ID: 1006334655

View in Genome Browser
Species Human (GRCh38)
Location 6:33414339-33414361
Sequence GAATTGGGACAGTTTGCTCC TGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 149
Summary {0: 1, 1: 0, 2: 1, 3: 9, 4: 138}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1006334651_1006334655 -8 Left 1006334651 6:33414324-33414346 CCCCTTCACTTCTGAGAATTGGG 0: 1
1: 0
2: 1
3: 21
4: 206
Right 1006334655 6:33414339-33414361 GAATTGGGACAGTTTGCTCCTGG 0: 1
1: 0
2: 1
3: 9
4: 138
1006334654_1006334655 -10 Left 1006334654 6:33414326-33414348 CCTTCACTTCTGAGAATTGGGAC 0: 1
1: 0
2: 0
3: 16
4: 157
Right 1006334655 6:33414339-33414361 GAATTGGGACAGTTTGCTCCTGG 0: 1
1: 0
2: 1
3: 9
4: 138
1006334653_1006334655 -9 Left 1006334653 6:33414325-33414347 CCCTTCACTTCTGAGAATTGGGA 0: 1
1: 1
2: 1
3: 18
4: 205
Right 1006334655 6:33414339-33414361 GAATTGGGACAGTTTGCTCCTGG 0: 1
1: 0
2: 1
3: 9
4: 138
1006334649_1006334655 -5 Left 1006334649 6:33414321-33414343 CCTCCCCTTCACTTCTGAGAATT 0: 1
1: 0
2: 1
3: 29
4: 297
Right 1006334655 6:33414339-33414361 GAATTGGGACAGTTTGCTCCTGG 0: 1
1: 0
2: 1
3: 9
4: 138

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1006334655 Original CRISPR GAATTGGGACAGTTTGCTCC TGG Exonic
901946347 1:12707086-12707108 GAATTGGGACCATTTAATCCGGG - Intergenic
904833646 1:33321120-33321142 AAGCTGGGAAAGTTTGCTCCAGG - Intergenic
905300690 1:36984687-36984709 GGATTGGGACAGTTTCCGACAGG - Intronic
905400040 1:37694705-37694727 GAAATTGGACACTTTGCTCAAGG + Intronic
906940389 1:50250693-50250715 GAATAGAGACAGTTTCCTTCAGG - Intergenic
907658520 1:56370132-56370154 AAATTGGGACAGTTTCCTATGGG - Intergenic
912749124 1:112270868-112270890 GAAGAGGGACAGCTTGCCCCTGG - Intergenic
916887723 1:169086318-169086340 GAATGGGGACAGGCTGCTCCAGG + Intergenic
917311767 1:173686083-173686105 GAATTGGGACCATTTAATCCGGG - Intergenic
921095557 1:211884557-211884579 AAATTGGGTCAGTTTGTTTCTGG + Intergenic
1064373651 10:14776293-14776315 GAATTTGGACAGCTTGCACTTGG - Intergenic
1064756504 10:18576350-18576372 GAATTGGGACCATTTAATCCAGG + Intronic
1067414328 10:46092115-46092137 GACATTGGACAATTTGCTCCTGG + Intergenic
1067439307 10:46299697-46299719 GACATTGGACAATTTGCTCCTGG - Intronic
1067581560 10:47449768-47449790 GACATTGGACAATTTGCTCCTGG - Intergenic
1068559746 10:58500479-58500501 GAATTGAGACAGTGTGATACTGG + Intergenic
1069225047 10:65932679-65932701 TAATTGGGACTGTTTTGTCCTGG + Intronic
1069305049 10:66958738-66958760 AAATTAGGATAGTTTGCCCCAGG - Intronic
1069846920 10:71378573-71378595 CAAGTGGTACAGTTTGCTGCTGG - Intergenic
1070385439 10:75919833-75919855 GAAATGGTTCAGTTTGCTCTGGG + Intronic
1071910056 10:90221461-90221483 TCATGGGGACAGTTTCCTCCAGG - Intergenic
1072691076 10:97572689-97572711 GAATTGGGCCAGTGAGCTCATGG + Exonic
1073135629 10:101218548-101218570 GCATGGGGACTGCTTGCTCCCGG + Intergenic
1073669174 10:105568446-105568468 GAACAGGGAAAGTTTGCCCCTGG + Intergenic
1074608823 10:115001642-115001664 TAAGTGAGACAGTTTGCACCAGG - Intergenic
1078672535 11:13377644-13377666 GAATTTGGACAGTTTCCACAAGG - Intronic
1080515317 11:33014943-33014965 GGGTAGGGACAGTTTGCTGCCGG - Intergenic
1081700412 11:45148966-45148988 GTAGTGGGACAGTGTGCTCTTGG - Intronic
1085341123 11:75732284-75732306 GAAGTGGGAATGCTTGCTCCTGG - Intronic
1086593541 11:88544006-88544028 TTATTGGGAGAGTTGGCTCCTGG + Intronic
1087391285 11:97537875-97537897 GCAGTGGGACAGGCTGCTCCAGG - Intergenic
1087456810 11:98396848-98396870 AAATTGGGACCATTTGATCCAGG - Intergenic
1090436165 11:126688161-126688183 GAAGTGGGACAGGCTGCTCTTGG - Intronic
1091832998 12:3563457-3563479 CAATAGGGTCAGTTTGCTGCAGG + Intronic
1092430956 12:8408463-8408485 GAATTGGCACAGGTTCATCCGGG - Intergenic
1093356735 12:18176265-18176287 GAATTGGGACCATTTGATCTGGG + Intronic
1104029772 12:125056418-125056440 GATTTGGGACTCTTTGCTGCGGG - Intergenic
1107404856 13:40102846-40102868 GACATGAGACAGTTTTCTCCTGG - Intergenic
1110884121 13:80611270-80611292 GCATTGCCACAGTTTGTTCCTGG - Intergenic
1111227472 13:85293286-85293308 GAATTGGGACATTTTAAACCTGG + Intergenic
1111748143 13:92295662-92295684 GAATTGTGACAGTTTTCTGTTGG + Intronic
1112548522 13:100396325-100396347 GAATAGGGATAGTATTCTCCAGG + Intronic
1117179550 14:53178023-53178045 GAATTGGGACCATTTAATCCGGG - Intergenic
1117621722 14:57594070-57594092 GAACTGGGGCAGTTGGCTCCTGG + Exonic
1118240284 14:64049730-64049752 GCATTTGGACAATTTGCTTCAGG + Exonic
1119777531 14:77258169-77258191 GAATGGGGTCTGTGTGCTCCAGG + Exonic
1124186010 15:27530173-27530195 CAATTGGAACAGCTTGCCCCAGG - Intronic
1125690314 15:41590937-41590959 GAATTGGGACCATTTAATCCGGG + Intergenic
1127804064 15:62502478-62502500 GACCTGGGACAGATTGCTCTAGG + Intronic
1128666300 15:69540601-69540623 GAACAGGGAAAGTTTGGTCCTGG - Intergenic
1129771727 15:78207128-78207150 GAACAGGGACAGCTTGGTCCCGG - Intronic
1131384526 15:91992778-91992800 GAGTTGGGACCCTTGGCTCCTGG - Intronic
1132669684 16:1097491-1097513 CCAGTGGGACAGTGTGCTCCTGG + Intergenic
1133774754 16:8887745-8887767 GCATTGGGGCATTTTACTCCAGG - Intergenic
1136684201 16:31984470-31984492 GAAATGGGAAAGGTTGCTCTTGG - Intergenic
1136784831 16:32928022-32928044 GAAATGGGAAAGGTTGCTCTTGG - Intergenic
1136884952 16:33925784-33925806 GAAATGGGAAAGGTTGCTCTTGG + Intergenic
1138128479 16:54457760-54457782 GAATTAGGAGAGTTAACTCCAGG - Intergenic
1139002496 16:62529920-62529942 GAACTGGGATACTTTGCCCCAGG - Intergenic
1203087491 16_KI270728v1_random:1192028-1192050 GAAATGGGAAAGGTTGCTCTTGG - Intergenic
1142475200 17:184584-184606 GCAATGGGACGGTTTGCACCAGG - Intergenic
1142475214 17:184674-184696 GCACTGGGACGGTTTGCACCAGG - Intergenic
1143418231 17:6766097-6766119 GAAGTGAGAGAGTTAGCTCCTGG - Intronic
1147145138 17:38480164-38480186 GAAATGGGAAAGGTTGCTCTTGG - Intronic
1149556545 17:57577405-57577427 GAAATGGGACGGTTTGGACCAGG - Intronic
1152167256 17:78717770-78717792 GATTTAGGACAGTGTGGTCCTGG - Intronic
1156344563 18:36244830-36244852 GAATTGGGACACTTTCCTGTTGG + Intronic
1162518741 19:11166508-11166530 GACAAGGGACGGTTTGCTCCCGG + Intronic
1163018260 19:14469918-14469940 GAAGTTGGACAATTTGCTCCTGG + Exonic
1164837978 19:31370483-31370505 GGAATGGTACAGTTTGCCCCTGG - Intergenic
1166516454 19:43450724-43450746 GAGCTGGCACAGTTTGTTCCTGG - Intergenic
1167692992 19:50998444-50998466 GACTTTGTACAGTTTGCTCATGG + Intronic
925003451 2:424486-424508 GAATTGGGAGCGTTGGCCCCGGG + Intergenic
926767570 2:16335714-16335736 CTATTGGGACAGTTTGCTGTGGG - Intergenic
930246171 2:48985443-48985465 GAATTAGGACATTATTCTCCTGG + Intronic
930273034 2:49278744-49278766 GAACTGGAACAATTTGCTCTGGG + Intergenic
933281352 2:80335941-80335963 GAATTGGGAGAGTTGAGTCCTGG - Intronic
936061578 2:109298495-109298517 GATTTAGGTCACTTTGCTCCAGG + Intronic
939464554 2:142540887-142540909 AAATTGGGAGAGTCTTCTCCTGG - Intergenic
939630192 2:144520042-144520064 GTTTTTGTACAGTTTGCTCCGGG - Exonic
939636874 2:144592722-144592744 GAAAGGAGACAGTTTGCTTCGGG + Intergenic
941953982 2:171185642-171185664 GAATATGGACAGTTTGCCGCAGG - Intronic
945128462 2:206539628-206539650 GACTTTGGACAGTCAGCTCCAGG - Intronic
1168842412 20:917823-917845 GAATTGGGGCAGGCTGCTTCTGG + Intergenic
1169560874 20:6799537-6799559 GAATTGGGAAAATTTGCTCAGGG - Intergenic
1169769953 20:9189580-9189602 GGACTGAGACAGTATGCTCCTGG - Intronic
1170258357 20:14372947-14372969 GAATTTTGACAGTATGCCCCAGG - Intronic
1171353488 20:24523875-24523897 TAAATGGGACAGATTGCTGCTGG + Intronic
1171472347 20:25382256-25382278 GTAATGGGACAGTTTGGTTCCGG + Intronic
1172559919 20:35877822-35877844 GAAGTGGGACACTTTGCCACAGG + Intronic
1173848957 20:46205905-46205927 GAATGGGGAGAGTGTGCCCCAGG - Intronic
1177284885 21:19037049-19037071 GAATGGGGAAAGTTTTCACCAGG - Intergenic
1178302307 21:31463345-31463367 GAATTGACAGGGTTTGCTCCGGG - Intronic
1180680615 22:17623820-17623842 GAATTAGCGCAGTTTGCTCTAGG - Intronic
1182053133 22:27328441-27328463 GAATTGTGACAGCCTGCTCCCGG + Intergenic
1182653265 22:31869358-31869380 GAATCGGAACAGTTTGCTAAGGG + Intronic
951069031 3:18303926-18303948 GAATTCTGACAGTTTACACCAGG - Intronic
954604731 3:51900562-51900584 GAATTGGGACCATTTAATCCTGG + Intronic
958740341 3:98061722-98061744 AAATTGGGCCAGTTTGTTCTGGG + Intergenic
959369379 3:105504478-105504500 GAAGTGGGAAGGTTTTCTCCTGG + Intronic
963373376 3:144431318-144431340 GAAGTGAGACTGTTTGCTCTAGG + Intergenic
963410994 3:144927369-144927391 TAATTGCTACAGTTTGCTGCCGG - Intergenic
963588222 3:147222139-147222161 GAATTGAGAGAATATGCTCCTGG + Intergenic
977230460 4:94446370-94446392 TAATTGGGAAATTCTGCTCCAGG + Intergenic
980438803 4:132814882-132814904 GAATTGGGACCATTTAATCCGGG - Intergenic
980519640 4:133914949-133914971 TAATTTGGACAGTTTGCTCCTGG + Intergenic
983279224 4:165659541-165659563 AAATTGGGACAGTGTGGTCAAGG + Intergenic
984773149 4:183455764-183455786 GAATGGGGAGAGTGTGCTCCAGG - Intergenic
990450437 5:55927985-55928007 GAATTGGGACACTTTGGGCGTGG - Intergenic
998901176 5:146856690-146856712 TCTTTGGGAGAGTTTGCTCCAGG + Intronic
998938677 5:147257303-147257325 GAATTGGGACCATTTAATCCGGG - Intronic
999042338 5:148427906-148427928 TACATGGGACAGTCTGCTCCTGG - Intronic
999343676 5:150796052-150796074 GAATGGGGACAGGGTGCTCTTGG - Exonic
999419637 5:151429633-151429655 GAATGGGGACAGCCTGCTCAAGG + Intergenic
999761239 5:154702783-154702805 GATTTGGGACAGTTAGCTTGGGG - Intergenic
1002005515 5:176230628-176230650 GAATTGAGCCAGTTTACTCATGG - Intergenic
1002220863 5:177679991-177680013 GAATTGAGCCAGTTTACTCATGG + Intergenic
1006334655 6:33414339-33414361 GAATTGGGACAGTTTGCTCCTGG + Exonic
1006628055 6:35411404-35411426 GAAGTGGTGCAGCTTGCTCCAGG - Intronic
1008025093 6:46627158-46627180 TAATGGGGACAGTTTTCCCCAGG - Intronic
1011570376 6:88728354-88728376 GAATTGGGACCATTTAATCCGGG + Intronic
1016535117 6:145101320-145101342 GATTTTGGAAAGTTTACTCCTGG - Intergenic
1016816388 6:148306817-148306839 GAATTGGGAGAGCTTCATCCTGG + Intronic
1017565231 6:155676926-155676948 AAATGGAGACAGTCTGCTCCTGG - Intergenic
1019934454 7:4245211-4245233 GAATTGGGGAAGTTTGCACCAGG - Intronic
1022612526 7:31891197-31891219 GAACTGGAACTGATTGCTCCTGG + Intronic
1023701038 7:42892126-42892148 GAGTTGGGGCAGTGTCCTCCAGG - Intergenic
1027196581 7:76034728-76034750 GAAGAGGTACAGTTTGCTTCCGG - Intronic
1028333975 7:89628712-89628734 GAATTGGGACCATTTAATCCAGG + Intergenic
1031261558 7:119527132-119527154 GAATTGTGATAGTTTCCTCTTGG - Intergenic
1033741289 7:144277507-144277529 GAATGGGGAAAGTGTGCTCTTGG + Intergenic
1033752614 7:144372107-144372129 GAATGGGGAAAGTGTGCTCTTGG - Intronic
1035606259 8:931566-931588 GAGCTGGGACATTTGGCTCCCGG + Intergenic
1038685752 8:29716656-29716678 TAATTGGGACTGTTTGATGCTGG + Intergenic
1039778437 8:40759898-40759920 GAATTGGGAGAGTTTGTGTCTGG - Intronic
1042087883 8:65128517-65128539 GAATTGGGACCATTTAATCCAGG - Intergenic
1043979356 8:86620134-86620156 GCATTGGGACAGTTTGAGCACGG - Intronic
1048755942 8:137738214-137738236 AAATTGGGCCAGTTTCATCCTGG + Intergenic
1050035466 9:1431366-1431388 GAAGTGGGAAAGTTTGATCCTGG + Intergenic
1050535464 9:6626887-6626909 GAATTGGGCCAGTGGGTTCCTGG - Intronic
1051683348 9:19631286-19631308 GAATTGTGTCACTTTCCTCCTGG + Intronic
1052111124 9:24583333-24583355 GCATGGGGACAGTATGCTCTGGG - Intergenic
1052454746 9:28681590-28681612 GAAAAGGGACAGCTGGCTCCTGG + Intergenic
1052944763 9:34159462-34159484 GCATTGCGACAGATTGCTGCTGG + Intergenic
1054450218 9:65399742-65399764 GAATTGGGACTGTGTGCACTGGG + Intergenic
1061026460 9:128052886-128052908 GAATGGGGACTGGTTACTCCTGG + Intergenic
1188854712 X:35179247-35179269 GAGATGGGACAGTTTGCTACAGG - Intergenic
1194357196 X:92900422-92900444 GAAATGGAACAATCTGCTCCTGG - Intergenic
1201133515 Y:10973172-10973194 GGATTGTGACATTGTGCTCCAGG - Intergenic