095940621 12:47724576-47724598 CTTTCTCCTGTGGGCAGAGGAGG + Intronic
1096906675 12:54942714-54942736 TGTTCTCTGGTGGGCAGGGGCGG + Intergenic
1096978841 12:55716919-55716941 TCCTCTTTTCTGGGGAGAGGGGG - Exonic
1097398200 12:59101878-59101900 TGTTCTCTGGTGGGCAGGGGCGG - Intergenic
1097520222 12:60658497-60658519 TGGTCTCTTCTGGTCAGAACAGG + Intergenic
1097542525 12:60957385-60957407 TGTTCTCTGGTGGGCAGGAGTGG + Intergenic
1097544305 12:60979450-60979472 TGTTCTCTGGTGGGCAGAGTGGG + Intergenic
1097690506 12:62730060-62730082 TGTTCTCTGGCGGGCAGAGTGGG - Intronic
1098401869 12:70085531-70085553 TGTTCTCTAGTGGGCAGGGGTGG - Intergenic
1098402617 12:70090097-70090119 TGTTCTCTGGTGGGCAGGGGTGG - Intergenic
1098567234 12:71950414-71950436 TGTTCTCTGGTGGGCAGAGTGGG + Intronic
1098639994 12:72826560-72826582 TGTTCTCTTCCGGGCAGGGGTGG - Intergenic
1098919622 12:76291932-76291954 TGTTCTCTTATTGGCAGGGGCGG - Intergenic
1098920451 12:76297584-76297606 TGCTCTCTTATGGGCAGGGGCGG - Intergenic
1099835616 12:87907462-87907484 TGTTCTCTGGTGGGCAGGGGTGG + Intergenic
1099836395 12:87912665-87912687 TGTTCTCTGGTGGGCAGGGGTGG + Intergenic
1099872529 12:88368251-88368273 TGTTCTCTGGTGGGCAGGAGTGG - Intergenic
1100263829 12:92957225-92957247 TGTTCTCTTGCAGGCAGGGGTGG + Intergenic
1101593448 12:106142060-106142082 TGTTCTCTGGCGGGCAGGGGTGG + Intergenic
1102117085 12:110410878-110410900 TGTTCTCTGGCGGGCAGGGGCGG + Intergenic
1102329864 12:112019863-112019885 TGATCTCTTGGTGGCAGAGGTGG + Exonic
1103538737 12:121651639-121651661 TGTTCTCTGCAGGGGAGAGAGGG + Exonic
1105031877 12:132889768-132889790 TGTTCTCTGGTGGGCAGGGGTGG - Intronic
1105501790 13:20979345-20979367 TGTTCTCTGCAGGGCAGGTGTGG + Intronic
1105833191 13:24183973-24183995 AGTTTTCTCCTGGGTAGAGGGGG - Intronic
1106082611 13:26512954-26512976 TGTTCTCTGGCGGGCAGGGGCGG - Intergenic
1106608977 13:31259980-31260002 TGTTCTATTGTGGTCAGAAGTGG + Intronic
1108196675 13:48001955-48001977 TTTTCTCTTACGGGCAGGGGCGG + Intergenic
1108952289 13:56110234-56110256 TGTTCTCTGGTGGGCAGGAGTGG - Intergenic
1109339790 13:61041410-61041432 TTTTCTCTTCTGAGAAAAGGAGG - Intergenic
1109343267 13:61088670-61088692 TGTTCTCTGGCGGGCAGAGTGGG - Intergenic
1109344083 13:61094242-61094264 TGTTCTCTGGCGGGCAGAGTGGG - Intergenic
1109352736 13:61205895-61205917 TGTTCTCTTGTGGGCAGGAGTGG - Intergenic
1109498941 13:63213354-63213376 TGTTCTCTGGTGGGCAGAGTGGG - Intergenic
1109709199 13:66141507-66141529 TGTTCTCTGGTGGGCAGGGGTGG + Intergenic
1109709995 13:66146780-66146802 TGTTCTCTGGTGGGCAGAGGTGG + Intergenic
1110696734 13:78499887-78499909 TTTTCTCTTCTTGGCAGGAGAGG - Intergenic
1110765941 13:79279625-79279647 TGTTCTCTGGCGGGCAGAGTGGG - Intergenic
1110844991 13:80183763-80183785 TGTTCTCTGGTGGGCAGGAGTGG - Intergenic
1110979004 13:81872235-81872257 TGTTCTCTGGCGGGCAGGGGTGG - Intergenic
1111151234 13:84255974-84255996 TTTCATCTTCTGGTCAGAGGTGG - Intergenic
1111630135 13:90839798-90839820 TGTTCTCTGGTGGGCAGGGGCGG - Intergenic
1111630896 13:90844945-90844967 TGTTCTCTGGTGGGCAGGGGCGG - Intergenic
1112237890 13:97652592-97652614 TGTTCTCTGGTGGGCAGGGGTGG + Intergenic
1112274721 13:98005675-98005697 TGCGATCTTCTGGGGAGAGGGGG + Intronic
1112507545 13:99984012-99984034 TGTTCTCTTCCGGGAAGGGAGGG + Intronic
1112566073 13:100552213-100552235 TGTTCTCTCCTGGGGAAATGAGG + Intronic
1112651264 13:101401101-101401123 TGTTTTCTTCTGGGAATAGGAGG - Intronic
1112809148 13:103197496-103197518 TGTTCTCTTCCGGTCAGGGGAGG - Intergenic
1113323918 13:109265324-109265346 TGTTCTCTGGTGGGCAGGGGCGG - Intergenic
1113324807 13:109270918-109270940 TGTTCTCTGGTGGGCAGGGGCGG - Intergenic
1113535514 13:111063224-111063246 TTTTCTCTTGTGGGCAAGGGTGG - Intergenic
1114197867 14:20494946-20494968 TGTTCTCTGGCGGGCAGGGGTGG + Intergenic
1114346053 14:21796472-21796494 TTTTCTCTTGCGGGCAGGGGCGG - Intergenic
1114504390 14:23197926-23197948 TGTTCTCTGGTGGGCAGGCGGGG + Intronic
1115015512 14:28607691-28607713 TATTCCCTTCTGGCCAGAAGAGG - Intergenic
1115240261 14:31246539-31246561 TGTTCTCTGGTGGGCAGGGGTGG + Intergenic
1115240973 14:31250847-31250869 TGTTCTCTGGTGGGCAGGGGTGG + Intergenic
1115650019 14:35396504-35396526 TGTTCTCTGGTGGGCAGGGGTGG - Intergenic
1115949131 14:38699960-38699982 TTATCTCTTGTGGGCAGGGGCGG + Intergenic
1115953045 14:38743315-38743337 GGGTTTCTTCTGGGTAGAGGGGG + Intergenic
1116534322 14:46012609-46012631 TGTTCTCTGGCGGGCAGAGTGGG + Intergenic
1116701902 14:48255370-48255392 TGTTCTCTGGTGGGCAGGAGTGG + Intergenic
1116702846 14:48262567-48262589 TGTTCTCTGGTGGGCAGGAGTGG + Intergenic
1116704413 14:48278642-48278664 TGTTCTTTGGTGGGCAGGGGTGG + Intergenic
1116952562 14:50893413-50893435 TGTTCTCTGGTGGGCAGGGGTGG - Intronic
1116953130 14:50896683-50896705 TGCTCTCTGGTGGGCAGGGGCGG - Intronic
1117598566 14:57349447-57349469 TCTTCTCTTGTGTGCAGAAGTGG - Intergenic
1118412941 14:65501715-65501737 CCTTCTCTTCTGGTCAAAGGAGG + Intronic
1118501442 14:66366020-66366042 TGGTCTCTCCTCTGCAGAGGTGG - Intergenic
1118816939 14:69320545-69320567 TTTTCTCTTCTGTACAGTGGGGG + Intronic
1118937656 14:70301709-70301731 TGTTCTCTGGCGGGCAGAGTGGG + Intergenic
1119022057 14:71124419-71124441 TGTTCTCTGGCGGGCAGAGTGGG - Intergenic
1119248678 14:73133840-73133862 TGTGCTCTTGTGGGCAGGGGCGG + Intergenic
1119881896 14:78106271-78106293 TTTTCTTTTCTGGACAGAGTTGG + Intergenic
1120539888 14:85738366-85738388 TGTTCTCTGGTGGGCAGGAGTGG + Intergenic
1120617977 14:86731800-86731822 TGTTCTCTGGTGGGCAGGAGTGG - Intergenic
1120658846 14:87229230-87229252 TATTCTCTACTTGGCAGAAGAGG - Intergenic
1120659447 14:87234866-87234888 TGTTCTCTGGCGGGCAGAGTGGG + Intergenic
1120661273 14:87254099-87254121 TTTTCTCTTGTGGGCAGGGGTGG - Intergenic
1121040393 14:90741483-90741505 TTTGCTCCGCTGGGCAGAGGTGG - Intronic
1121980853 14:98452391-98452413 TGTTCTCTGGCGGGCAGGGGCGG + Intergenic
1124875608 15:33590073-33590095 TGTTCTCTTGTGGGCAGGGGCGG + Intronic
1125047134 15:35254844-35254866 TGTTCTCTGGTGGGCAGGGGTGG + Intronic
1125212074 15:37228191-37228213 TGTTCTCTGCTAAGCAGAGATGG - Intergenic
1125719733 15:41839536-41839558 GGCTCTCTCCTGGGCAGGGGAGG - Intronic
1125913532 15:43463768-43463790 TACTCTCTCCAGGGCAGAGGAGG - Intronic
1126154364 15:45551412-45551434 TGTTCTCTGGTGGGCAGGGGCGG + Intergenic
1126260175 15:46680362-46680384 TGTTCTCTGGCGGGCAGAGTGGG - Intergenic
1126843399 15:52738790-52738812 TGTTCTCTGGTGGGCAGAGTGGG - Intergenic
1126844318 15:52745006-52745028 TGTTCTCTGGTGGGCAGAGTGGG - Intergenic
1126911952 15:53427021-53427043 TGTTCTCTGGTGGGCAGGGGTGG + Intergenic
1126912718 15:53432207-53432229 TGTTCTCTGGTGGGCAGGGGCGG + Intergenic
1127498528 15:59534865-59534887 TGTTCTCTGGCGGGCAGGGGTGG + Intergenic
1128542661 15:68546589-68546611 TGTACTGCACTGGGCAGAGGAGG - Intergenic
1128648003 15:69391150-69391172 TGTTTTTTCCTGGGGAGAGGGGG - Intronic
1128938034 15:71764746-71764768 TGTTGTCTTCTGTGCTGAGAGGG - Intronic
1129329891 15:74821662-74821684 TGTTAGATACTGGGCAGAGGAGG + Intronic
1130459627 15:84151509-84151531 TGTTCTCTCCTGGGCAGGACAGG + Intergenic
1131403521 15:92145304-92145326 TTTCCTCTCCTGGGAAGAGGAGG + Intronic
1131687302 15:94782336-94782358 TTTTCTCTTCTAGTCAGAGATGG - Intergenic
1132262649 15:100440419-100440441 TGTTCTCTGGTGGGCAGGAGTGG - Intronic
1132263522 15:100446013-100446035 TGTTCTCTAGTGGGCAGGAGTGG - Intronic
1132858585 16:2058553-2058575 TGTTCACTCCTGCGCACAGGCGG - Intronic
1133453184 16:5920590-5920612 AGCTCTGTACTGGGCAGAGGAGG + Intergenic
1133869016 16:9670704-9670726 TGTTCTCTGGTGGGCAGGAGTGG + Intronic
1133925644 16:10190034-10190056 TGTGGTCTGCAGGGCAGAGGGGG + Intergenic
1134563117 16:15227731-15227753 AGTTCACTTCTGGCCAGATGCGG - Intergenic
1134923649 16:18139360-18139382 AGTTCTCTTCTGGCCAGATGCGG - Intergenic
1135139335 16:19908213-19908235 TGTTCTCTGGCGGGCAGGGGTGG + Intergenic
1135258680 16:20962662-20962684 TGTTCTTTTTTGGGGGGAGGGGG + Intronic
1136866587 16:33763087-33763109 TGTTTTCTTCTGTGAAAAGGAGG - Intergenic
1137250827 16:46739512-46739534 TGTTGTCTTGGTGGCAGAGGAGG - Intronic
1137388541 16:48061960-48061982 TGTTGGTTTCTGAGCAGAGGAGG - Intergenic
1137421268 16:48336597-48336619 TGTTCTCTTGCTGGCAGGGGCGG + Intronic
1137801520 16:51266344-51266366 TCTTCTCTTCTGGGCAGTAATGG - Intergenic
1138246935 16:55474578-55474600 TGTTCTCTGGCGGGCAGGGGTGG + Intronic
1139205687 16:65026291-65026313 TTTTCTTATCTGGGCAGTGGAGG - Intronic
1139230115 16:65275433-65275455 TGTTCTCTGGTGGGCAGGGGCGG + Intergenic
1140310755 16:73846133-73846155 TGTTCTGTACTTGGCAGCGGTGG + Intergenic
1140813741 16:78602216-78602238 TGTTCTCTTCTGGATAGATCTGG + Intronic
1141025536 16:80543263-80543285 TGGTCTCTTTCAGGCAGAGGTGG + Exonic
1141069309 16:80938935-80938957 TGTTTTCTTTTTGGCAGGGGTGG + Intergenic
1141073200 16:80977419-80977441 TGTTTTCCCCTGGGCAGAAGGGG + Intronic
1141796404 16:86278336-86278358 TGTTCTCTGCTGGGCAGGGGTGG - Intergenic
1141796889 16:86281080-86281102 TGTTCTCTGCTGGGCAGGGGTGG - Intergenic
1141798683 16:86292317-86292339 TGCTCGCTGCTGGGCATAGGTGG + Intergenic
1203105572 16_KI270728v1_random:1353110-1353132 TGTTTTCTTCTGTGAAAAGGAGG + Intergenic
1203127942 16_KI270728v1_random:1609258-1609280 TGTTTTCTTCTGTGAAAAGGAGG - Intergenic
1142489136 17:266578-266600 TGTGCTCTCCTGGGCTGAGTGGG - Intronic
1142718898 17:1763219-1763241 TGTGCGGTTCTGGGAAGAGGGGG + Intronic
1142757824 17:2025905-2025927 TGTTCTTTCGTGGGGAGAGGAGG + Intergenic
1142953812 17:3506380-3506402 TGTTCTTTTCTTGGCAGAATGGG - Intronic
1143439060 17:6954020-6954042 TGACCTCTTCTGGGAAGTGGAGG - Intronic
1143617471 17:8062098-8062120 TGTTCTCTGGCGGGCAGGGGCGG - Intergenic
1143643645 17:8215116-8215138 TTGTCTCTTCTGTGGAGAGGAGG + Intergenic
1144104281 17:11971990-11972012 TGTTCTCTGGTGGGCAGGGGCGG - Intergenic
1144105048 17:11976748-11976770 TGTTCTCTGGTGGGCAGGGGCGG - Intergenic
1144108736 17:12010807-12010829 TGTGCTTTTCTGGGCAGTGCAGG + Intergenic
1144869750 17:18362108-18362130 TGTTCTCTTCTTTACAGAAGAGG + Intronic
1145926967 17:28655168-28655190 TGTTCTCTTTTGTGCAGACCTGG - Intronic
1146165978 17:30589068-30589090 TTATCTCTTGTGGGCAGGGGAGG + Intergenic
1146299014 17:31673727-31673749 TGTTCTCTTTTTGGTAGAGATGG - Intergenic
1147711527 17:42469887-42469909 TAATCTCTCCTGGGCCGAGGCGG - Intronic
1147808351 17:43148474-43148496 TTTTCTCTTGTGGGCAGGGGTGG + Intergenic
1148595249 17:48849239-48849261 TGTTCTTTTGTAGGGAGAGGTGG + Exonic
1148866050 17:50629249-50629271 TGGTCCCTACTGGGAAGAGGAGG - Intergenic
1148974810 17:51518372-51518394 TGTTCTCTTACGGGCTAAGGAGG - Intergenic
1149215162 17:54345941-54345963 TGTTCTCTGGTGGGCAGGAGTGG - Intergenic
1149319248 17:55467990-55468012 TTTTCTCTTGTGGGCAGGGGCGG - Intergenic
1149343192 17:55707781-55707803 GGTTATCTTTAGGGCAGAGGAGG - Intergenic
1149560512 17:57604898-57604920 AGTTGTCTTCAGGGCTGAGGAGG - Intronic
1150114907 17:62538674-62538696 TGTTCTCATGTGGAAAGAGGTGG + Intronic
1151425893 17:74030868-74030890 TGGAGTCTTCTGGGCAGAGATGG - Intergenic
1151839295 17:76606164-76606186 TGTTCTCTGGTGGGCAGAGTGGG + Intergenic
1151840064 17:76611260-76611282 TGTTCTCTGGCGGGCAGAGCGGG + Intergenic
1152438670 17:80291806-80291828 TCTTCACTTCTGGGCTCAGGAGG + Exonic
1152536616 17:80953784-80953806 TGGGCTCTTCTGGGCAGAAACGG + Intronic
1153533117 18:6069657-6069679 TGAACTCTTCTGTGCAGAAGAGG - Intronic
1153796486 18:8627833-8627855 TGTTCTCTGCTTGGAAGAGGGGG + Intronic
1155064344 18:22255757-22255779 AGTTCTATTCTGGAGAGAGGAGG - Intergenic
1155720048 18:29000523-29000545 TGTTCTCTGGTGGGCAGGAGTGG + Intergenic
1155942079 18:31809870-31809892 TGTTCTCTGGTGGGCAGGAGTGG - Intergenic
1156019467 18:32583216-32583238 TGGTCTCACCTGGGCAGATGGGG - Intergenic
1156237073 18:35216221-35216243 TGTTCTCTGGCGGGCAGGGGTGG - Intergenic
1156237971 18:35222324-35222346 TGTTCTCTGGTGGGCAGGGGTGG - Intergenic
1156290674 18:35746946-35746968 TGTCCTCTCCTGAACAGAGGAGG - Intergenic
1156490151 18:37491288-37491310 AGGTCTCTGCTGGCCAGAGGAGG - Intronic
1156923566 18:42552615-42552637 TGTTCTCTGGTGGGCAGGAGTGG + Intergenic
1156958681 18:42996613-42996635 TGTTCTCTGGTGGGCAGGAGTGG - Intronic
1157107214 18:44785616-44785638 TGTTCTCTAATGGGGAGATGAGG - Intronic
1157409392 18:47450867-47450889 AGTTCCCTTCTGGGAAGGGGAGG - Intergenic
1157589847 18:48829697-48829719 TGCTGTCTCCTGGGGAGAGGAGG + Intronic
1157896357 18:51471941-51471963 GGTTCTCTGGTGGGCAGGGGTGG + Intergenic
1158076575 18:53536959-53536981 TGTTTTCATCGGGGCAAAGGGGG - Intergenic
1158263633 18:55636225-55636247 TGTGCTTCTCTGGGCAGAGCAGG - Intronic
1158393899 18:57064825-57064847 TGTTCTCTGGTGGGCAGGAGTGG + Intergenic
1158395004 18:57072228-57072250 TGTTCTCTGGTGGGCAGGAGTGG + Intergenic
1158484886 18:57857585-57857607 TGTTCTCTGGCGGGCAGGGGTGG - Intergenic
1159002323 18:62985202-62985224 TCTTCTATCCTGTGCAGAGGGGG + Intergenic
1159378918 18:67631182-67631204 TGTTCTCTGGTGGGCAGGAGTGG + Intergenic
1159834690 18:73324849-73324871 TGTTCTCTGGTGGGCAGGGGTGG - Intergenic
1159835513 18:73330165-73330187 TGTTCTCTGGTGGGCAGGGGCGG - Intergenic
1159929819 18:74298847-74298869 TGTTCTCTTGAGGGCAGGGGCGG - Intergenic
1161299312 19:3535214-3535236 TGGTCTGTTCTGTGCAGACGTGG - Intronic
1161661388 19:5548817-5548839 TGCTCTCTGGTGGGCAGGGGTGG - Intergenic
1161662072 19:5553013-5553035 TGTTCTCTGGTGGGCAGGGGTGG - Intergenic
1162078311 19:8203820-8203842 TGTTCTCTGGTAGGCAGGGGCGG + Intronic
1162266782 19:9582447-9582469 TGTTCTCTTGCGGGCAGGGGCGG - Intronic
1162986826 19:14276203-14276225 TTTTCTCTTGTGGGCAGGGGCGG - Intergenic
1163486973 19:17593727-17593749 TGTTCTCTGGCGGGCAGAGTGGG - Intergenic
1163664531 19:18597044-18597066 TGGTCACTGCGGGGCAGAGGAGG + Exonic
1163897125 19:20068977-20068999 TGTTCTCTGGTGGGCAGAGTGGG + Intergenic
1163900633 19:20096510-20096532 TGTTCTCTGGTGGGCAGGAGTGG + Intronic
1163927423 19:20359359-20359381 TTTTCTCTTGTGGGCAGGGGCGG - Intergenic
1163943955 19:20519007-20519029 TGTTCTCTGGTGGGCAGGGGTGG + Intergenic
1163944725 19:20524260-20524282 TGTTCTCTGGTGGGCAGGGGCGG + Intergenic
1164082066 19:21867191-21867213 TTTTCTCTTGTGGGCAGGGGCGG - Intergenic
1164202886 19:23033070-23033092 TGTTCTCTGGCGGGCAGGGGCGG - Intergenic
1164999458 19:32749127-32749149 TGTCATCATCTGGGTAGAGGAGG + Intronic
1165317937 19:35067929-35067951 TGTTCTCTGGCGGGCAGGGGTGG + Intergenic
1165401671 19:35604773-35604795 TGTTCTCTTGCAGGCAGGGGCGG - Intergenic
1166181609 19:41112974-41112996 TGTTCTCAGAGGGGCAGAGGAGG - Intergenic
1166398466 19:42460179-42460201 TTTTCTCTTGTGGGCAGTGGTGG - Intergenic
1166498468 19:43323688-43323710 TGTTCTCTGGTGGGCAGGGGCGG + Intergenic
1166499323 19:43329128-43329150 TGTTCTCTGGTGGGCAGGGGCGG + Intergenic
1166546316 19:43636421-43636443 TGGGCTCTTCTGGGAAGAGGGGG - Intronic
1166653301 19:44591670-44591692 TGTTCTCTTGCGGGCAGGGGTGG + Intergenic
1167099935 19:47398568-47398590 TGTTCTCTGGTGGGCAGGAGTGG - Intergenic
1167353699 19:48991332-48991354 TGTCCTCTTCAGGGCCGGGGTGG + Exonic
1167847717 19:52178206-52178228 TGTTCTCTTGTGGGCAGGGGCGG - Intergenic
1167883885 19:52484758-52484780 TGTTCTCTGGCGGGCAGAGTGGG - Intronic
1167901813 19:52628006-52628028 TGTTCTCTGGTGGGCAGGAGTGG - Intronic
1167902599 19:52633208-52633230 TGTTCTCTGGTGGGCAGGGGTGG - Intronic
1167917853 19:52756666-52756688 TGTTCTCTTGAGGGCAGGGCCGG - Intergenic
1167935704 19:52905309-52905331 TGTTCTCTGGCTGGCAGAGGTGG - Intergenic
1168131316 19:54321411-54321433 TGTTCTCTGGTGGGCAGGTGTGG + Intergenic
1168227530 19:55007003-55007025 TGTTCTCTGGCGGGCAGAGTCGG + Intergenic
1168228317 19:55012189-55012211 TGTTCTCTGGCGGGCAGAGTGGG + Intergenic
925434136 2:3821127-3821149 TGTTCTCTGGTGGGCAGGGGCGG + Intronic
926056074 2:9774820-9774842 TGGTCTCTTCTGGGGCCAGGTGG - Intergenic
926408221 2:12575241-12575263 TGTTCTCTGGTGGGCAGGGGCGG - Intergenic
926612270 2:14958319-14958341 TTTTCTCATCTGGGCAGGGTTGG + Intergenic
926815080 2:16792119-16792141 TGTTCTCTGGTGGGCAGGTGCGG + Intergenic
926815907 2:16797447-16797469 TGTTCTCTGGTGGGCAGGGGCGG + Intergenic
927133889 2:20082797-20082819 TTTTCTCTTACGGGCAGGGGTGG - Intergenic
927454422 2:23237412-23237434 GGTCCTCTCCTGGGCCGAGGAGG - Intergenic
927519035 2:23688291-23688313 TCCTCTCTTCTGAGCAGAGCTGG + Intronic
927895661 2:26780158-26780180 TAATCTCTTCCAGGCAGAGGAGG - Exonic
928490567 2:31778550-31778572 TGTTCTCCTGTGGGCAGTGGTGG - Intergenic
928771109 2:34702637-34702659 TGTTCTCTGGTGGGGAGGGGTGG - Intergenic
928779247 2:34801171-34801193 TGTTCTCTGGTGGGCAGGAGTGG + Intergenic
928827166 2:35437088-35437110 TGTTCTCTGGTGGGCAGGAGTGG + Intergenic
930510480 2:52337862-52337884 TGTTCTCTGGCGGGCAGGGGCGG - Intergenic
930955554 2:57198496-57198518 TGTTCTCTGGTGGGCAGGGGTGG - Intergenic
931025926 2:58113609-58113631 TGTTCTCTGGTGGGCAGGGGCGG + Intronic
931026739 2:58118874-58118896 TGTTCTCTGGTGGGCAGGGGCGG + Intronic
931042351 2:58314377-58314399 TGTTCTCTGGTGGGCAGGAGTGG - Intergenic
931236532 2:60417636-60417658 TGTTCTCTGGCGGGCAGGGGCGG - Intergenic
931237298 2:60422288-60422310 TGTTCTCTGGTGGGCAGGGGTGG - Intergenic
931608432 2:64074983-64075005 TGTTCTCTGGCGGGCAGAGTGGG + Intergenic
932359207 2:71090723-71090745 TGTTCTCTGGTGGGCAGGAGTGG + Intergenic
932838226 2:75057287-75057309 TGTTCCCTGGTGGGCAGGGGCGG - Intronic
933137661 2:78758372-78758394 TGTTCTCTTGCGGGCAGGGGCGG - Intergenic
933138518 2:78764075-78764097 TGTTCTCTGGTGGGCAGGGGTGG - Intergenic
933329215 2:80875974-80875996 TGTTCTCTGGTGGGCAGGGGCGG + Intergenic
933336354 2:80964416-80964438 TGTGCTCATGTAGGCAGAGGTGG + Intergenic
933369549 2:81397441-81397463 TGTTCTCTGGCGGGCAGGGGCGG + Intergenic
933447318 2:82398451-82398473 TGTTCTCTGGTGGGCAGAGTGGG + Intergenic
933589930 2:84221113-84221135 TGTTCTCTTGCGGGCAGGGGCGG + Intergenic
933860748 2:86464790-86464812 GGATCTCTTCTGGGAAGTGGTGG + Intronic
934635277 2:95981670-95981692 TGTTTTCTTCTGTGAAAAGGAGG - Intronic
934798353 2:97123549-97123571 TGTTTTCTTCTGTGAAAAGGAGG + Intronic
934835076 2:97579879-97579901 TGTTTTCTTCTGTGAAAAGGAGG - Intronic
934886679 2:98031228-98031250 TGTTCTCCGGTGGGCAGGGGTGG + Intergenic
934888447 2:98045370-98045392 TGTTCTCTTGAGGGCAGGGCGGG + Intergenic
934905003 2:98192400-98192422 TGTTCTCTGGCGGGCAGAGTGGG + Intronic
935725217 2:106018158-106018180 CTTTCTGTTCTGGGGAGAGGTGG + Intergenic
936793447 2:116178976-116178998 TGTTCTCTGGTGGGCAGGAGTGG + Intergenic
936793782 2:116183929-116183951 TGTTCTCTGGCGGGCAGGGGTGG + Intergenic
936794562 2:116189476-116189498 TGTTCTCTGGCGGGCAGGGGTGG + Intergenic
937710431 2:124974737-124974759 TGTTCTCTAGTGGGCAGGAGTGG + Intergenic
937827476 2:126382364-126382386 TGTTCTCTGGCGGGCAGGGGTGG + Intergenic
938162223 2:128996252-128996274 TGTTATGTACTGTGCAGAGGTGG + Intergenic
939307943 2:140432205-140432227 TGTTCTCTGGTGGGCAGATGTGG - Intronic
939518264 2:143196763-143196785 TGTTCTATTCTGTTTAGAGGGGG + Intronic
940182670 2:150953585-150953607 TGTTCTCTGGTGGGCAGGGGCGG - Intergenic
940529840 2:154867527-154867549 TGTTCTCTGGCGGGCAGAGTGGG - Intergenic
940530871 2:154874363-154874385 TGTTCTCTGGCGGGCAGAGTGGG - Intergenic
940726694 2:157343244-157343266 TGTTCTCTTGTGGACAGGGGCGG + Intergenic
940920321 2:159298430-159298452 TGTTCTGTTGTGGGCAGGGGCGG - Intergenic
942363748 2:175199831-175199853 TTTTCTCTTGCGGGCAGCGGTGG + Intergenic
943421117 2:187670657-187670679 TGTTCTCTGGTGGGCAGGAGTGG + Intergenic
943450650 2:188038942-188038964 TGTTCTCTGGTGGTCAGGGGTGG - Intergenic
943461482 2:188174462-188174484 TGTTCTCTGGTGGGCAGGAGTGG + Intergenic
943806265 2:192130620-192130642 TGTTCTCTGGTGGGCAGGGGCGG - Intronic
943807095 2:192135912-192135934 TGTTCTCTGGTGGGCAGGGGCGG - Intronic
943865072 2:192918535-192918557 TATTCTCTGGTGGGCAGGGGTGG - Intergenic
943865941 2:192924650-192924672 TGTTCTCTGGCGGGCAGGGGTGG - Intergenic
943977564 2:194504065-194504087 TGTCCTCTCATGGGTAGAGGTGG - Intergenic
944251965 2:197587528-197587550 TGTTCTCTGGCGGGCAGGGGTGG - Intronic
944387106 2:199179616-199179638 TGTTCTCTGGTGGGCAGGGTTGG - Intergenic
944387970 2:199185473-199185495 TGTTCTCTGGTGGGCAGGAGTGG - Intergenic
944875656 2:203962117-203962139 TGTTCTCTGGCGGGCAGAGTGGG + Intergenic
944985528 2:205171340-205171362 AGTTCTGTTCTAGGCAGAGCAGG + Intronic
945173107 2:207017429-207017451 TGTTCTCTGGCGGGCAGAGTGGG - Intergenic
945173955 2:207023086-207023108 TGTTCTCTGGTGGGCAGAGTGGG - Intergenic
945300974 2:208216105-208216127 TGTTCTCTGGCGGGCAGAGTGGG + Intergenic
945375757 2:209078271-209078293 TGTTCTCTGGTGGGCAGGAGTGG - Intergenic
945376637 2:209084181-209084203 TGTTCTCTGGTGGGCAGGAGTGG - Intergenic
945394763 2:209304739-209304761 TGTTCTCTGGTGGGCAGGAGTGG - Intergenic
946781379 2:223195268-223195290 TGTTCTCTGGTGGGCAGGAGTGG + Intronic
946804932 2:223462607-223462629 TTTTCTCTTGCGGGCAGGGGCGG - Intergenic
947497308 2:230647229-230647251 TTTTCTCTTGCGGGCAGGGGCGG + Intergenic
947831251 2:233143414-233143436 TGTTCTCTACTGTGAAAAGGAGG + Intronic
948137527 2:235647905-235647927 TGCTCTCACCTGGCCAGAGGGGG - Intronic
948390295 2:237606997-237607019 TGTTCTCTGGTGGGCAGAGGAGG - Intergenic
948391152 2:237612456-237612478 TGTTCTCTGGCGGGCAGAGTGGG - Intergenic
948661430 2:239508929-239508951 TGGCCTCTCCTGGGCTGAGGTGG + Intergenic
1168943601 20:1733314-1733336 TTTTCTCTTGTGGGCAGGGGTGG + Intergenic
1170068398 20:12340444-12340466 TGTTCTCTGGTGGGCAGGGGCGG + Intergenic
1170069197 20:12345683-12345705 TGTTCTCTGGTGGGCAGGGGCGG + Intergenic
1170504256 20:17008448-17008470 TGTTCTCTGGCGGGCAGGGGCGG + Intergenic
1171296936 20:24025588-24025610 TGTTGTCTGCTGGGCAGTGGGGG - Intergenic
1172202210 20:33134420-33134442 TGTTCTCTTCGGGGCTAATGGGG - Intergenic
1172339489 20:34144918-34144940 TTTTCTCTGGTGGGCAGGGGTGG + Intergenic
1173102366 20:40098810-40098832 TGTTCTCTGGTAGGCAGGGGCGG - Intergenic
1173370144 20:42427902-42427924 TGTTCTCTCGTGGGCAGGAGTGG - Intronic
1173478711 20:43382606-43382628 TGTTCTCTGGCGGGCAGGGGCGG - Intergenic
1173632189 20:44524978-44525000 TGTTCTCTGATGGTCAGGGGCGG - Intergenic
1173781300 20:45759553-45759575 TGTTCTCTGGAGGGCAGAGTTGG - Intronic
1173782162 20:45765047-45765069 TGTTCTCTGGAGGGCAGAGTGGG - Intronic
1174649278 20:52110858-52110880 TGATCTCTTGGTGGCAGAGGTGG - Intronic
1174695442 20:52552055-52552077 GGTTTTCCTCTGGGGAGAGGCGG + Intergenic
1175504657 20:59473028-59473050 TGTTCTCTGGTGGGCAGGGGCGG + Intergenic
1175563811 20:59955936-59955958 TGTTCTAGTCTGGGCGGAGCTGG - Intergenic
1175980122 20:62734523-62734545 GGTTCTCTGCTGAGCAGAGCTGG + Intronic
1176268981 20:64225641-64225663 TGTTCCCTTCTGCCCAGATGGGG + Intronic
1177030669 21:15979785-15979807 TGTTCTCTGGTGGGCAGGAGTGG + Intergenic
1177031460 21:15985078-15985100 TGTTCTCTGGAGGGCAGGGGTGG + Intergenic
1177116000 21:17087990-17088012 TGTTCTCTGGCGGGCAGGGGTGG - Intergenic
1177119221 21:17121695-17121717 TGTTCTCTGATGGGCAGGAGTGG - Intergenic
1177120113 21:17127602-17127624 TGTTCTCTGGTGGGCAGGAGTGG - Intergenic
1177138855 21:17336544-17336566 TCTTCTCTTCTAGGGCGAGGTGG + Intergenic
1177825782 21:26081387-26081409 TGTTCTCTGGGGGGCAGGGGTGG + Intronic
1177840250 21:26228049-26228071 TGTTCTCTGGTGGGCAGGAGTGG + Intergenic
1177841014 21:26233250-26233272 TGTTCTCTGGTGGGCAGGAGTGG + Intergenic
1178076290 21:29016005-29016027 TGCTCTGTTCTGTGGAGAGGAGG - Intronic
1178267185 21:31154421-31154443 TGTACTCTTCGGAGCACAGGGGG + Exonic
1178752572 21:35318469-35318491 TGTTGTCATTAGGGCAGAGGTGG - Intronic
1179324417 21:40326318-40326340 TCTTGTCTTCAGGACAGAGGTGG + Intronic
1179892232 21:44341713-44341735 TGTTCTCTGGCGGGCAGAGTGGG + Intergenic
1179892986 21:44346521-44346543 TGTTCTCTTGCGGGCAGGGGTGG - Intergenic
1180560560 22:16611547-16611569 TGTTCTCTGGTGGGCAGGGGTGG - Intergenic
1180561133 22:16614950-16614972 TGTTCTCTGGTGGGCAGGGGTGG - Intergenic
1180619271 22:17149333-17149355 TCTTTTCTTCTGGGCATTGGGGG - Intronic
1180897906 22:19350680-19350702 CGTTTTCTTCTTGGCAGAGTTGG - Intronic
1181025572 22:20125516-20125538 TGTTGCCTTTTGGGGAGAGGGGG + Intronic
1181096512 22:20508571-20508593 TGTTCTCTGGTGGGCAGGGATGG + Intronic
1181359762 22:22325324-22325346 TTTTCTCCTCTGGGCTTAGGAGG - Intergenic
1181962401 22:26632150-26632172 TGTTCTCTGGTGGGCAGGGGTGG + Intergenic
1182065276 22:27426888-27426910 TCTTCTCTACTTTGCAGAGGAGG - Intergenic
1182731932 22:32502988-32503010 TGTTCTCTGGTGGGCAGGGGCGG - Intergenic
1182732745 22:32508305-32508327 TGTTCTCTGGTGGGCAGGGGCGG - Intergenic
1182999077 22:34839824-34839846 TGTTCTCTGGTGGGCAGGAGTGG - Intergenic
1183535066 22:38396713-38396735 TGTTCTCTGGTGGGCAGGGGTGG + Intronic
1183636710 22:39068111-39068133 TTTTCTCTTGCGGGCAGGGGTGG + Intronic
1184236604 22:43186573-43186595 TGTTCTCATCTGTGAAGTGGGGG + Intronic
1184375364 22:44108648-44108670 TGTTCTCTGGTGGGCAGGGGTGG + Intronic
1184545062 22:45162345-45162367 TGTTCTCTGGTGGGCAGGGGTGG - Intergenic
1184627079 22:45743674-45743696 TTTTGTCTTCTGGGCAAAGGAGG - Intronic
1185052995 22:48563425-48563447 TGAACTCCTCTGGGCACAGGTGG + Intronic
949190041 3:1240943-1240965 TGTTCTCTGGTGGGCATGGGTGG + Intronic
949190671 3:1244798-1244820 TGTTCTCTGGTGGGCAGGGGTGG + Intronic
949592485 3:5508894-5508916 TTTTCTCTTGTGGGCAGGGGTGG + Intergenic
949820883 3:8114082-8114104 TGTTCTCTGGCGGGCAGAGTGGG - Intergenic
949927014 3:9049464-9049486 TGTTTCCTTCTGGGTAGAAGGGG - Intronic
950844381 3:16000414-16000436 TGTTCTCTGGTGGGCAGGGGTGG - Intergenic
950890966 3:16403202-16403224 TGTCCCTTTCTGGACAGAGGTGG - Intronic
950926144 3:16744487-16744509 TGTTCTCTGGTGGGCAGAGTGGG - Intergenic
950926963 3:16749869-16749891 TGTTCTCTGGCGGGCAGAGTGGG - Intergenic
951298364 3:20967716-20967738 TGTTCTTTGGTGGGCAGGGGTGG + Intergenic
951299147 3:20972995-20973017 TGTTCTCTGGTGGGCAGGAGTGG + Intergenic
951700748 3:25494148-25494170 TGTACTCTTCTGTGCAGTAGAGG - Intronic
952192614 3:31039827-31039849 TCTTCTCTTCTGTACAGTGGGGG + Intergenic
952343061 3:32461111-32461133 TGTTCTCTGATGGGCAGGAGTGG + Intronic
952663795 3:35879843-35879865 TGTTCTCTGGTGGGCAGGAGTGG + Intergenic
953076683 3:39578008-39578030 TGTTCTCTGGCGGGCAGAGTGGG + Intergenic
953320822 3:41969782-41969804 TGTTCCCTTCTAAGTAGAGGTGG - Intergenic
953598906 3:44344832-44344854 TGTTCTCTTGCGGGCAGGGGCGG + Intronic
953834717 3:46332594-46332616 TTATCTCTTGAGGGCAGAGGTGG + Intergenic
954162079 3:48729977-48729999 TTTTCTCTTGCGGGCAGGGGTGG + Intronic
954506086 3:51075180-51075202 TGTTCACTTCTGGGTAAATGAGG - Intronic
954841445 3:53515243-53515265 TGTTCTCTGCTTGGCCCAGGTGG + Intronic
955054318 3:55442416-55442438 TGCTCACTTCTGGGCCAAGGAGG - Intergenic
955523993 3:59802540-59802562 TGTTCTCTGGTGGGCAGGGGCGG - Intronic
955689396 3:61576121-61576143 TGCTTTCTTCTGTGCAGAGCAGG + Intronic
956168351 3:66413272-66413294 CGTTCTCTTCTGTGCAGCTGTGG - Intronic
956358331 3:68418317-68418339 TGTTCTCTGGTGGGCAGAGTGGG + Intronic
956426798 3:69144610-69144632 TGTTACCTTCAAGGCAGAGGTGG + Intergenic
956696848 3:71925774-71925796 TGTTCTCTGGCGGGCAGAGTGGG - Intergenic
957049189 3:75398295-75398317 TGTTCTCTGGTGGGCAGAGTGGG - Intergenic
957317671 3:78588648-78588670 TGTTCTCTGGTGGGCAGGGGTGG + Intergenic
957394142 3:79618529-79618551 TTTTCTCTTGTGGGCAGGGGTGG - Intronic
957554362 3:81747787-81747809 TGTTCTCTGGTGGGCAGGGGCGG - Intronic
957729552 3:84115659-84115681 TGTTCTCTTGTGGGCAGGGGCGG + Intergenic
957872661 3:86108871-86108893 TGTTCTCTTGTGGGCAGGGGCGG + Intergenic
957905153 3:86543673-86543695 TTTTCTCTTATGGGCAGGGGCGG + Intergenic
958183318 3:90086533-90086555 TGTTCTCTGGCGGGCAGGGGCGG - Intergenic
958462198 3:94412900-94412922 TGTTTTCTGGTGGGCAGGGGCGG + Intergenic
958936733 3:100263180-100263202 TGTTCTCTGGCGGGCAGAGTGGG + Intronic
959287895 3:104440105-104440127 TGTTTTCTGGTGGGCAGGGGTGG + Intergenic
959288713 3:104445519-104445541 TGTTTTCTGGTGGGCAGGGGTGG + Intergenic
959581242 3:107984611-107984633 TGCTCTCTTCTGGCCAGTGAAGG - Intergenic
959970196 3:112400603-112400625 TGTTCTCTGGTGGGCAGGGGCGG + Intergenic
959972610 3:112423090-112423112 TGTTCTCTGGTGGGCAGGAGTGG + Intergenic
960309665 3:116105534-116105556 TGTTCTCTGGTGGGCAGGGGCGG + Intronic
960310510 3:116110971-116110993 GGTTCTCTGGTGGGCAGGGGCGG + Intronic
960863082 3:122171471-122171493 TGTTCTCTGGCGGGCAGGGGCGG + Intergenic
961164289 3:124752745-124752767 TGTTCTCTGGTGGGCAGGGGCGG + Intergenic
961165088 3:124757926-124757948 TGTTCTCTGGTGGGCAGGGGCGG + Intergenic
961182280 3:124886708-124886730 TGTTCCCTCCCGGGCTGAGGAGG - Intronic
961318574 3:126057046-126057068 TGTTCCCCTCCTGGCAGAGGAGG + Intronic
961363199 3:126380866-126380888 CACTCTCTTCTGGGCTGAGGAGG + Intergenic
961730243 3:128960059-128960081 TGTTCTCTGGTGGGCAGGGGTGG - Intronic
961731046 3:128965201-128965223 TGTTCTCTGGTGGGCAGGGGTGG - Intronic
961881505 3:130064776-130064798 TGTTCTCTGGTGGGCAGTGTGGG - Intergenic
962206049 3:133434785-133434807 TGTTCTCTGGTGGGCAGGAGTGG - Intronic
962581085 3:136798578-136798600 TGCTCTCTTTAGTGCAGAGGGGG + Intergenic
963058246 3:141205111-141205133 TGTTCTCTGGTGGGCAGGAGTGG - Intergenic
963252630 3:143117171-143117193 TGTTCTCTGGTGGGCAGGTGTGG + Intergenic
963319453 3:143797743-143797765 TGTTCTCTGGTGGGCAGGGGCGG - Intronic
963424678 3:145111442-145111464 TGTTCTCTGGCGGGCAGAGTTGG + Intergenic
963456229 3:145551404-145551426 TGTTCTCTGGCGGGCAGAGTTGG + Intergenic
963468288 3:145710658-145710680 TGTTCTCTGGTGGGCAGGAGTGG - Intergenic
963469068 3:145715907-145715929 TGTTCTCTGGTGGGCAGGAGTGG - Intergenic
963520171 3:146354028-146354050 TGTTCTCTGATGGGCAGGAGTGG - Intergenic
963521286 3:146362297-146362319 TGTTCTCTGGTGGGCAGAGTGGG - Intergenic
963522100 3:146367777-146367799 TGTTCTCTGGCGGGCAGAGTGGG - Intergenic
963684786 3:148419899-148419921 TGTTCTCTGGTGGGCAGGAGTGG - Intergenic
964067473 3:152597229-152597251 TGTTCTCTGGTGGGCAGGAGTGG - Intergenic
964479944 3:157130320-157130342 GGGTCTCTTCTGCCCAGAGGTGG + Intergenic
964906901 3:161727543-161727565 TGTTCTCTGGCGGGCAGAGTGGG + Intergenic
965105555 3:164347615-164347637 TGTTCTCTGGCGGGCAGAGTGGG + Intergenic
965458353 3:168931090-168931112 TGTTCTCCTGTAGGCAGGGGTGG + Intergenic
965625226 3:170678026-170678048 TGTTCTCTGGTGGGCAGGAGTGG + Intronic
965625645 3:170681932-170681954 TGTTCTCTGGCGGGCAGAAGTGG + Intronic
965713882 3:171581958-171581980 TGTTCTCTGGTGGGCAGGGGCGG - Intergenic
965931725 3:174051793-174051815 TTTTCTCTTCTGGGTGGATGGGG - Intronic
965945192 3:174232204-174232226 TGTTCTCTGGCGGGCAGAGTGGG + Intronic
966279930 3:178214460-178214482 TGTTCTCTGGTGGGCAGGAGTGG - Intergenic
966397117 3:179515479-179515501 TATTCTCTGGTGGGCAGGGGCGG + Intergenic
966397366 3:179517282-179517304 TGTTCTCTGGTAGGCAGGGGTGG - Intergenic
966398112 3:179522285-179522307 TGTTCTCTGGTGGGCAGGGGCGG - Intergenic
966398733 3:179526135-179526157 TGTTCTCTGGCGGGCAGGGGCGG + Intergenic
967051239 3:185786539-185786561 TTTTCTCTTACGGGCAGGGGCGG - Intronic
967213002 3:187185427-187185449 TGCTCTCTGGTGGGCAGGGGTGG - Intergenic
967243727 3:187466475-187466497 TGTTCTCTGGTGGGCAGAGTGGG + Intergenic
967244512 3:187471769-187471791 TGTTCTCTGGCGGGCAGAGTGGG + Intergenic
967496691 3:190150007-190150029 TGTTCTCTGGTGGGCAGGAGTGG - Intergenic
967643365 3:191895544-191895566 TGTTCTCTGGCGGGCAGAGTGGG + Intergenic
967644167 3:191900876-191900898 TGTTCTCTGGCGGGCAGAGTGGG + Intergenic
967657649 3:192071285-192071307 TGTTCTCTAGTGGGCAGGAGTGG + Intergenic
967734650 3:192939451-192939473 TGTTCTCTCCTGGGCACTGGTGG - Intergenic
967740149 3:192995859-192995881 TGTTCTCTGGCGGGCAGAGTGGG - Intergenic
967878765 3:194284421-194284443 TGTTCTCCTCTCAGTAGAGGGGG + Intergenic
967889887 3:194357433-194357455 AGTTCTTTCCTGGGCAGACGTGG + Intronic
968588913 4:1448171-1448193 TGTCCTCTTCAGGGCATAGTGGG + Intergenic
968993822 4:3932882-3932904 TGTTCTCTGGCGGGCAGAGTAGG - Intergenic
969822406 4:9730704-9730726 TGTTCTCTGGCGGGCAGAGTGGG + Intergenic
970088031 4:12369492-12369514 TGTTCTCTGGCGGGCAGAAGTGG - Intergenic
970612570 4:17739356-17739378 TTTTCTACTCTGGACAGAGGCGG - Intronic
970853535 4:20629944-20629966 TGTTCTCTGGTGGGCAGGGATGG + Intergenic
971130050 4:23798061-23798083 TGTTCTCTGGTGGGCAGGAGTGG - Intronic
971713655 4:30148971-30148993 TGTTCTCTGGCGGGCAGGGGCGG + Intergenic
971980810 4:33747627-33747649 TTTTCTCTTGTGGGCAGGGCCGG + Intergenic
973058690 4:45692005-45692027 TGTTCTCTGGTGGACAGGGGCGG - Intergenic
974172898 4:58290915-58290937 TGTTCTCTGGTGGGCAGGGGTGG + Intergenic
974923898 4:68274635-68274657 TGTTCTCTGGTGGGCAGAGGCGG + Intergenic
974935709 4:68407368-68407390 TGTTCTCTGGCGGGCAGGGGTGG + Intergenic
975361109 4:73473589-73473611 TGTTCTGAACTGGGCAGAGATGG - Intergenic
975952092 4:79786282-79786304 AGTTCTCTTCTTTGCAGATGTGG + Intergenic
976271460 4:83234709-83234731 TTTTCTCTGGTGGGCAGGGGTGG - Intergenic
976271563 4:83235640-83235662 TTTTCTCTTATGGGCAGGGGCGG - Intergenic
976695706 4:87917952-87917974 TGTTCTCTGGTGGGCAGGGGTGG - Intergenic
976719019 4:88152492-88152514 TGTTCTCTGGTGGGCAGGGGTGG + Intronic
976739392 4:88343015-88343037 TGTTGTCTTGTGGGCAGGGGTGG - Intergenic
977013302 4:91660294-91660316 TGTTCTCTGGTGGGCAGGAGTGG + Intergenic
977041657 4:92026044-92026066 TGTTCTCTGGTGGGCAGGGGTGG - Intergenic
977042428 4:92030963-92030985 TGTTCTCTGGTGGGCAGGGGTGG - Intergenic
977216696 4:94293426-94293448 TGTTCTCTGGTGGGCAGGGGTGG + Intergenic
977347639 4:95838181-95838203 TGTTCTCTTCTGGCATGAGTCGG + Intergenic
977446282 4:97137164-97137186 TGTTCTCTTATGGGCAGGGGCGG + Intergenic
977527618 4:98164055-98164077 TGTTCATTCCTGGGCATAGGCGG + Intergenic
978000655 4:103553946-103553968 TGTTCTCTGGTGGGCAGGGGCGG + Intergenic
978001461 4:103559218-103559240 TGTTCTCTGGTGGGCAGGGGCGG + Intergenic
978585711 4:110273786-110273808 TGTTCTCTGGCGGGCAGGGGTGG - Intergenic
979054944 4:115981052-115981074 TGTTCTCTGGTGGGCAGAGTGGG + Intergenic
979170798 4:117599440-117599462 TGTTCTCTGGTGGGCAGGGGTGG + Intergenic
979894705 4:126145360-126145382 TGTTCTCTGGTGGGCAGGGGCGG + Intergenic
979895454 4:126150287-126150309 GGTTCTCTGGTGGGCAGGGGTGG + Intergenic
980349276 4:131666184-131666206 TGTTCTCTGGCGGGCAGGGGTGG - Intergenic
980388574 4:132118392-132118414 TGTTCTCTGGTGGGCAGAGTGGG - Intergenic
980389383 4:132123693-132123715 TGTTCTCTGGCGGGCAGAGTGGG - Intergenic
980416212 4:132492264-132492286 TGTTCTCTGGTGGGCAGGGGCGG - Intergenic
980471939 4:133263725-133263747 TGTTCTCTGGTGGGCAGGAGTGG + Intergenic
980491616 4:133534381-133534403 TGTTCTCTTGCAGGCAGATGCGG + Intergenic
980574728 4:134670341-134670363 AGTTCCCTTCTGCTCAGAGGTGG + Intergenic
980575188 4:134678112-134678134 TGTTCTCTGGCGGGCAGAGTGGG + Intergenic
980575976 4:134683317-134683339 TGTTCTCTGGCGGGCAGAGTCGG + Intergenic
980592878 4:134914547-134914569 TGTTCTCTGGTGGGCAGGGGTGG - Intergenic
980611340 4:135167610-135167632 TGTTCTCTGGTGGGCAGGGGCGG + Intergenic
980612134 4:135172864-135172886 TGTTCTCTGGTGGGCAGGGGCGG + Intergenic
980874374 4:138646065-138646087 GGTTCTCTGCTGGGCACAGTGGG - Intergenic
980904394 4:138933356-138933378 TGTTCTCTGGTGGGCAGGAGTGG - Intergenic
981097109 4:140793183-140793205 TGTCCTGTTCTGTGCAGAGGAGG + Intergenic
981444459 4:144819605-144819627 TGTTCTAATCTGTGGAGAGGAGG - Intergenic
982015081 4:151145471-151145493 TGTTCTCTTGCGGGCAGGGGCGG - Intronic
982049211 4:151483584-151483606 TGTGCTTTTCTGGGAAGAGTAGG + Intronic
982180020 4:152741532-152741554 TGTTCTCTGGTGGGCAGGGGTGG + Intronic
982180843 4:152746884-152746906 TGTTCTCTGGTGGGCAGGGGTGG + Intronic
982657907 4:158171486-158171508 TGGTCTCCAGTGGGCAGAGGTGG + Exonic
983056041 4:163100114-163100136 TGTTCTCTTGCGGGCAGGGGCGG + Intergenic
983056598 4:163104064-163104086 TGTTCTCTTGCGGGTAGGGGTGG + Intergenic
983528725 4:168787319-168787341 TGATCTCTTGTGCTCAGAGGAGG - Intronic
983638266 4:169919989-169920011 TGTTCTCTTGCGGGCAGGGGCGG - Intergenic
983805339 4:171986282-171986304 TGTTCTCTGGCGGGCAGAGTGGG + Intronic
984021405 4:174488351-174488373 TGTTCTCTGGTGGGCAGGGGTGG - Intergenic
984099377 4:175466858-175466880 TGTTCTCTGGTGGGCAGAGTGGG + Intergenic
984321834 4:178207333-178207355 TGTTCTCTGGTGGGCAGGAGTGG - Intergenic
984436941 4:179720738-179720760 GGTTCTCTGGTGGGCAGAGTCGG - Intergenic
984437829 4:179726698-179726720 TGTTCTCTGGTGGGAAGAGTGGG - Intergenic
984620837 4:181950222-181950244 AGTTCTCTGGTGGGCAGAGTGGG - Intergenic
984700265 4:182814544-182814566 TGTTCTCTGGTGGGCAGGGGTGG - Intergenic
984700973 4:182818722-182818744 TGTTCTCTGGTGGGCAGGGGTGG - Intergenic
984707259 4:182856524-182856546 TGTTCCCTTTCGAGCAGAGGAGG - Intergenic
984858625 4:184217546-184217568 TGTCCTCTTCTGGGCAGGGAGGG - Intronic
985078487 4:186242131-186242153 TGTTCTCTGGCGGGCAGCGGTGG + Intronic
985079294 4:186247393-186247415 TGTTCTCTGGCGGGCAGGGGTGG + Intronic
985435398 4:189926104-189926126 TGTTCTCTGGTGGGCAGGAGTGG - Intergenic
985639153 5:1055447-1055469 TGACCTCTTCTGGGCAGTGCGGG - Intronic
986186803 5:5449873-5449895 TCTTGTTTTCTGGGAAGAGGAGG - Intronic
986193979 5:5520966-5520988 TGTTCTCTGGTGGGCAGGAGTGG - Intergenic
986554559 5:8998533-8998555 TGTTCTCTGGTGGGCAGGAGTGG + Intergenic
986665734 5:10102459-10102481 TGTTCTCTTGTTGGCAGGGGCGG - Intergenic
986736930 5:10674839-10674861 TGTCCTCTGCTGTGCAGAGCCGG - Intergenic
986906106 5:12494320-12494342 TGTTCTCTGGTGGGCAGGGGTGG - Intergenic
987136508 5:14904471-14904493 TTTTCTCTGATGGGCAGAGGAGG + Intergenic
987149378 5:15023364-15023386 TATTCTCCACTGGGCAGAGGAGG - Intergenic
987282453 5:16425228-16425250 TGTTCTCTGGCGGGCAGAGTGGG - Intergenic
987356296 5:17066058-17066080 TGTTCTGTGGTGGGCAGAGTGGG + Intronic
987497662 5:18669018-18669040 TGTTCTCTGGTGGGCAGGGGTGG + Intergenic
987498476 5:18674324-18674346 TGTTCTCTGGTGGGCAGGGGCGG + Intergenic
987901228 5:24014004-24014026 TTTGTTCTTCTTGGCAGAGGAGG + Intronic
989046071 5:37274934-37274956 TGTTCTCTTGCTGGCAGGGGCGG - Intergenic
989058827 5:37389796-37389818 TTGTGTCTTCTGGGCTGAGGCGG - Intronic
989487579 5:42010207-42010229 TCTTCTTTTCTGGGCAGGTGCGG + Intergenic
989511118 5:42288665-42288687 TGTTCTCTGGTGGGCAGGAGTGG + Intergenic
989661041 5:43797985-43798007 TGTTCTCTTGAGGGCAGGGGTGG - Intergenic
989687902 5:44110662-44110684 TGTTCTCTGGTGGGCAGAGGCGG + Intergenic
990367454 5:55085574-55085596 TGTTCTTTGGTGGGCAGCGGTGG - Intergenic
990985999 5:61641615-61641637 TGTCCTCTTCTGGACAAAGGCGG - Intronic
991429610 5:66530509-66530531 AGTTCTCTCCTGGGCAGACAGGG + Intergenic
991937629 5:71817514-71817536 TTTTCTTGTCAGGGCAGAGGGGG + Intergenic
992439974 5:76789364-76789386 TGTTCTCTTGCTGGCAGGGGCGG + Intergenic
992545704 5:77812124-77812146 TGTTTCCTTCCGGGCAGGGGAGG - Intronic
992787456 5:80183702-80183724 TGTTCTCTGGTGGGCAGGGGCGG - Intronic
992921675 5:81529756-81529778 TGTTCTCTTCTGGGTAATGTGGG + Intronic
992960480 5:81953465-81953487 TGTTCTTTGGTGGGCAGAGTGGG - Intergenic
992961326 5:81959037-81959059 TGTTCTCTGGTGGGCAGAGCGGG - Intergenic
993745104 5:91587478-91587500 TGTTTTCTTCTGTGTTGAGGTGG + Intergenic
993836309 5:92823976-92823998 TGTTCTCTGGTGGGCAGGGGCGG - Intergenic
993837147 5:92829507-92829529 TGTTCTCTGGTGGGCAGGGGCGG - Intergenic
994325502 5:98441139-98441161 TGTTATCTTGGGGGCAGGGGTGG - Intergenic
994532099 5:100984467-100984489 TGTTCTCTGGTGGGCAGGGGCGG + Intergenic
994532945 5:100989968-100989990 TGTTCTCTGGTGGGCAGGGGCGG + Intergenic
994776132 5:104037116-104037138 TGTTCTCTGGAGGGCAGAGTGGG - Intergenic
994903206 5:105802901-105802923 TGTTCTCTTATGGGCAGGGATGG - Intergenic
994989253 5:106978842-106978864 TGTTCTCTGGTGGGCAGGAGTGG - Intergenic
995296543 5:110531146-110531168 TGTTCTCTGGCGGGCAGAAGTGG - Intronic
995414085 5:111889864-111889886 TATTCTCTTGCGGGCAGGGGTGG + Intronic
995471087 5:112503010-112503032 TGTTCTCTTGTAGGCAGGGGTGG - Intergenic
995838467 5:116421364-116421386 TGTTCTCTACTGTGCAGTTGGGG + Intergenic
995899752 5:117051990-117052012 TGTTCTCTGGTGGGCAGGGGAGG + Intergenic
996357897 5:122617067-122617089 TGTTCTCTGGTGGGCAGGAGTGG + Intergenic
996358905 5:122624098-122624120 TGTTCTCTGGTGGGCAGGAGTGG + Intergenic
996527718 5:124497247-124497269 TGTTCTCTGGCGGGCAGAGTGGG - Intergenic
996528495 5:124502545-124502567 TGTTCTCTGGCGGGCAGAGTGGG - Intergenic
996575315 5:124972002-124972024 TGTTCTCTGGCGGGCAGGGGTGG + Intergenic
996790578 5:127289865-127289887 TGTTTTTTTGTGGGGAGAGGGGG + Intergenic
996955566 5:129179075-129179097 TGTTCATTCCTGGGCATAGGTGG - Intergenic
997193346 5:131960556-131960578 TCCTCTCTTCTGGGCCCAGGAGG + Exonic
997522797 5:134534092-134534114 TGTACTCTGCTGCGCAGAGACGG + Intronic
997754452 5:136383112-136383134 TTTTCTCTTGCGGGCAGGGGCGG - Intronic
997769393 5:136541120-136541142 TGTTCTCTGGTGGGCAGGGGTGG + Intergenic
997770158 5:136546504-136546526 TGTTCTCTGGTGGGCAGGGGCGG + Intergenic
997770880 5:136551748-136551770 TGTTCTCTGGTGGGCAGGAGTGG + Intergenic
997788629 5:136737234-136737256 TGTTCTCTGGTGGGCAGGGGTGG - Intergenic
998462703 5:142321312-142321334 TTTTCTCTACTGTGCAGATGGGG + Intronic
998512189 5:142722862-142722884 TGTACTCTTCTGGGCAGTCTTGG + Intergenic
999403776 5:151288357-151288379 AGCCCTCTTCTGGGCAGAGTGGG - Intronic
999452019 5:151685812-151685834 TGTTCCCTTTTGGGCAGACTGGG + Intronic
999618407 5:153449863-153449885 TGTTCTCTGGTGGGCAGGAGTGG + Intergenic
999619204 5:153455156-153455178 TGTTCTCTGGTGGGCAGGAGTGG + Intergenic
1000607524 5:163340399-163340421 TGTTCTCTGGCGGGCAGGGGCGG - Intergenic
1000884969 5:166740213-166740235 TGTTCTCTGGCGGGCAGGGGTGG + Intergenic
1001331836 5:170767630-170767652 TGTTCTCTGACGGGCAGAGTGGG + Intronic
1001364323 5:171121831-171121853 TGTGCCCTTCTTGGCAGGGGTGG - Intronic
1002278648 5:178118560-178118582 TGTTCCCGTCTGGGCAGTGGTGG - Intronic
1002409140 5:179060489-179060511 TGGTCTCTTCCGGGCCGGGGTGG + Exonic
1002610600 5:180415863-180415885 TGTTCTCTGGTGGGCAGGGGTGG + Intergenic
1002611323 5:180420248-180420270 TGTTCTCTGGTGGGCAGGGGTGG + Intergenic
1003100598 6:3173659-3173681 TGTTCTCTGGTGGGCAGGAGTGG - Intergenic
1003429710 6:6027980-6028002 TGTTCTCTGGTGGGCAGGGGTGG + Intergenic
1003430540 6:6033360-6033382 TGTTCTCTGGTGGGCAGGGGTGG + Intergenic
1004105854 6:12667381-12667403 TGTTCTCTGGTGGGCAGAGTGGG - Intergenic
1004106715 6:12672816-12672838 TGTTCTCTGTCGGGCAGAGTGGG - Intergenic
1004283048 6:14297116-14297138 TGTTCTCTGGTGGGCAGGAGTGG + Intergenic
1004507544 6:16259193-16259215 TGTTCTCTGGCGGGCAGAGTAGG + Intronic
1004508379 6:16264659-16264681 TGTTCTCTGGTGGGCAGAGTGGG + Intronic
1004768114 6:18754309-18754331 TGTTCTCTGGTGGGCAGGAGTGG + Intergenic
1005351062 6:24936017-24936039 TGCTTTCTTCAGGGCAGATGCGG - Exonic
1005595844 6:27378432-27378454 TGTTCTCTGGTGAGCAGGGGTGG + Intronic
1005672595 6:28122399-28122421 TTATCTCTTGTGGGCAGGGGCGG + Intergenic
1006332855 6:33404835-33404857 TGTTCTCTTCTGGGCAGAGGAGG + Exonic
1007059223 6:38921932-38921954 TGTTCTCTGGCGGGCAGGGGTGG + Intronic
1007084875 6:39136248-39136270 TTTTCTCTTACGGGCAGGGGCGG + Intergenic
1007300120 6:40861572-40861594 TGTTCTCTTGTGGGCAGGGGCGG + Intergenic
1007301095 6:40868510-40868532 TGTTCCCTTGCGGGCAGGGGTGG + Intergenic
1010068367 6:71712375-71712397 TGTTTTCTTCTGGGGGAAGGAGG - Intergenic
1010264235 6:73850332-73850354 TGTTATCTGGTGGGCAGGGGTGG + Intergenic
1010622337 6:78091764-78091786 TGTTCTCTTGCGGGCAGGGGCGG - Intergenic
1010840813 6:80647710-80647732 TCTTCTCTGGTGGGCAGGGGTGG + Intergenic
1010893968 6:81344103-81344125 TGTTTTCTGATGGGCAGGGGTGG + Intergenic
1010894944 6:81350904-81350926 TGTTTTCTGGTGGGCAGGGGCGG + Intergenic
1011354356 6:86458656-86458678 TGTTCTCTGGTGGGCAGGGGTGG - Intergenic
1011367410 6:86598426-86598448 TGTTCTCTGGTGGGCAGGAGTGG + Intergenic
1011368205 6:86603670-86603692 TGTTCTCTGGTGGGCAGGAGTGG + Intergenic
1011487908 6:87862036-87862058 TGTTCTCTGGTGGGCAGGAGTGG + Intergenic
1011550630 6:88528356-88528378 TCTCCTCTTCTGGGCAGAGTAGG - Intergenic
1011772341 6:90688593-90688615 TGTTATCTTCTGGACAAGGGAGG + Intergenic
1012066067 6:94554094-94554116 TGTTCTCTGGTGGGCAGGGGTGG + Intergenic
1012066871 6:94559336-94559358 TATTCTCTGGTGGGCAGGGGTGG + Intergenic
1012607802 6:101179782-101179804 TGTTTTCTTCTGGGGAAAGTTGG - Intergenic
1012689184 6:102292961-102292983 TGTTCTCTGGGGGGCAGGGGCGG - Intergenic
1013843246 6:114422615-114422637 TGTTCTCTGGTGGGCAGGAGTGG + Intergenic
1014396521 6:120930659-120930681 TGTTCTCTGGCGGGCAGAGTGGG - Intergenic
1014718263 6:124890641-124890663 TTTTCTCTGGTGGGCAGGGGTGG - Intergenic
1014719358 6:124897564-124897586 TTTTCTCTGGTGGGCAGGGGTGG - Intergenic
1014771510 6:125463074-125463096 TTTTCTCTTCTGGCCTTAGGTGG + Intergenic
1015164862 6:130192524-130192546 TGTTCTCTGGTGGGCAGGAGTGG - Intronic
1015266377 6:131295609-131295631 TGTTCTCTGGTGGGCAGGGGCGG - Intergenic
1015270106 6:131328939-131328961 TGTTCTCTGGTGGGCAGGAGTGG - Intergenic
1016113687 6:140257668-140257690 TGTTCTCTGACGGGCAGAGTGGG + Intergenic
1016204197 6:141453038-141453060 TGTTCTCTGGTGGGCAGGAGTGG - Intergenic
1016513583 6:144870022-144870044 TGTTCTCTGGCGGGCAGAGTGGG + Intergenic
1016518459 6:144923409-144923431 TGTTCTCTGGTGGGTAGGGGCGG - Intergenic
1016519263 6:144928659-144928681 TGTTCTCTGGTGGGCAGGGGCGG - Intergenic
1016536091 6:145108622-145108644 TGTTCTCTGGTGGGCAGGAGTGG + Intergenic
1016649841 6:146450645-146450667 TGTTCTCTGGTGGGCAGGGGCGG + Intergenic
1016650714 6:146456213-146456235 TGTTCTCTGGTGGGCAGGGGCGG + Intergenic
1016851403 6:148622876-148622898 TGTTATCATCTGAGTAGAGGTGG - Intergenic
1018077290 6:160228852-160228874 TGTTCTCTGGTGGGCAGGGGTGG - Intronic
1018495816 6:164344544-164344566 TGTTCTCTGGTGGGCAGAGTGGG + Intergenic
1018731358 6:166653526-166653548 TGTACTTTTCTGGGAAGAGAAGG - Intronic
1020316441 7:6908795-6908817 TGTTCTCTGGCGGGCAGAGTGGG - Intergenic
1020350075 7:7209927-7209949 TGTTCTCTGGCGGGCAGGGGCGG + Intronic
1020490895 7:8782910-8782932 TGTTCTCTGGTGGGCAGGAGTGG - Intergenic
1020541453 7:9463943-9463965 TGTTCTCTGGTGGGCAGGAGTGG + Intergenic
1020542090 7:9470859-9470881 TGTTCTCTGGCGGGCAGGGGTGG - Intergenic
1021172392 7:17414298-17414320 TGTTCTCTGGTGGGCAGGGGTGG - Intergenic
1021173305 7:17420569-17420591 TGTTCTCTGGCGGGCAGGGGCGG - Intergenic
1021429724 7:20546913-20546935 TGTTCTCTAGTGGGCAGGAGTGG - Intergenic
1021661118 7:22918730-22918752 TGTTCTCTTGCGGGCAGGGGTGG - Intergenic
1021810315 7:24396499-24396521 TGTTCTCTGGTGGGCAGGAGTGG - Intergenic
1021811115 7:24401798-24401820 TGTTCTCTGGTGGGCAGGAGTGG - Intergenic
1021936539 7:25637220-25637242 TGTCCACGTCTGGGCAGAGGGGG + Intergenic
1021977445 7:26024377-26024399 TGTTCTCTGGTGGGCAGGGGTGG + Intergenic
1021978213 7:26029546-26029568 TGTCCTCTGGTGGGCAGGGGTGG + Intergenic
1022427486 7:30283509-30283531 TGGTCTCTTCACGGCAGAGCAGG - Intergenic
1022709667 7:32838919-32838941 TGTTCTCTGGTGGGCAGGGGTGG + Intergenic
1022710373 7:32843276-32843298 TGTTCTCTGGTGGGCAGGGGTGG + Intergenic
1022854290 7:34300308-34300330 TGTTCTCTGGTGGGCAGGGGTGG + Intergenic
1022855056 7:34305309-34305331 TGTTCTCTGGTGGGCAGGGGTGG + Intergenic
1023842738 7:44106203-44106225 TATTCTGTTCTGGGCACAGAAGG - Intronic
1024330036 7:48146450-48146472 TGTTCTCTGGTGGGCAGGAGTGG + Intergenic
1024402499 7:48941217-48941239 TGTTCTCTTGCAGGCAGGGGCGG - Intergenic
1024415548 7:49101297-49101319 TGTTCTCTGGCGGGCAGAGTGGG - Intergenic
1024576313 7:50767521-50767543 TGCTCTGGTCTGGGCAGAGCTGG + Intronic
1024697061 7:51868463-51868485 TGTTCTCTGGTGGGCAAGGGTGG - Intergenic
1024804466 7:53121238-53121260 TGTTCTGTTATGGGCAGGAGAGG - Intergenic
1024813412 7:53239399-53239421 TGTTCTCTGGTGGGCAGGGGTGG + Intergenic
1026037568 7:66840435-66840457 TGACCTCTTAGGGGCAGAGGTGG - Intergenic
1026193783 7:68154270-68154292 TGTTTTCTTGTGGGGGGAGGGGG + Intergenic
1026201510 7:68218468-68218490 TGTTCTCTGGTGGGCAGGGGTGG + Intergenic
1027157470 7:75779113-75779135 TGTTCTCTGGCGGGCAGGGGTGG - Intronic
1027157942 7:75781737-75781759 TGTTCTCTGGCGGGCAGGGGCGG - Intronic
1027248085 7:76380428-76380450 GTTTCTCTTCTGTACAGAGGAGG + Intergenic
1027545606 7:79524187-79524209 GGTTCTCTACAGGGCTGAGGTGG + Intergenic
1027852418 7:83465185-83465207 TGTTCTCTGGTGGGCAGGAGTGG - Intronic
1028590190 7:92485019-92485041 TTTTCTCTTAGGGGCAGGGGCGG + Intergenic
1028689842 7:93640146-93640168 TGTTCTCTGGCGGGCAGAGTGGG - Intronic
1029380817 7:100213343-100213365 TGTTCTCTTCTCTGCAGGGAAGG + Intronic
1029433047 7:100544590-100544612 TGACCTCTGCTGGGCAGAGGTGG + Intronic
1029499891 7:100922476-100922498 GGTTCTCTGGTGGGCAGGGGTGG - Intergenic
1029500721 7:100927806-100927828 TGTTCTCTGGTGGGCAGGGGTGG - Intergenic
1029657215 7:101935236-101935258 TGTTCTCTGGCGGGCAGAGTGGG - Intronic
1029890532 7:103924606-103924628 TGTTCTTTGCTGGCTAGAGGAGG + Intronic
1030193152 7:106829876-106829898 TTATCTCTTATGGGCAGGGGCGG - Intergenic
1030246122 7:107386247-107386269 TGCTCTCTACTGGGCGGGGGTGG + Intronic
1030441196 7:109591987-109592009 TGTTCTCTGGTGGGCAGGAGTGG + Intergenic
1030626471 7:111850733-111850755 TGTTCTCTTGAGGGCAGGGGTGG - Intronic
1030751149 7:113234608-113234630 TGTTCTCTGGTGGGCAGGGGTGG + Intergenic
1030751850 7:113239014-113239036 TGTTCTCTGGTGGGCAGGGGTGG + Intergenic
1031005124 7:116460979-116461001 TGTTCTCTGGTGGGCAGGGGTGG - Intronic
1031364320 7:120885874-120885896 TGTCCTCTGGTGGGCAGAGTGGG + Intergenic
1031365086 7:120891158-120891180 TGTCCTCTGGTGGGCAGAGTGGG + Intergenic
1031399585 7:121315621-121315643 TGTTCTCTGGTGGGCAGGGGTGG - Intergenic
1031400444 7:121321095-121321117 TGTTCTCTGGTGGGCAGGGGTGG - Intergenic
1031727501 7:125259130-125259152 TGTTCTCTGCCGGGCAGGAGTGG - Intergenic
1031932556 7:127700876-127700898 TGTTCTCTTCTGATCAGTGATGG + Intronic
1032044623 7:128594350-128594372 TGTTCTCATGTGGAAAGAGGTGG + Intergenic
1033675489 7:143537409-143537431 TGTTCTCTGTTGGGCAGGGGCGG + Intergenic
1034017369 7:147601373-147601395 TGTTCTCTGGCGGGCAGGGGTGG + Intronic
1034281499 7:149858000-149858022 TGTTCTCCTCTGGGGTGTGGTGG + Intronic
1034400069 7:150856405-150856427 AGTTGTCTTATGGGCAGAGATGG - Intronic
1034674818 7:152884801-152884823 TGTTCTCTGGTGGGCAGGGACGG - Intergenic
1034968365 7:155404869-155404891 TCTTCTCCACTGGGCAGGGGAGG + Intergenic
1035880172 8:3238168-3238190 TGTTCTCTGGTGGGCAGGTGTGG + Intronic
1036281940 8:7407976-7407998 TGTTCTCTGGTGGGCAGGAGTGG - Intergenic
1036486512 8:9184261-9184283 TGTTCTCTGGTTGGCAGGGGTGG + Intergenic
1036549348 8:9803148-9803170 TGTTCTCTTGCAGGCAGGGGCGG - Intergenic
1038451903 8:27644980-27645002 TGTTCTGTTCTGCGAAGGGGAGG + Intronic
1038476697 8:27873546-27873568 TGTTCTCTGGTGGGGAGGGGTGG - Intronic
1038721030 8:30035470-30035492 TGTTCTCTGGTGGGCAGAAGTGG - Intergenic
1039323613 8:36461027-36461049 TGCTCTATTCTGAGCAGATGTGG + Intergenic
1039386226 8:37138126-37138148 TGTACCCTTCTGGGCAGGGCAGG + Intergenic
1039499273 8:38003873-38003895 TTATCTCTTGTGGGCAGGGGCGG + Intergenic
1039671630 8:39606855-39606877 TGTTCTCTGGCGGGCAGGGGCGG + Intronic
1040394811 8:46987155-46987177 TGTTCTCTGGTGGGCAGGGGTGG - Intergenic
1040530411 8:48261896-48261918 TGTTCTCTGGTGGGCAGAGTGGG + Intergenic
1041010354 8:53536271-53536293 TGTTCTTTGGTGGGCAGGGGAGG - Intergenic
1041048044 8:53906056-53906078 TGTTCACTTGTGGGTGGAGGAGG - Intronic
1041073497 8:54148078-54148100 TGCTCTCATCTCGGCAGAGCAGG - Intergenic
1041652124 8:60311752-60311774 TGTTCTTTGGTGGGCAGAGTGGG + Intergenic
1041957695 8:63574439-63574461 GGATCTGTTCTGGGCAGTGGAGG - Intergenic
1042705797 8:71664833-71664855 TGTTCTTTGGTGGGCAGGGGCGG - Intergenic
1042828053 8:72998129-72998151 TGTTCTCTGGTGGGCAGGAGTGG - Intergenic
1043353205 8:79386283-79386305 TGTTCTCTGGTGGGCAGGGGCGG + Intergenic
1043353985 8:79391429-79391451 TGTTCTCTGGTGGGCAGGGGTGG + Intergenic
1043596925 8:81898193-81898215 TGTTCTCTGGCGGGCAGGGGCGG + Intergenic
1043597730 8:81903743-81903765 TGTTCTCTGGCGGGCAGGGGCGG + Intergenic
1043718249 8:83510687-83510709 TGTTCTCTGGTGGGCAGGAGTGG + Intergenic
1044050745 8:87500534-87500556 TGTTCCCTTTTGAGCATAGGTGG + Intronic
1044229186 8:89756079-89756101 TTTTCTCTTGCGGGCAGGGGTGG - Intergenic
1044258161 8:90090401-90090423 TGTTCTCTGGTGGGCAGGGGCGG + Intronic
1044417442 8:91952565-91952587 TTTTCTCTGGTGGGCAGGGGTGG - Intergenic
1044458408 8:92416008-92416030 TGTTCTCATTCGGGCAGGGGCGG - Intergenic
1044587160 8:93878530-93878552 TGTTCTCTTGGGGGCAGGGACGG + Intronic
1044921611 8:97175264-97175286 TGTTCTCTGGTGGGCAGGGGCGG - Intergenic
1044922452 8:97180540-97180562 TGTTCTCTGGTGGGCAGGGGAGG - Intergenic
1045197131 8:99943926-99943948 TGTTCTCTGGTGGGCAGGGGCGG - Intergenic
1045197992 8:99949410-99949432 TGTTCTCTGGTGGGCAGGGGCGG - Intergenic
1045595092 8:103646030-103646052 TGTTCTCTGGTGGGCAGTTGTGG + Intronic
1045778748 8:105838675-105838697 TGTTCTCTGACTGGCAGAGGTGG + Intergenic
1046263802 8:111805453-111805475 TGTTCTCTGGTGGGCAGGGGCGG - Intergenic
1047190322 8:122673631-122673653 TGCCCTCTTCTGGGCACTGGTGG - Intergenic
1048097262 8:131310378-131310400 TGTTCTCTGGTGGGCAGGAGTGG - Intergenic
1048584972 8:135767366-135767388 TTTTCTCTGGTGGGCAGGGGTGG + Intergenic
1049664960 8:143838933-143838955 TGCTCTCTTCTGTTCAGAGGTGG - Exonic
1049844124 8:144791908-144791930 TGATGTCCTGTGGGCAGAGGCGG + Exonic
1049868317 8:144954084-144954106 TGTTCTCTGGTGGGCAGGAGTGG + Intergenic
1049869161 8:144959762-144959784 TGTTCTCTGGTGGGCAGGAGTGG + Intergenic
1050140198 9:2509921-2509943 TTATCTCTTTTGGGCAGAAGTGG - Intergenic
1050427315 9:5524678-5524700 TGTTTACTTCTGGGGAGGGGAGG + Intronic
1050895789 9:10885195-10885217 TGTTCTCTGCGGGGCAGGGTTGG - Intergenic
1050896567 9:10890519-10890541 TGTTCTCTGGCGGGCAGGGGTGG - Intergenic
1050908693 9:11038886-11038908 TGTTCTCTGGTGGGCAGGAGTGG - Intergenic
1051849021 9:21487461-21487483 TGTTCTCTGGTGGGCAGGAGTGG + Intergenic
1052163623 9:25293905-25293927 TGTTCTCTGGTGGGCAGGAGTGG - Intergenic
1052547782 9:29902542-29902564 TGTTCTCTGGTGGGCAGGAGTGG + Intergenic
1052661659 9:31440552-31440574 TGTTCTCTGGGGGGCAGGGGTGG - Intergenic
1053057626 9:35003506-35003528 TGTTCTCTGGCGGGCAGGGGGGG - Intergenic
1053058505 9:35009135-35009157 TGTTCTCTGGTGGGCAGGAGTGG - Intergenic
1053078006 9:35151398-35151420 TGTTCTCTTGCGGGCAGGGGTGG + Intergenic
1053078739 9:35156411-35156433 TGTCCTCTTGCGGGCAGGGGTGG + Intergenic
1053783491 9:41633891-41633913 TGTTCTCTGTTGGGCAGGGGCGG + Intergenic
1054171446 9:61844033-61844055 TGTTCTCTGGCGGGCAGGGGCGG + Intergenic
1054666088 9:67736779-67736801 TGTTCTCTGGCGGGCAGGGGCGG - Intergenic
1055347173 9:75351321-75351343 TGTTCTCTGGTGGGCAGGAGCGG + Intergenic
1056044366 9:82701739-82701761 TGTTCTCTGGTGGGCAGGGGTGG + Intergenic
1056045060 9:82706024-82706046 TGTTCTCTGGTGGGCAGGGGTGG + Intergenic
1056363432 9:85881170-85881192 TGTTCTCTTGCGGGCAGGAGCGG - Intergenic
1056437623 9:86588763-86588785 TGTTCTCTGGTGGGCAGGGGTGG + Intergenic
1056521751 9:87408246-87408268 TTTTCTCTTGCGGGCAGGGGCGG + Intergenic
1057501364 9:95599132-95599154 CTTTCCCTTCTGAGCAGAGGTGG + Intergenic
1057813399 9:98275080-98275102 TGTTCTCTGGCGGGCAGGGGCGG + Intergenic
1058612088 9:106788495-106788517 TGTTCTCTGGTGGGCAGGAGTGG - Intergenic
1059389550 9:113990196-113990218 TGATCTCTTCTGGTGAGAGTGGG + Intronic
1059545721 9:115174828-115174850 TGTTCTCTGGTGGGCAGAGTGGG + Intronic
1059546486 9:115180101-115180123 TGTTCTCTGGTGGCCAGAGTGGG + Intronic
1060257760 9:122047519-122047541 CATTCTCTTCTGGGGAGAGGGGG - Intronic
1061037670 9:128122540-128122562 GGGTCTCCTCTGGGGAGAGGGGG + Intronic
1061583425 9:131551742-131551764 TGTTCTCTGGTGGGCAGGAGTGG - Intergenic
1061681497 9:132244715-132244737 AGTCCTGTTCTGGACAGAGGTGG - Intergenic
1061872543 9:133528524-133528546 TGCCATCTGCTGGGCAGAGGAGG - Intronic
1062687830 9:137824978-137825000 TGTTCTCTTCCCGGCACTGGGGG + Intronic
1185781431 X:2850739-2850761 TGTTCTCTGGTGGGCAGGAGTGG - Intronic
1185857949 X:3553319-3553341 TGTTCTCTGGTGGGCAGGGGCGG + Intergenic
1185858930 X:3559905-3559927 TGTTCTCTGGTGGGCAGGGGCGG + Intergenic
1185862357 X:3591399-3591421 TGTTCTCTGGCGGGCAGAGGCGG - Intergenic
1185960222 X:4540651-4540673 TGTTCTCTGGTGGGCAGGTGTGG + Intergenic
1185961065 X:4546048-4546070 TGTTCTCTGGTGGGCAGGGGTGG + Intergenic
1186116293 X:6308165-6308187 TGTTCTCTGGCGGGCAGAGTGGG - Intergenic
1186195984 X:7110743-7110765 TGTTCTCTTGCGGGCAGGGGTGG + Intronic
1187099522 X:16179376-16179398 TGTTCTCTGGCGGGCAGAGTGGG + Intergenic
1188059033 X:25577540-25577562 TGTTCCCTGGTGGGCAGGGGTGG - Intergenic
1188201279 X:27294725-27294747 TTTTCTCTTGTGGGCAGGGGCGG + Intergenic
1188300594 X:28502764-28502786 TGTTCTCTTGCGGGCAGGGGCGG + Intergenic
1188301336 X:28507638-28507660 TGTTCTCTTGCAGGCAGGGGCGG + Intergenic
1188333567 X:28899979-28900001 TGACCAATTCTGGGCAGAGGAGG + Intronic
1188419200 X:29975749-29975771 TGTTCTCTGGCGGGCAGGGGTGG - Intergenic
1188420009 X:29981050-29981072 TGTTCTCTAGTGGGCAGGAGTGG - Intergenic
1188430742 X:30103816-30103838 TGTTCTCTGGCGGGCAGGGGTGG - Intergenic
1188438820 X:30194073-30194095 TGTTCTCTGGTGGGCAGGGGCGG - Intergenic
1188462907 X:30449107-30449129 TGTTCTCTGGCGGGCAGAGTGGG + Intergenic
1188463715 X:30454576-30454598 TGTTCTCTGGCGGGCAGAGTGGG + Intergenic
1188643740 X:32538393-32538415 TTTTCTCTTGTGGGCAGGGGCGG - Intronic
1188688799 X:33103528-33103550 TGTTCTCTGGTGGGCAGGAGTGG - Intronic
1189691623 X:43623343-43623365 TGTTTTCTTGGGGGCAGGGGCGG - Intergenic
1189872715 X:45401174-45401196 TGTTCTCTTGTGGGCAGGGGCGG + Intergenic
1190691863 X:52919211-52919233 TGTCCTGTTCTGGTCACAGGGGG - Intergenic
1190694120 X:52936581-52936603 TGTCCTGTTCTGGTCACAGGGGG + Intronic
1191755762 X:64590677-64590699 TGTTTTCTTCTGAGTAGAGAGGG - Intergenic
1191805282 X:65129476-65129498 TGTTCTCTGGCGGGCAGGGGCGG + Intergenic
1192706694 X:73533750-73533772 TGTTCTCTGGTGGGCAGGGGTGG - Intergenic
1192730889 X:73801634-73801656 TGTTCTCTGGCGGGCAGGGGTGG + Intergenic
1193718378 X:84958490-84958512 TGTTCTCTGGTGGGCAGGGGTGG + Intergenic
1193851088 X:86537949-86537971 TGTTCTCTGGTGGGCAGGGGCGG - Intronic
1193942069 X:87688619-87688641 TGTTCTCTTGCTGGCAGGGGTGG - Intergenic
1193942379 X:87691468-87691490 TGTTCTCTTGTGGGCAGGGGCGG - Intergenic
1193994057 X:88343585-88343607 TGTTCTCTGGTGGGCAGGAGTGG + Intergenic
1194199201 X:90934310-90934332 TGTTCTCTGGCGGGCAGGGGTGG + Intergenic
1194308080 X:92273260-92273282 TGTTCTCTGGTGGGCAGGGGCGG + Intronic
1194308880 X:92278538-92278560 TGTTCTCTGGTGGGCAGGGGCGG + Intronic
1194660345 X:96624238-96624260 TGTTCTCTGGTGGGCAGGAGTGG - Intergenic
1194661249 X:96630254-96630276 TGTTCTCTGGTGGGCAGGAGTGG - Intergenic
1194680098 X:96841926-96841948 TGTTCTCTTGTGGGCAGGGGCGG + Intronic
1195908319 X:109866249-109866271 TGTTCCCTGGTGGGCAGGGGTGG + Intergenic
1195909004 X:109870599-109870621 TGTTCTCTGGTGGGCAGGGGTGG + Intergenic
1196226651 X:113176297-113176319 TGTTCTCTGGTGGGCAGGGGTGG + Intergenic
1196226670 X:113176363-113176385 TGTTCTCTGGTGGGCAGGGGTGG + Intergenic
1196295158 X:113988629-113988651 TGTTCTCTGGTGGGCAGGGGCGG - Intergenic
1196299698 X:114040305-114040327 TGTTCTCTGATGGGCAGGAGTGG - Intergenic
1196301195 X:114051442-114051464 TGTTCTCTGGTGGGCAGGAGTGG - Intergenic
1196572956 X:117284680-117284702 TGTTCTCTGGTGGGCAGGGGTGG - Intergenic
1196773398 X:119317958-119317980 TGTTCTCTGGTGGGCAGGGGCGG + Intergenic
1196774200 X:119323215-119323237 TGTTCTCTGGTGGGCAGGGGCGG + Intergenic
1196918118 X:120560519-120560541 CTTTCTCTTCTTGGCAGAGGTGG + Exonic
1197351578 X:125389014-125389036 TGTTCTCTGGTGGGCAGGAGTGG + Intergenic
1197793742 X:130279995-130280017 TGTTCTCTGGCGGGCAGGGGCGG - Intergenic
1197932740 X:131712248-131712270 TGTTCTCTGGCGGGCAGAGTCGG - Intergenic
1197933547 X:131717568-131717590 TGTTCTCTGGCGGGCAGAGTGGG - Intergenic
1197982195 X:132228689-132228711 TGTTCATTTCTGAGGAGAGGTGG - Intergenic
1198599790 X:138270101-138270123 GGTTCTCTGGTGGGCAGAGTGGG + Intergenic
1198983248 X:142423552-142423574 TGTTCTCTGGCGGGCAGAGTGGG + Intergenic
1199256684 X:145725800-145725822 TGTTCTCTGGCGGGCAGGGGCGG - Intergenic
1199377532 X:147131847-147131869 TGTTCTCTGGTGGGCAGGGGTGG + Intergenic
1199583261 X:149382204-149382226 TGTCCTCTTCCGTGCAAAGGGGG + Intergenic
1200020492 X:153201032-153201054 TGTTCTCTCCAGGGCAAAAGAGG - Intergenic
1200545195 Y:4510728-4510750 TGTTCTCTGGCGGGCAGGGGTGG + Intergenic
1200942626 Y:8801590-8801612 TGTTCTCTGGTGGGCAGGGGTGG - Intergenic
1201233501 Y:11888659-11888681 TGTTCGCTGGTGGGCAGGGGCGG + Intergenic
1201303886 Y:12534353-12534375 TGTTCTCTTGTGGGCAGGGATGG - Intergenic
1201483388 Y:14465742-14465764 TGTTCTCTGGCGGGCAGAGGCGG - Intergenic
1201581003 Y:15512237-15512259 TGTTCTCTGGTGGGCAGGGGTGG - Intergenic
1201936091 Y:19412267-19412289 TGTTCTCTAGTGGGCAGGAGTGG - Intergenic
1201937944 Y:19427542-19427564 TGTTCTCTGTTGGGCAGGAGTGG - Intergenic
1202585400 Y:26419511-26419533 TGTTTTCTTCTGTGAAAAGGAGG + Intergenic