ID: 1006335123

View in Genome Browser
Species Human (GRCh38)
Location 6:33416362-33416384
Sequence CTGGGGGCAGAGACTGAGGA GGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 1062
Summary {0: 1, 1: 0, 2: 4, 3: 105, 4: 952}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1006335123 Original CRISPR CTGGGGGCAGAGACTGAGGA GGG Exonic
900208983 1:1444279-1444301 CTGGGGGCCGTGGCTCAGGAGGG + Intergenic
900422407 1:2561254-2561276 CTGGGGCCAGAGGACGAGGAGGG - Intronic
900490545 1:2946638-2946660 CTGTGGTCAGAGGCTTAGGATGG - Intergenic
900593837 1:3471572-3471594 CTGGGGGCAGAGCTGGGGGAGGG - Intronic
900760308 1:4466092-4466114 CTGGGGGCAGAGGGTGGGCATGG + Intergenic
900809042 1:4787314-4787336 CTGGGGGCAGAGAAGGAGAGAGG + Exonic
900905371 1:5553168-5553190 TTGAAGACAGAGACTGAGGAAGG + Intergenic
900954492 1:5878118-5878140 CTGGTGCCAGAGAGTGAGGAAGG - Intronic
901325911 1:8364976-8364998 CTGGGTGCACAGGCTGAGGTAGG + Intronic
901450402 1:9333163-9333185 CTGGGAGCAGACACTGAACAGGG - Intronic
901633290 1:10658271-10658293 CTGGGGGCACAGGCTGCTGAGGG + Intronic
901804843 1:11731942-11731964 CTGGGGCCAGAGGCGGAGGGAGG - Intergenic
901878755 1:12181721-12181743 ATGGGGGCAGAAGCTGAGCATGG + Intronic
902238514 1:15073373-15073395 CATGGGGCAGAGACTGAGGGTGG + Intronic
902283012 1:15388258-15388280 CGAGGGGCAGAGGCTGGGGAGGG - Intronic
902331500 1:15733131-15733153 CTGGGGGCAGAGGCCAAGGTGGG + Intronic
902332021 1:15735378-15735400 CTGGGGGCAGAGGCCAAGGTGGG + Intergenic
902565537 1:17308778-17308800 GTGGCGGCAGAGACTGAGGTAGG + Intronic
902917358 1:19646648-19646670 CTGGGTGCAGAGGGTGTGGAGGG - Intronic
903228065 1:21904920-21904942 CTGTGGGCAGTGACCCAGGAGGG - Intronic
903261098 1:22132266-22132288 GTGGGAGCAGAGACTGAGTTGGG - Intronic
903267005 1:22163587-22163609 GTGGGGGCAGGGGCTGGGGAGGG + Intergenic
903350659 1:22714526-22714548 GTGGGGGTTGAGACTGAGAATGG + Intronic
903666657 1:25012106-25012128 CTGGGGACAGAGAATGATCAAGG - Intergenic
904011627 1:27393305-27393327 CTGGGGGCGGAGTCTAAGGCTGG + Intronic
904052692 1:27649383-27649405 CTGGTGGCAGGGTCTGCGGAAGG + Intergenic
904377235 1:30089639-30089661 CTGGGGGCTCAGAGTCAGGAGGG + Intergenic
904493416 1:30873918-30873940 CTGGGGTCAAAAACTGGGGAAGG + Intronic
904602333 1:31680561-31680583 ATGGGGGCTGAGTCAGAGGATGG - Intronic
904619521 1:31766854-31766876 CCTGGGGCAGAGACTGGGCATGG + Intergenic
904652016 1:32013271-32013293 CTGGAGGGAGAAATTGAGGAAGG - Intergenic
904745962 1:32711376-32711398 CTTGGGGCTAAGTCTGAGGATGG - Intergenic
904880011 1:33689212-33689234 CTGGGGTGGGAGAATGAGGAAGG + Intronic
905011245 1:34748302-34748324 CTGTGGGAGGAGAGTGAGGAGGG - Intronic
905262224 1:36727947-36727969 CTGGGGGCTGTGAATGAAGATGG + Intergenic
905288943 1:36908224-36908246 CTGGAAGCAGAGCCTGAGGCAGG - Intronic
905365503 1:37449054-37449076 GTGGGGGCTGAGAATGTGGAGGG - Intergenic
905499659 1:38426606-38426628 CTGGGCACAGAGACTAGGGAGGG - Intergenic
905791402 1:40791588-40791610 CCGTGGGCAGCGCCTGAGGAAGG + Intronic
905791643 1:40792664-40792686 CTGGTGGGAGAGACGGGGGACGG + Intronic
905913275 1:41668415-41668437 GTGGGAGCAGAGCCTGAGCAGGG - Intronic
906210835 1:44011411-44011433 CTGGGGGCACAGAGTGGGCAGGG + Intronic
906535355 1:46548282-46548304 CTGGTGGCAGAGACTGGGCTGGG + Intronic
906711609 1:47934441-47934463 CTGGGGGCAGAGGCTGAGTGTGG + Intronic
906744646 1:48213197-48213219 CTGGGCACAGAGACTAGGGAGGG + Intergenic
906779471 1:48559774-48559796 GAGGGGGCAGAGACTGGGAAAGG - Intronic
907293475 1:53433747-53433769 TTGGGAGCAGAGACTAGGGAGGG - Intergenic
907340406 1:53731353-53731375 CTGTTGGCTGAGACTGAGAAAGG + Intronic
907460999 1:54605376-54605398 CTTAGGGAAGAGACTGAGCACGG + Intronic
908358356 1:63344083-63344105 CTGGATGCAGAGAGGGAGGAAGG - Intergenic
910049265 1:82956849-82956871 TTGGGAACAGAGACTAAGGAGGG - Intergenic
910312039 1:85835015-85835037 ATGGGGGCAGAGACTGTGTCTGG + Intronic
911165630 1:94722180-94722202 CTGTAGGCAGAGACAAAGGAAGG + Intergenic
911381315 1:97118506-97118528 CATGGGGCAGGAACTGAGGAGGG + Intronic
911730440 1:101287177-101287199 CTGGGCTGAGAGACTGAGGCAGG + Intergenic
912371893 1:109179991-109180013 CTGGAGGCAGAGGCTGTGGTAGG + Intronic
913109712 1:115647002-115647024 CTGGGGCTAGAGAAGGAGGAGGG + Intronic
913960108 1:143332872-143332894 CTGAGAGCAGAGGGTGAGGAGGG - Intergenic
914054464 1:144158445-144158467 CTGAGAGCAGAGGGTGAGGAGGG - Intergenic
914124682 1:144807916-144807938 CTGAGAGCAGAGGGTGAGGAGGG + Intergenic
914918809 1:151834034-151834056 CTGGGGGCAAACACTCTGGAAGG + Intergenic
915030763 1:152878856-152878878 GTGGGGACAGAGACCCAGGAAGG + Intronic
915141990 1:153773574-153773596 CTGGGGGAGGAGATTGCGGAAGG - Exonic
915599609 1:156913983-156914005 CTGGGGGGAGATCCTGAGGGAGG - Exonic
915944669 1:160141154-160141176 CTGGGGGAAGTGGCTTAGGAAGG - Intronic
917664358 1:177209368-177209390 ATTAGGGCAGAGAGTGAGGATGG + Intronic
917749526 1:178041483-178041505 TTGGGAGCAGAGACTAAGGAGGG - Intergenic
917923636 1:179771195-179771217 CTGGGGGCTGAAGCTGTGGACGG - Intronic
918417724 1:184329382-184329404 ATGGGAGCAGTGATTGAGGAAGG - Intergenic
919476282 1:198036321-198036343 CTGGGCACAGAGACTAGGGAGGG - Intergenic
919691476 1:200532015-200532037 ATGGGGGAAGAGACTGGGAAGGG + Intergenic
919925246 1:202188736-202188758 CTGGGTGCAGGGACTGAGAAGGG - Intergenic
920517175 1:206593805-206593827 GTGGGGACAGAGACTGACGGTGG + Intronic
921299046 1:213732805-213732827 CTAGGGGCTGAGATTGGGGAGGG - Intergenic
921899487 1:220435310-220435332 CTGGGTGCAGAGACTGGGTGGGG + Intergenic
921946495 1:220889398-220889420 CAGGGGGCAGAGACAGGGAAGGG - Intergenic
922046274 1:221949088-221949110 TTGGGGTCAGAGGCTAAGGAGGG - Intergenic
922378610 1:224996963-224996985 GTGGGGGCAGGGTCTGAGGCTGG + Intronic
922470031 1:225870877-225870899 CTGGGGTCAGGGGCAGAGGAAGG - Intronic
922721000 1:227900315-227900337 CTGTGGGCTGACACTGAGGGAGG - Intergenic
922823416 1:228500732-228500754 CTGGGGGGAGAGAGAGAGGCAGG + Intergenic
922845576 1:228681518-228681540 TTGGGAACAGAGACTAAGGAGGG + Intergenic
923214311 1:231834405-231834427 CTGGGAACAGAGACTAGGGAGGG + Intronic
923339439 1:232995168-232995190 CGGGGGGCAGAGAAAGAGCAGGG + Intronic
923631109 1:235649940-235649962 GTGGGGGCCCAGACTGGGGAAGG + Exonic
923962669 1:239102869-239102891 CTGGGCACAGAGACTAGGGAGGG - Intergenic
924461695 1:244265491-244265513 CTGGGGGCTGCTACTGAGGAGGG + Intergenic
1062813519 10:482839-482861 CTGGGCTTAGAGACTGATGAGGG + Intronic
1063300390 10:4845137-4845159 CTCGGGCCAGCGGCTGAGGAGGG - Intronic
1064648306 10:17482599-17482621 CATGGGGCAGTGAGTGAGGAAGG + Intergenic
1065437516 10:25717933-25717955 CTGGGCACAGAGACTAGGGAGGG - Intergenic
1065610413 10:27466612-27466634 TTGGGAGCAGAGACTAGGGAGGG - Intergenic
1066394010 10:35001435-35001457 CTGGAGGCTGAGGCTGAGGCAGG + Intergenic
1066437477 10:35407447-35407469 TTGGGAGCAGAGACTAGGGAGGG + Intronic
1067064308 10:43095096-43095118 CTGGGGTCAGAGCCTGAGGGAGG + Intronic
1067101826 10:43339593-43339615 CTGGGAACAGACACTCAGGACGG + Intergenic
1067327205 10:45280975-45280997 CTGGGGGCAGGGTCGGAGGGGGG - Intergenic
1068228658 10:54140578-54140600 CTGAGGACTGAGGCTGAGGAAGG - Intronic
1068360664 10:55972707-55972729 ATGGGAACAGAGACTGGGGAGGG - Intergenic
1068588755 10:58831984-58832006 CTGGGGGCATAGTATGTGGAGGG - Intergenic
1069033163 10:63619096-63619118 CTGGGGGCAGGTGATGAGGATGG - Intronic
1069515640 10:69074659-69074681 CTGAGGCTGGAGACTGAGGATGG + Intergenic
1069557341 10:69406921-69406943 CTGGGGGCTGAGTGTGAGGACGG + Intronic
1069786131 10:70989050-70989072 GTGGGAGCAGAGGCTGAGAAGGG - Intergenic
1070806853 10:79275721-79275743 CTGGTGGTAGAGCCTGAGGCTGG - Intronic
1070911569 10:80123434-80123456 CTGGGGGAAGAGAGTGTGGGAGG + Intergenic
1071187118 10:83058646-83058668 TTGGGAGCAGAGACTAGGGAGGG - Intergenic
1071268049 10:83981899-83981921 CAGGAGGCAGAGGCTGCGGATGG - Intergenic
1071550903 10:86565453-86565475 TTGGGAGCAGAGACTAGGGAAGG + Intergenic
1072267480 10:93744476-93744498 CTGAGGGAAGAGGCTGAGGTGGG + Intergenic
1072434673 10:95404179-95404201 CTGGGGCCAGAGAATGAGGTGGG + Intronic
1072884410 10:99261111-99261133 TTGGGAGCAGAGACTAGGGAGGG - Intergenic
1073013766 10:100382157-100382179 TTGGGAGCAGAGACTAGGGAGGG - Intergenic
1073465542 10:103692845-103692867 CAGGGGCCATGGACTGAGGAGGG + Intronic
1073654606 10:105399628-105399650 CAAGGAGCAGAGACTCAGGAGGG + Intergenic
1074843370 10:117375794-117375816 CTGCGGCCAGAGACGGGGGATGG - Intergenic
1075474865 10:122725936-122725958 CTGAGGGCAGGGGCTGAGGAGGG - Intergenic
1076214245 10:128679969-128679991 CTGGAGGCAGAGAGGAAGGAAGG + Intergenic
1076352432 10:129826186-129826208 CTGAGGACAAAGACTCAGGAGGG + Intergenic
1076467770 10:130696893-130696915 CTGGGAGCTGAGACTGGGGAGGG + Intergenic
1076752130 10:132548602-132548624 CCGGGAGCAGGGACTGAGGAGGG - Intronic
1077194491 11:1272402-1272424 CTGGGGGATGAGATTGGGGAGGG - Intergenic
1077243288 11:1523199-1523221 CTGGGCTCAGAGACGGTGGATGG - Intergenic
1077295804 11:1825725-1825747 CTGGGCTCAGAGAATAAGGAAGG - Intergenic
1077304856 11:1864444-1864466 CTGAGGGCAGAGGCGGAGGGAGG + Intronic
1077351534 11:2095319-2095341 CTGGGGACAGAGGCTGGAGAGGG - Intergenic
1077405125 11:2379281-2379303 CTGGGGGCAGGGGCCGAGGGAGG + Intronic
1077679238 11:4223804-4223826 CTGGGAACAGAGACTAGGGAGGG + Intergenic
1077688672 11:4320446-4320468 CTGGGAACAGAGACTAGGGAAGG + Intergenic
1078103793 11:8345787-8345809 GTGGAGGCAGAGACCAAGGAGGG + Intergenic
1078157817 11:8813808-8813830 CTGGGGGAAGGGACAAAGGAAGG + Intronic
1078388210 11:10911736-10911758 TTGGGTGCAGGGACTGAGGCGGG + Intergenic
1078513963 11:12007841-12007863 GTGGGGGCAGAGAGGGAAGATGG - Intronic
1079188853 11:18261079-18261101 TTGGGGGCGGAGGCGGAGGATGG - Intergenic
1079689889 11:23405646-23405668 CTGGGGGCAGGGCCTGAGGCTGG + Intergenic
1079727192 11:23891372-23891394 CTGGGCACAGAGACTAGGGAGGG + Intergenic
1080028023 11:27633260-27633282 CTGGGCACAGAGACTGGGAAGGG + Intergenic
1080474986 11:32582102-32582124 CTGGGGGCAGGGATTGGGTAAGG - Intergenic
1080744551 11:35097067-35097089 CTGGGTGCAGGCCCTGAGGAGGG + Intergenic
1080930454 11:36804815-36804837 CTGGGGAAAGAGTCTGAGAAAGG + Intergenic
1080994465 11:37582239-37582261 TTGGGAGCAGAGACTAGGGAAGG + Intergenic
1081207583 11:40293326-40293348 GTGGGGGCGGGGACAGAGGAAGG - Exonic
1081401854 11:42653122-42653144 GTGGGGGCAGTGTCTGAGGTAGG - Intergenic
1081413321 11:42785238-42785260 CTGGGGGCAAAGAGTGACCAGGG + Intergenic
1081666370 11:44919191-44919213 CTGGGGGCAGAGGGAGAAGATGG - Intronic
1081743196 11:45455281-45455303 CTGGATGCAGAGCCTGAGGCAGG - Intergenic
1081854261 11:46294248-46294270 CTGGGGGCTGAGAGTGAGGTCGG + Intronic
1083300796 11:61738813-61738835 CGGGGGGCAGGGGGTGAGGAGGG - Intronic
1083319214 11:61834996-61835018 CTGGGGGCAGGCAGGGAGGAGGG - Intronic
1083534296 11:63454418-63454440 TTGGGAGCAGAGACTATGGAGGG - Intergenic
1083722140 11:64608701-64608723 CAGGGAGCAGAGAGTGAGGGAGG - Intronic
1083749186 11:64752072-64752094 CTGGAGGCAGAGACGGGGAAGGG + Intronic
1083864502 11:65446224-65446246 GAGGGGGCAGAGACTGAGGGAGG - Intergenic
1083903391 11:65654764-65654786 GTGGGGCCACAGCCTGAGGAGGG + Exonic
1083935870 11:65869894-65869916 CTGGTGGCAGCGACACAGGAAGG + Exonic
1084047047 11:66575118-66575140 CTGGGCACAGAGACTAGGGAGGG - Intergenic
1084225117 11:67710980-67711002 CGGCTGGCAGAGACAGAGGAGGG - Intergenic
1084262936 11:67990822-67990844 CGGCTGGCAGAGACAGAGGAGGG - Intergenic
1084302139 11:68258780-68258802 CTGGGGGCCGATGCTGAGGTTGG + Intergenic
1084462845 11:69305926-69305948 CTCAGGGCAGAGACAGAGGCAGG + Intronic
1084617034 11:70243307-70243329 GTGGGAGCAGAGAATGAGGAAGG + Intergenic
1084653258 11:70501203-70501225 CTGGGGCTAGAGTCTGAGGATGG - Intronic
1084694885 11:70747056-70747078 CCAGGGGAAGAGACTGAGCAGGG - Intronic
1084810457 11:71608294-71608316 CGGCTGGCAGAGACAGAGGAGGG + Intergenic
1084851431 11:71944394-71944416 CTTGGGGCAGAAATGGAGGAGGG + Intronic
1085022893 11:73220096-73220118 CTGGTGCCAGAGACAGGGGATGG - Intronic
1085408839 11:76279872-76279894 CAGGGGGCAGTGGCTGGGGAAGG + Intergenic
1085570071 11:77551428-77551450 TTGGGAGCAGAGACTAGGGAGGG - Intronic
1086061968 11:82709047-82709069 CCTGGTGCAGAGCCTGAGGAAGG - Intergenic
1086125423 11:83344291-83344313 TTGGGAACAGAGACTGGGGAGGG + Intergenic
1086401944 11:86468085-86468107 CTGTGGTCAGAGACTGAGATGGG - Intronic
1087102725 11:94380774-94380796 CTGGGGGCAGGAAGTGGGGAGGG + Intronic
1087168021 11:95023726-95023748 TTGGGAGCAGAGACTAGGGAGGG + Intergenic
1089318823 11:117611163-117611185 CTGGGGCCAGCAAGTGAGGAGGG - Intronic
1089333868 11:117709300-117709322 ATGGGGTCAGAGACTGGGGAGGG + Intronic
1089361483 11:117890846-117890868 CTGGGAACAGAGGCTGAGGTTGG - Intergenic
1089597093 11:119587333-119587355 CGGGAGGCTGAGACTGAGGTGGG + Intergenic
1089688844 11:120173508-120173530 CTGGGGGCAGTTTCTGTGGAGGG - Intronic
1089987321 11:122826148-122826170 CTGGGCACAGAGACTAGGGAGGG - Intergenic
1090265472 11:125350695-125350717 CTGGGGCTACAGTCTGAGGACGG + Intronic
1090396661 11:126423865-126423887 CTGGGGGGAGGGAGGGAGGAGGG - Exonic
1090659666 11:128872758-128872780 CTTGGAGCAGAGGCTGTGGAGGG - Intergenic
1090778542 11:129986131-129986153 GAGGGGGCAGAGGCTTAGGATGG + Intronic
1091262318 11:134244537-134244559 TGGGGGGCATACACTGAGGATGG + Intronic
1091450380 12:569091-569113 CTGGGGGCAGCCAGTGAGGTTGG + Intronic
1091835433 12:3582610-3582632 CTGGGGGCAAATTCTGAGGGGGG - Intronic
1092117381 12:6019004-6019026 CGGGGGGCAGAGTAGGAGGAGGG + Exonic
1092232370 12:6783268-6783290 CTGGGGGCAGGGTTTGAGGATGG - Intergenic
1092241216 12:6837603-6837625 CTGGGGGCAGGGCCTGAGGTTGG - Intronic
1092474376 12:8806463-8806485 CTGGGCACAGAGACTAGGGAGGG - Intergenic
1092626861 12:10337112-10337134 CTGGGCACAGAGACTAGGGAGGG + Intergenic
1092784120 12:12012431-12012453 TTGAGGGCAGAGACAGCGGAAGG - Intergenic
1092821555 12:12357579-12357601 CTAGGGTCAGGGACTGCGGACGG + Intronic
1093179878 12:15954654-15954676 CTGGGGCTTGAGAATGAGGAAGG + Intronic
1093302115 12:17471099-17471121 TTGGGAGCAGAGACTAGGGAGGG - Intergenic
1093812964 12:23510227-23510249 CTGTGAGCAGAGACTAGGGAGGG + Intergenic
1093950956 12:25164669-25164691 CTGGGAACAGAGACTAGGGAGGG - Intronic
1094080500 12:26529447-26529469 TGTGTGGCAGAGACTGAGGAAGG - Intronic
1094117992 12:26938276-26938298 CTGGGTGGAGAGACAGAGAAGGG - Exonic
1094166669 12:27450287-27450309 GTGGGGGCAGGGAGGGAGGAGGG - Intergenic
1094178210 12:27563706-27563728 CTGGGGAAAGACACTAAGGAGGG - Intronic
1094400550 12:30057492-30057514 CTGGGAACAGAGACTAGGGAGGG - Intergenic
1094480059 12:30874543-30874565 CTGGGGGCAGTGAGTGGGGTGGG - Intergenic
1094488668 12:30945105-30945127 CTGAGGGCAGAAAAGGAGGAGGG - Intronic
1095280904 12:40352049-40352071 TTGTGGGCAGAGACTGAGGCTGG - Intronic
1095436612 12:42195910-42195932 GCGGGGGCAGAGACAGAGAATGG + Intronic
1096465324 12:51845465-51845487 CAGGGGACAGAGACTGTGGGGGG - Intergenic
1096542490 12:52315810-52315832 CTGGGGACTGAGACTGAGATAGG + Intronic
1096861684 12:54533296-54533318 GTAGGGGCAGAGAGGGAGGATGG + Intronic
1097081262 12:56432841-56432863 CAGGAGGCAGAGGCTGAGGCAGG + Intronic
1097092917 12:56521823-56521845 CTGCGGGCAGAGAATGAGCTCGG - Intergenic
1097155758 12:57011191-57011213 CTGGGACCAGAGACTGAGTCTGG - Intronic
1097942181 12:65322547-65322569 CTGGAGGCTGAGGCTGAGGCAGG + Intronic
1098498093 12:71160151-71160173 GTGGGGGCAGAGGATGAGGAAGG - Intronic
1098919789 12:76292961-76292983 TTGGGAGCAGAGACTAGGGAGGG - Intergenic
1099728899 12:86472194-86472216 CTGGAGGCAGACACATAGGAAGG - Intronic
1100659498 12:96681675-96681697 CAGGAGGCAGAGGCTGAGGCAGG - Intronic
1100722513 12:97373860-97373882 CCGGGCAAAGAGACTGAGGAGGG + Intergenic
1100765947 12:97865820-97865842 CTGGGGGGATAGATTGAGGAGGG - Intergenic
1101326000 12:103716441-103716463 CATGTGGCAGAAACTGAGGAAGG - Intronic
1101958753 12:109232498-109232520 CTGGGGCCGGGGCCTGAGGAGGG - Intronic
1102123169 12:110458978-110459000 CTGGAGGCTGAGGGTGAGGAAGG - Intronic
1102225831 12:111227685-111227707 CTGGGGGCAGGGAGTGATGGAGG + Intronic
1102243349 12:111339361-111339383 CAGGGGGCTGAGGCAGAGGAGGG - Intronic
1102604304 12:114056983-114057005 TTGGGAGCAGAGACTAGGGAGGG - Intergenic
1103219816 12:119234378-119234400 CTGGAGGCAGAGAAAGAGGCCGG - Intergenic
1103487867 12:121295547-121295569 CTGGGGGCAGAGCTAGGGGAGGG + Intronic
1103963150 12:124621951-124621973 GGGGTGGAAGAGACTGAGGAAGG - Intergenic
1104275701 12:127325417-127325439 ATGATGGCAGAGCCTGAGGATGG + Intergenic
1104483924 12:129133030-129133052 CTGGGAGCAAAGACTGAGCTTGG - Intronic
1104815581 12:131643787-131643809 CTGGGGGCACAGCCTGCAGATGG + Intergenic
1104837967 12:131804152-131804174 CTGGGGGCTGTGAGTGAGAAGGG + Intergenic
1104841695 12:131828792-131828814 CTGGGTGGGGAGACTGAGGCAGG + Intronic
1104865199 12:131949680-131949702 GGCGGGGCCGAGACTGAGGAAGG - Intergenic
1104919914 12:132285322-132285344 CTGCGGACAGAGACGCAGGAGGG + Intronic
1104948463 12:132427945-132427967 ATGGGGCAAGAGACTGAGGGCGG - Intergenic
1105058939 12:133130227-133130249 CTGGAGGCAGGCACTGAGGACGG - Exonic
1105218888 13:18307432-18307454 CTGGAGGCAGAGCCTGGGGGAGG - Intergenic
1105546150 13:21352421-21352443 CTGGGAGCAGAAAGTGAGGTGGG + Intergenic
1105587275 13:21756847-21756869 CAGGGGGCAGGGAGAGAGGAAGG - Intergenic
1105603588 13:21908949-21908971 CTGTGGGCAGTGCCTGAGCACGG + Intergenic
1105926247 13:25011422-25011444 CTGGGAGCAGAGAACTAGGAAGG + Intergenic
1106038737 13:26069555-26069577 CTGGGAGCAGAGAACTAGGAAGG - Intergenic
1107161282 13:37231523-37231545 GTGGAAGCAGGGACTGAGGAGGG - Intergenic
1107727960 13:43318966-43318988 CTGGAGGGAGAGAGGGAGGAAGG + Intronic
1107758298 13:43649896-43649918 CTGGAGGGAGTAACTGAGGAGGG - Intronic
1107795814 13:44050456-44050478 CTGGGGACAGAGACTGAATGTGG + Intergenic
1107901146 13:45015729-45015751 CTGGAGGAAGAGTATGAGGAAGG + Intronic
1108954241 13:56132498-56132520 CTAGAGGCAGAGGCTGAGGGAGG + Intergenic
1109380816 13:61557665-61557687 CGGGAGGCAGAGACAGAGAATGG + Intergenic
1109499178 13:63214651-63214673 CTGGGCACAGAGACTAGGGAGGG - Intergenic
1109606329 13:64702859-64702881 CAGGAGGCAGAGGCTGAGGCAGG - Intergenic
1111362239 13:87190659-87190681 CTGGGCACAGAGACTAGGGAGGG + Intergenic
1112155551 13:96812959-96812981 CTGAGGACAGAGACTTGGGATGG + Intronic
1112434846 13:99384557-99384579 CCTGGGGCAGCAACTGAGGAAGG - Intronic
1112584495 13:100706145-100706167 CAGTGGGCAGAAACTTAGGAAGG + Intergenic
1113797290 13:113065937-113065959 GAGGGGGCGGGGACTGAGGAAGG - Intronic
1113808576 13:113123827-113123849 CAGGGGACAGAGGCTGGGGAGGG - Intronic
1113857533 13:113456203-113456225 CTGGAAGCAGAGCCTGGGGAAGG + Intronic
1113962351 13:114132836-114132858 CTGGCGGAAGAGACGAAGGAAGG + Intergenic
1113972450 13:114200302-114200324 CTGGGGACAGAGAAGGAGGCTGG - Intergenic
1114069124 14:19094339-19094361 ATGGCGGCAGTGACTCAGGAAGG - Intergenic
1114093136 14:19305664-19305686 ATGGCGGCAGTGACTCAGGAAGG + Intergenic
1114189158 14:20428125-20428147 ATGGGGGCAGAGGCCAAGGAGGG - Intergenic
1114221561 14:20702065-20702087 TTGGGAGCAGAGACTAGGGAGGG - Intergenic
1114423308 14:22602520-22602542 CTCGGGTGAGAGACTGAGGTGGG - Intronic
1114823606 14:26051339-26051361 CAGGAGGCTGAGACTGAGGCAGG + Intergenic
1115569840 14:34656048-34656070 CTGTGGCCAGAGAGTGAGGATGG + Intergenic
1115747394 14:36451566-36451588 CAGGCTGCAGAGACTCAGGAGGG - Intergenic
1116534893 14:46016587-46016609 CTGGGCACAGAGACTAGGGAGGG + Intergenic
1117628675 14:57666879-57666901 CTGGGGGCAAAGACTGTTGTAGG - Intronic
1118632829 14:67722104-67722126 GAGGGGGCAGTGACTGGGGAGGG - Intronic
1119176856 14:72574831-72574853 GTGGGCACAGAGACTGAGAAAGG + Intergenic
1119248516 14:73132849-73132871 TTGGGAGCAGAGACTAGGGAGGG + Intergenic
1119325012 14:73754683-73754705 CTGGGGCCTCAGACAGAGGAAGG + Intronic
1119560446 14:75585217-75585239 ATGGGAGCAGAGACTAGGGAGGG + Intronic
1119774589 14:77240427-77240449 CTGGGGCCAGAGCCCCAGGAAGG - Intronic
1119829381 14:77687549-77687571 GTGAGGGGAGAGAGTGAGGAAGG - Intronic
1119890071 14:78175706-78175728 CTCGGGGCAGGGACTATGGATGG + Intergenic
1120183479 14:81368809-81368831 CTGGGACTAGAGAATGAGGAGGG - Intronic
1121034310 14:90687511-90687533 CTGGGGGAAGAGGGTGAGAATGG + Intronic
1121193425 14:92048924-92048946 CTGGGAGCAGAGACTAGGGAGGG + Exonic
1121432581 14:93898380-93898402 CAGGGGGCAGAGCCAGAGGACGG + Intergenic
1121512887 14:94525802-94525824 CTGGAGGTAGAAACTCAGGATGG - Intergenic
1121553616 14:94820303-94820325 CTGGGGGTGGAGAGTGAGGAGGG - Intergenic
1121820724 14:96963929-96963951 CTGGGGGCAGAGAAAGAGAGAGG + Intergenic
1121995935 14:98602921-98602943 CTGAGGACAGTGACTGATGAAGG - Intergenic
1122507514 14:102241129-102241151 TTGGGAGCAGAGACTAGGGAGGG - Intronic
1122792680 14:104190937-104190959 CTGGGGGCAGAGGGTGGGGCTGG + Intergenic
1122804313 14:104248905-104248927 CTGCAGGCAGAGGTTGAGGAGGG - Intergenic
1123020099 14:105393924-105393946 CTGAGCGCAGAGGCTGAGGCAGG + Intronic
1123118669 14:105906944-105906966 ATGCGGGCAGAGCCTGAGCAGGG - Intergenic
1123120894 14:105916562-105916584 ATGCGGGCAGAGCCTGAGCAGGG - Intergenic
1123427467 15:20184037-20184059 CTGGGGGCAGAGCCTCTGGCAGG - Intergenic
1123476510 15:20595280-20595302 CTGGGTGCAGGGATGGAGGAAGG + Intergenic
1123536703 15:21190587-21190609 CTGGGGGCAGAGCCTCTGGCAGG - Intergenic
1123641501 15:22405084-22405106 CTGGGTGCAGGGATGGAGGAAGG - Intergenic
1123941514 15:25218867-25218889 CTGGGGGCAGGGAATGTTGATGG + Intergenic
1123991091 15:25683882-25683904 CTGGGGTCACAGACAGAGGAGGG - Intronic
1124338306 15:28873612-28873634 ATGGTAGAAGAGACTGAGGAAGG + Intergenic
1125549538 15:40535046-40535068 CTGGGGGACCAGACTGTGGAGGG + Intronic
1125592202 15:40861822-40861844 CTGGAGGCTGAGGCTGAGGCAGG - Intergenic
1125715520 15:41817745-41817767 ATGTGGGCAGAGTCTGAGGAGGG - Intronic
1125720990 15:41845087-41845109 CTGGGGGCAGAGCCAGGGCAAGG + Intronic
1125723240 15:41855172-41855194 GAGTGGGCAGAGGCTGAGGAAGG - Intronic
1125993382 15:44132388-44132410 CTGGGGACAGATAGTGATGATGG + Intronic
1126369742 15:47933241-47933263 CTGTGGGAAGAGAGTGAGTAAGG - Intergenic
1128068548 15:64779231-64779253 CTGGGGGTGGAGAGTGAGGATGG - Intergenic
1128278216 15:66372226-66372248 CTTGAGGAAGAGAGTGAGGAAGG - Intronic
1128514469 15:68333804-68333826 GTGGGGACAGAGGCTGGGGAGGG - Intronic
1129351841 15:74959743-74959765 GTGGGGCCAGAGTCAGAGGAGGG + Intronic
1129661355 15:77554722-77554744 CTGGGGGCTCAGGCTGAAGAGGG + Intergenic
1129858862 15:78844645-78844667 CTGTGGCCAGTGAATGAGGATGG - Intronic
1129906979 15:79195399-79195421 CTGTGGGCACATGCTGAGGAGGG - Intergenic
1130064145 15:80591029-80591051 TCGGGGGCAGAGGCTGAGGTTGG + Intronic
1130551919 15:84894917-84894939 CTGGGGGATGAGACAGAGGAGGG - Intronic
1130798812 15:87239292-87239314 CTGGGGGCATAGCATGAGGAGGG + Intergenic
1131553109 15:93374769-93374791 TTGGGGGCTGAGACTGGGGTAGG + Intergenic
1131684062 15:94752269-94752291 CTGGGCACAGAGACTAGGGAAGG - Intergenic
1131687052 15:94779452-94779474 TTGGATGCAGAGCCTGAGGAAGG - Intergenic
1132095961 15:98985092-98985114 CTGGACGCAGAGCTTGAGGAGGG + Intronic
1132260021 15:100415788-100415810 CGGGGGGCAGGGAGTGAGGGAGG + Intronic
1132340292 15:101074069-101074091 CTGGGAACAGAGACTAGGGAGGG - Intronic
1132482817 16:175083-175105 CTGTGGGCAGAGTCAGAAGAGGG + Intergenic
1132634035 16:934133-934155 CTGATGGCAGAGGCTAAGGAAGG + Intronic
1132752756 16:1466320-1466342 CGGGAGGCCGAGCCTGAGGAAGG - Intronic
1132826129 16:1906563-1906585 CCGGGAGCACAGACGGAGGAGGG + Intergenic
1132883909 16:2174060-2174082 CAGGCTGCAGAGACTGAGGTAGG - Intronic
1133020441 16:2964653-2964675 CTGGGGGCGGAGGCCGAGGAAGG - Intronic
1133113386 16:3562973-3562995 CAGGGGGCAGGGGCTGGGGAAGG - Intronic
1133215011 16:4286866-4286888 GTGGTGGCAGAGGCTGAGGCGGG - Intergenic
1133883801 16:9807320-9807342 GTGGGGGGAGAGAGGGAGGAAGG + Intronic
1133950416 16:10386401-10386423 CTGGGGTTAGGGACTGCGGAGGG + Intronic
1133960829 16:10492078-10492100 CTGGGGGAAGAGACAGTGGAAGG - Intergenic
1134316831 16:13126646-13126668 GTGGAGAGAGAGACTGAGGAAGG + Intronic
1134329314 16:13235859-13235881 ATGGGGGTAGAGAATGAGGGAGG + Exonic
1135025525 16:18996326-18996348 TTGGGAGCAGAGACTAGGGAGGG + Intronic
1135181842 16:20281592-20281614 CTGAGGGCAGAGAGGGAGGCAGG + Intergenic
1135530107 16:23245741-23245763 CTGGGGGAAGAGTCCCAGGATGG - Intergenic
1135544343 16:23355652-23355674 CTGGAGGCAGAGCCTGAGGCAGG + Intronic
1136097336 16:27966618-27966640 CTGGGAGGAAAGACTGAAGAGGG - Intronic
1136141754 16:28292900-28292922 GCGGGGGCCCAGACTGAGGAGGG - Exonic
1136227092 16:28866494-28866516 GAGGAGGAAGAGACTGAGGAAGG - Exonic
1136316066 16:29455249-29455271 CTGGAGGCAGGGCCTGAGGTGGG + Intronic
1136430643 16:30194591-30194613 CTGGAGGCAGGGCCTGAGGTGGG + Exonic
1136456326 16:30381829-30381851 CGGGGCGTAGAGATTGAGGAAGG - Exonic
1136529839 16:30860710-30860732 TTGGGAGCAGAGACTAGGGAGGG - Intronic
1136553957 16:30997120-30997142 CAGGGAGCAGAGACCGAGGCAGG + Intronic
1137388874 16:48064997-48065019 TTGGAGGCAGAGGCTGTGGAAGG + Intergenic
1138283890 16:55793487-55793509 CTGGTGGCAAAGACAGAGCACGG + Intergenic
1138285112 16:55803500-55803522 CTGGTGGCAAAGACAGAGCACGG - Intronic
1138756516 16:59492962-59492984 CTCGGGGCAGAGAGTGGGGAAGG + Intergenic
1139338899 16:66254218-66254240 CTGGAGGCAGAGACAGGGGGAGG + Intergenic
1139780649 16:69348687-69348709 CTGGAGGCAGAGACTGCAGTGGG - Intronic
1140472938 16:75225174-75225196 CTGGGGGCAGGTGCTGAGGATGG - Intergenic
1140880688 16:79195452-79195474 CTGTGGGCAGTTCCTGAGGAGGG + Intronic
1141238375 16:82241893-82241915 CTGGGAGTAGAGAGTGAGGTTGG + Intergenic
1141495414 16:84406423-84406445 CAGGGGCCAGAGAATGAAGAAGG - Intronic
1141780679 16:86158439-86158461 CTGGGGACACAGCATGAGGATGG + Intergenic
1142117632 16:88368256-88368278 CCACGGGCAGATACTGAGGAGGG + Intergenic
1142223511 16:88866467-88866489 CTGGGGCCAGAGGGTGGGGAAGG - Exonic
1142252876 16:89000761-89000783 GAGGGGGCACAGACAGAGGAGGG - Intergenic
1142291455 16:89195289-89195311 CTGGGGGCAGAACCTGAGTGTGG + Exonic
1142572212 17:882412-882434 GTTGGGGCAGAGACGGGGGAGGG - Intronic
1143057845 17:4175792-4175814 CTGGGAGGAGAGAGTGGGGAAGG + Intronic
1143096905 17:4483080-4483102 TGGGGGGCAGAGGCTGAGCAGGG - Intronic
1143238970 17:5427768-5427790 GTGGGGGCAGAGGCAGAGGGAGG + Intronic
1143346581 17:6253983-6254005 GTGGGAGCAGAGCCTGTGGAAGG - Intergenic
1143414506 17:6736148-6736170 TTGGGAGCAGAGACTAGGGAGGG + Intergenic
1143462624 17:7114008-7114030 CTGTGAACAGGGACTGAGGAGGG - Intronic
1143491206 17:7286189-7286211 CTGAGTGCAGTAACTGAGGATGG + Intronic
1143516267 17:7420697-7420719 CTGGGGGCTGGGACATAGGAGGG + Intronic
1143518192 17:7430357-7430379 CTGGGGGCAGAGGCTGGGACAGG - Intergenic
1144075105 17:11711205-11711227 CTGGGGGACGAGGCTCAGGATGG - Intronic
1144267637 17:13586450-13586472 CTGGAGGCAGAGTCAGAGGAGGG - Intronic
1144864296 17:18324950-18324972 CTGGAGGCAGAGGCTGTGCAGGG + Intergenic
1144892280 17:18500940-18500962 CTGCTGCCAGAAACTGAGGAAGG + Intergenic
1145080783 17:19892636-19892658 TTGGGAGCAGAGACTAGGGAGGG + Intergenic
1145139936 17:20443348-20443370 CTGCTGCCAGAAACTGAGGAAGG - Intergenic
1145958790 17:28873350-28873372 GTGGGGGTAGGGAGTGAGGAGGG - Intergenic
1145984919 17:29039208-29039230 GTGGGGACAGAGATAGAGGAGGG - Intronic
1146279768 17:31537581-31537603 CTGGGGGCAGAGACAGTGCACGG - Exonic
1146429110 17:32773871-32773893 TTGGGAGCAGAGACTAGGGAGGG - Intronic
1146481763 17:33210671-33210693 ATGGGGGCAGACAACGAGGAGGG + Intronic
1146545732 17:33736466-33736488 CTGGCGGGAGACACTGAGGCAGG - Intronic
1146619429 17:34386084-34386106 CAAGGGGCAGGGACTGAGGATGG + Intergenic
1146730989 17:35193858-35193880 CTCAAGGCAGAGAGTGAGGACGG + Exonic
1146938735 17:36828709-36828731 CTTGGGGCACAGACTTAGGTGGG - Intergenic
1146947954 17:36886528-36886550 CTGGGGGAAGAGAACAAGGAAGG + Intergenic
1147139232 17:38452237-38452259 CTGGGGGCAGAGGGAGGGGAAGG - Intronic
1147241407 17:39093177-39093199 CTGGGGGCAGGGACTGAAGTGGG - Intronic
1147616998 17:41835744-41835766 CTTGGGGCAGAGAGCTAGGAGGG + Intronic
1147703722 17:42411931-42411953 CAGTGGGCAGTGACTGGGGATGG + Intronic
1147917932 17:43899887-43899909 CTGGGGGCAGAGATGGGCGAAGG + Intronic
1147989583 17:44324667-44324689 CTGGGGGCGGAGACGGAAGCGGG - Intronic
1148018769 17:44540070-44540092 CTGGGGCCAGGGGCTGGGGAAGG + Intergenic
1148170547 17:45515933-45515955 GTGGGAGCAGAGAATGGGGAGGG - Intergenic
1148171024 17:45519926-45519948 GTGGGAGCAGAGAATGGGGAGGG - Intergenic
1148201723 17:45753826-45753848 CTGTGGGTAGGGACTGAGGTGGG + Intergenic
1148278658 17:46329879-46329901 GTGGGAGCAGAGAATGGGGAGGG + Intronic
1148300868 17:46547741-46547763 GTGGGAGCAGAGAATGGGGAGGG + Intronic
1148364996 17:47048626-47048648 GTGGGAGCAGAGAATGGGGAGGG + Intergenic
1148805037 17:50259700-50259722 CTGGGGCCACAGAGTGGGGAGGG - Intergenic
1148807989 17:50273769-50273791 ATGGGGGCAGAGGTTGAGGGAGG - Intronic
1149319404 17:55468993-55469015 TTGGGAGCAGAGACTAGGGAGGG - Intergenic
1149535702 17:57431817-57431839 CTGGGGGCAGAGAGTGAAGTGGG - Intronic
1149597018 17:57870191-57870213 CAGGGGGCACTGACTGATGAGGG + Intronic
1149695541 17:58613349-58613371 CTGGGGCAAGAGGGTGAGGAGGG + Intronic
1149914558 17:60597326-60597348 CTAGGGGGAGAGGCTGAGGCAGG - Intergenic
1149921512 17:60664911-60664933 CTGGGGAGAGAGATTGAGGCAGG - Exonic
1150556905 17:66262703-66262725 CTGGGGGCAGGGATGGAGAAGGG + Intergenic
1150620036 17:66801322-66801344 CTGGGGGCAGAGGCCAGGGATGG - Intronic
1150630620 17:66877782-66877804 CTGGGAGCAGAGTGTGGGGAAGG - Intronic
1150860608 17:68796801-68796823 TTGGGAGCAGAGACTAAGGAGGG + Intergenic
1151217943 17:72590884-72590906 GTGGGGGCAGAGGGTGGGGAAGG + Intergenic
1151321014 17:73352404-73352426 CTGGGGGCTGACACTGGGCAGGG - Intronic
1151478012 17:74354678-74354700 CTGGGGACAGAGACTGTGGAGGG - Intronic
1151537526 17:74747423-74747445 CTGAGGACAGACACTGAGGAAGG - Intergenic
1151572018 17:74931183-74931205 TTGGGAGAAGAGACTGAGGAAGG + Intronic
1151763995 17:76122692-76122714 CTGGGGGCCGCAAATGAGGAGGG + Intergenic
1151815849 17:76471079-76471101 CTGGGGGCAGAGAACAAGGGGGG - Exonic
1151868146 17:76818633-76818655 CTGATGGCAAACACTGAGGATGG - Intergenic
1152348945 17:79772501-79772523 CTGGGGACAGGGAAGGAGGAAGG + Intergenic
1152572914 17:81128346-81128368 CAGGGCCCAGAGACTGAAGAAGG + Intronic
1152680851 17:81667021-81667043 CCGCGGGCACAGACAGAGGAGGG - Intronic
1152741611 17:82020884-82020906 GTGGCGGCCGAGACTCAGGAGGG + Intronic
1153166020 18:2263023-2263045 CTGGGTACAGAGACTGAGGTGGG + Intergenic
1153786214 18:8537541-8537563 CTGGGGGCAGGGGTAGAGGAGGG - Intergenic
1154092806 18:11380886-11380908 ATGTGGGGAGAGCCTGAGGAAGG + Intergenic
1154199794 18:12291415-12291437 CAGGGGGCAGAGGCTGTGGGGGG - Intergenic
1154239778 18:12642246-12642268 CTTGGGGCAGAGTCTGTGGGTGG - Intronic
1154399551 18:14023532-14023554 CTGTGTCCAGAGACAGAGGAGGG + Intergenic
1154443502 18:14414026-14414048 TTGGAGGCAGATTCTGAGGATGG - Intergenic
1154946289 18:21165228-21165250 CTGGGGGCAGAGGTTGCAGAGGG - Intergenic
1155074378 18:22342002-22342024 CTGGAGGCATAGGCTGAGGCTGG + Intergenic
1155571434 18:27198013-27198035 CTGGAGGCAGAGAATGAGTGAGG + Intergenic
1155941428 18:31805305-31805327 CTGGGCACAGAGACTAGGGAGGG - Intergenic
1155961833 18:32001780-32001802 TTGGGAGCAGAGACTAGGGAGGG - Intergenic
1155978919 18:32160706-32160728 CTTGGGGCAGAGGCTCAGGAAGG + Intronic
1156245655 18:35295377-35295399 CTGGGGGAAAAGTATGAGGATGG - Intergenic
1157328079 18:46683518-46683540 CTGAGGGCAGAGAGGGAAGAAGG + Intronic
1157604802 18:48919379-48919401 CTGGGGGCTGAGACCCTGGAAGG - Intergenic
1158394760 18:57070809-57070831 CTGGGCACAGAGACTAGGGAGGG + Intergenic
1158576818 18:58645168-58645190 TTGGGAGCAGAGACTAGGGAGGG + Intergenic
1159548570 18:69871195-69871217 CTGGGGGCAGAGATGGCAGAGGG - Intronic
1160359051 18:78255361-78255383 CTGGGGGAAGTGCCTGAGGGAGG - Intergenic
1161033877 19:2073198-2073220 CTGAGGCTCGAGACTGAGGAAGG + Exonic
1161266093 19:3365513-3365535 CTGGGGGCTCAGACGGAGGCAGG + Intronic
1161399917 19:4062655-4062677 CTGGGGGCTGAGAGGAAGGACGG + Intronic
1161483923 19:4524790-4524812 CTGGGGGGGGAAACTGAGGCAGG - Intronic
1161503820 19:4633221-4633243 CTAGGGGTAGAGAGGGAGGAGGG + Intergenic
1161583691 19:5093979-5094001 CTGGAGGCAGAGGCTGAGATGGG + Intronic
1161711919 19:5853605-5853627 TTGGGAGCAGAGACTAGGGAGGG - Intergenic
1161741659 19:6024623-6024645 CTGGGGGCAGAAAGTGATGTAGG - Intronic
1161963520 19:7535427-7535449 CTGGGGGCAGGGCTTGAGGCAGG + Intronic
1161988383 19:7670054-7670076 CTGGAGGCAGGGAGTGAGGGTGG - Intronic
1162094852 19:8304207-8304229 CAGGGGGCGGAGCCTTAGGAAGG - Intronic
1162104827 19:8364052-8364074 CTGGGGGCAGGGCCTGTGGCCGG - Intronic
1162573217 19:11484151-11484173 GTGGGGACCGAGGCTGAGGACGG + Intronic
1162727572 19:12699314-12699336 CAGGGGGAAGAGGGTGAGGAGGG + Exonic
1163487164 19:17594924-17594946 CTGGGCACAGAGACTAGGGAGGG - Intergenic
1163685457 19:18709565-18709587 CTGGGGGCTGTGTCTGAGCAAGG + Intronic
1163822269 19:19502730-19502752 CTGGGTGCAGAGAGTGAGGGTGG - Intronic
1163826414 19:19527171-19527193 CTGGGGGAAGAGGCGGAGGGGGG - Intronic
1164004201 19:21133978-21134000 CTGGGAGCAGAGACTAGGGAGGG + Intergenic
1164080683 19:21859281-21859303 TTGGGAGCAGAGACTAGGGAGGG - Intergenic
1164258650 19:23550761-23550783 TTGGGAGCAGAGACTAGGGAGGG - Intronic
1164435841 19:28228594-28228616 CTGGAGGGAGAGGCTGTGGATGG - Intergenic
1164618590 19:29680878-29680900 CTGAGGGCAGAGGCAGAGCACGG - Intergenic
1164628867 19:29747830-29747852 CTGAGGGCAGAGATTGAGCATGG + Intergenic
1164693507 19:30227406-30227428 CTGGGGGCCGAGAAAGAGCAGGG + Intergenic
1164828650 19:31303233-31303255 CTCTGGGAAGAGACTGAAGATGG + Intronic
1164944950 19:32285649-32285671 CTGGGGGCGGAGGCGGGGGAAGG + Intergenic
1165051065 19:33142030-33142052 CTGGGGGCAGGGACTGGAAACGG + Intronic
1165148014 19:33744291-33744313 GTGGGGGCAGATTCTGAGGAAGG + Intronic
1165333516 19:35154396-35154418 CTGGGGGAGGAGAATGAAGAGGG - Intergenic
1165825762 19:38704924-38704946 CTGTGTGCAGAGATTGTGGACGG + Exonic
1165854406 19:38870986-38871008 CTGGGGGCTGGAAGTGAGGAGGG + Exonic
1166110429 19:40619413-40619435 GTTGGGGCAGACACAGAGGAAGG - Exonic
1166281403 19:41796684-41796706 CTGTGGGGAGAGGCTGAGGGGGG - Exonic
1166305845 19:41936445-41936467 CTGGGGGCTGAGTCAGAGGGAGG + Intergenic
1166375453 19:42324727-42324749 CTCGGGGCAGGGGCTGAGGGAGG - Exonic
1166698831 19:44870191-44870213 GTGGAGGCAGAGACTGAGGAGGG + Intronic
1166938174 19:46347429-46347451 CTCAGTGGAGAGACTGAGGAGGG + Intronic
1166995641 19:46718490-46718512 CCGGGGGCTGGGGCTGAGGAAGG + Intergenic
1167295316 19:48646100-48646122 CTGGAGGCCGACACTGAGGGAGG - Exonic
1167384486 19:49155918-49155940 CTGGGGGCAGGGACTGGGCTAGG + Intergenic
1167516878 19:49928846-49928868 CTGCGGGAAGAGAATGAGGCTGG + Exonic
1167587031 19:50381040-50381062 CTGAGGGCAGAGAGTGAGCGAGG - Intronic
1167643376 19:50693892-50693914 ATGGGGACAGAGACACAGGATGG + Intronic
1167793445 19:51694285-51694307 TCGGGGGCAGAGACTCAGGGAGG + Intergenic
1168116145 19:54222234-54222256 CTGAGGGCAGAGCCTGGGGCTGG + Intronic
1168119128 19:54241982-54242004 CTGAGGGCAGAGCCTGGGGCTGG + Intronic
1168121911 19:54256445-54256467 CTGAGGGCAGAGCCTGGGGCTGG + Intronic
1168125377 19:54279747-54279769 CTGAGGGCAGAGCCTGGGGCTGG + Intronic
1168132506 19:54330501-54330523 CTGAGGGCAGAGCCTGGGGCTGG + Intergenic
1168169106 19:54574604-54574626 CTGAGGGCAGAGCCTGGGGCTGG - Intronic
1168171888 19:54594974-54594996 CTGAGGGCAGAGCCTGGGGCTGG - Intronic
1168173795 19:54608397-54608419 CTGAGGGCAGAGCCTGGGGCTGG - Intronic
1168176614 19:54631809-54631831 CTGAGGGCAGAGTCTGGGGCTGG - Intronic
1168181209 19:54664060-54664082 CTGAGGGCAGAGCCTGGGGCTGG - Intronic
1168185418 19:54697086-54697108 CTGAGGGCAGAGCCTGGGGCTGG - Intronic
1168287382 19:55341369-55341391 CAGGGGGCGGAGACCGAGGCTGG + Intronic
1168341206 19:55624233-55624255 ATGGGGGCGGAGTCTGAGGACGG - Intronic
1168401696 19:56089012-56089034 CTGGGGGCGCAGACTGGGGCGGG + Exonic
1168401793 19:56089452-56089474 CCGGGGGCAGAGGATGAGGAAGG + Intronic
1168654919 19:58120207-58120229 CTGGAGTCAGATGCTGAGGAAGG - Intergenic
1202693943 1_KI270712v1_random:111123-111145 CTGAGAGCAGAGGGTGAGGAGGG - Intergenic
925031523 2:653670-653692 CTGGAAGCAGAGACTGGGGCCGG - Intergenic
925180781 2:1815685-1815707 CTGGGGGCAGGGCATGGGGAAGG - Intronic
925289960 2:2740787-2740809 CTGAGGGCAGAGGCTGATGGAGG + Intergenic
925289968 2:2740823-2740845 CTGAGGGAGGAGGCTGAGGAAGG + Intergenic
925588579 2:5487574-5487596 CTGGAGGGAGAGACTTGGGACGG + Intergenic
925637112 2:5951165-5951187 CTGGGGAGAGAGAAGGAGGAAGG - Intergenic
926275466 2:11400050-11400072 ATGGGGGCAGATCCTGAGGGGGG + Intergenic
927489361 2:23510546-23510568 CTGTGGGCAGACCCTCAGGAAGG - Intronic
927558343 2:24050969-24050991 CAGGGAGGAGAGACTGAAGATGG - Intronic
927865736 2:26586111-26586133 CCGGGGGCAGAGAGAGAGGAGGG - Intronic
927959862 2:27234406-27234428 CTGGGGGATCAGACTGAGCAGGG - Intronic
928094250 2:28394122-28394144 GGGGGGGCAGACACTGGGGAGGG - Intronic
928287861 2:30008993-30009015 CTGGGAGCAGGGGCTGAGGCTGG - Intergenic
928770061 2:34695369-34695391 TTGGGGACAGAGACTAGGGAGGG - Intergenic
929578220 2:43066033-43066055 CTGGCGGGAGAGGTTGAGGAAGG + Intergenic
929684650 2:44023246-44023268 CTGGGAGCAGAGACTCGGGCGGG + Intergenic
929779570 2:44949191-44949213 CTAGGGGCAGGGACGGAAGAGGG - Intergenic
929881506 2:45840943-45840965 CTGGGGACAGAGCCTTGGGAGGG + Intronic
930544863 2:52753810-52753832 CTGGGTGCAGGGACAGAGGATGG + Intergenic
930710141 2:54543107-54543129 CTCGGGGCTGATGCTGAGGAAGG + Intronic
931034099 2:58216988-58217010 TTGGCAGCAGAGACTAAGGAGGG + Intronic
931195518 2:60048900-60048922 ATGTGGGCAGAGAATGAGTATGG - Intergenic
931470377 2:62533333-62533355 TTGGGGGCTGAGGCTGAGGTGGG - Intergenic
931573800 2:63698529-63698551 CTGTTGGCACAGACTGAGGCTGG + Intronic
931609047 2:64079383-64079405 CTGGGCACAGAGACTAGGGAGGG + Intergenic
931657809 2:64525289-64525311 CTTGGGGCAGAGGCAGAGTATGG + Intronic
931917732 2:66977393-66977415 CCAGAGGCAGAGTCTGAGGAAGG - Intergenic
932178600 2:69624888-69624910 TGTGGGGCAGAGACTGAGAAGGG + Intronic
932437060 2:71708081-71708103 ATAGGGGCAGAGACTGGGGCAGG + Intergenic
932498512 2:72159805-72159827 GTGGTGGCAGGGACTGGGGAGGG + Intergenic
933137818 2:78759397-78759419 TTGGGAGCAGAGACTAGGGAGGG - Intergenic
933294240 2:80471533-80471555 CAGGGAGCAGGGACTGAGGAAGG + Intronic
933794430 2:85908171-85908193 CTGGGGGTAGAAACGGTGGAGGG - Intergenic
933952618 2:87343452-87343474 CTGAGAGCAGAGGGTGAGGAGGG + Intergenic
934058149 2:88269802-88269824 CTGGAGGCAGTGCCTGTGGAGGG + Intergenic
934236863 2:90239798-90239820 CTGAGAGCAGAGGGTGAGGAGGG + Intergenic
934557374 2:95294586-95294608 CTGTGGGGAGAAACTGAGGCTGG - Intergenic
935679076 2:105620455-105620477 CTGGGGGCAGAGCTTGTGGCAGG - Intergenic
936461142 2:112714494-112714516 CTGGGGTCAGAGAATGAGTCAGG - Intergenic
936870677 2:117131815-117131837 TTGGGAGCAGAGACTAGGGAGGG - Intergenic
937145423 2:119640257-119640279 CTGGATACAGAGACTGCGGAAGG - Intronic
937316316 2:120934014-120934036 CTGGGGCCAGGGCCTGAGAATGG - Intronic
937340798 2:121089191-121089213 GGTGGGGCAGAGACTGGGGAAGG + Intergenic
937394082 2:121519385-121519407 CTGGAGGCAGGGACAGAAGAGGG + Intronic
937985587 2:127636771-127636793 CTGGGGGCAGAGAGGGTGGGTGG - Intronic
938320035 2:130356374-130356396 CGGGGGGCAGAGAGTGAAGACGG - Intronic
938710651 2:133973672-133973694 CTGTTGGGAGACACTGAGGAAGG - Intergenic
938775277 2:134536356-134536378 CCGGTGGCAGTGACTGAGGTTGG + Intronic
938847140 2:135221376-135221398 CTGGTGGCAGAGCCTGAATACGG + Intronic
939083260 2:137687151-137687173 CTGGGCACAGAGACTAGGGAGGG + Intergenic
939100628 2:137891045-137891067 TTGGAGGCAGATTCTGAGGATGG + Intergenic
939403784 2:141730180-141730202 ATGGTGGCTGAGACTGAGGCTGG - Intronic
939461080 2:142495559-142495581 GTGGGGGCTGGGACTGAAGAAGG - Intergenic
940216695 2:151310333-151310355 TTGGGAGCAGAGACTAGGGAGGG - Intergenic
940726550 2:157342320-157342342 TTGGGAGCAGAGACTAGGGAGGG + Intergenic
940843276 2:158609850-158609872 CTGGGGGCAGAAGTTAAGGAGGG + Intronic
940981350 2:160007334-160007356 CTGGGGGCAGAGGCTGGGGGTGG - Intronic
940997444 2:160164999-160165021 CTGGGAACAAAGACTGAGGAGGG - Intronic
941221026 2:162781511-162781533 CTAGTGGAAGAGAATGAGGAAGG + Intronic
941347701 2:164390405-164390427 GTGGGGCGAGAGATTGAGGAAGG - Intergenic
942844630 2:180408348-180408370 CTGGGGGCGGGGAATGAGGGTGG - Intergenic
943053173 2:182941538-182941560 CTGGGGCCAGAGACTGGGGTAGG + Intronic
944628561 2:201598204-201598226 CTGGAGGCTGAGGCAGAGGATGG - Intronic
944976765 2:205062420-205062442 CGGGGAGCAGGAACTGAGGAGGG - Intronic
945290688 2:208124398-208124420 CGGGGGCCAGAGACTGGGGCAGG - Intronic
945312073 2:208325562-208325584 CACAGGGCAGAGACTCAGGAGGG - Exonic
946215148 2:218178196-218178218 CTGGGGACAGAGACTAGGAAGGG + Intergenic
946659135 2:221980491-221980513 ATGGGGGCAGGGAATGAAGATGG + Intergenic
946886378 2:224226817-224226839 CTGGGCACAGAGACTAGGGAGGG - Intergenic
947521560 2:230849893-230849915 GTAGGGGCAGAGAGTGAGGGGGG + Intergenic
947633005 2:231665843-231665865 TGGAGGTCAGAGACTGAGGACGG - Intergenic
947643830 2:231723051-231723073 CTGGGAGGAGAGACTGAGGTAGG + Intergenic
947748530 2:232521524-232521546 TTGGGGGCAGAGACTGTGTTGGG + Intronic
947750341 2:232528798-232528820 CTGGGGCCACAGAGTGGGGAAGG - Intronic
948723728 2:239919337-239919359 GGAGGGGCAGAGAGTGAGGAGGG - Intronic
948768129 2:240233743-240233765 CTGTGGGCAGGGTCGGAGGAGGG - Intergenic
948768148 2:240233798-240233820 CTGTGGGCAGGGCCGGAGGAGGG - Intergenic
1168837259 20:885457-885479 CTGTAGGCACAGATTGAGGAGGG + Intronic
1168839152 20:898042-898064 TTGGGAGCAGAGACTAGGGAGGG - Intronic
1169021726 20:2335542-2335564 CTGGGGGCATCAGCTGAGGAGGG + Intronic
1169066286 20:2695879-2695901 CTGTGGGGTGAGGCTGAGGAAGG - Intronic
1169912109 20:10655411-10655433 CTGGGGGCAGTGATTGCTGATGG + Intronic
1170680558 20:18521817-18521839 TTGGGAGCAGAGACTAGGGAGGG + Intronic
1170694691 20:18647732-18647754 CAGTGGGCAGCCACTGAGGAGGG + Intronic
1171146469 20:22788186-22788208 CTGCTGGGAGAGACTGAGGCTGG - Intergenic
1171247697 20:23625912-23625934 CTGGGGGCACAGAATGAGGCTGG - Intergenic
1171252957 20:23663298-23663320 GCATGGGCAGAGACTGAGGAAGG - Intergenic
1171311841 20:24150989-24151011 CTGGAGGCAGAGTTTGAGGCTGG - Intergenic
1171333698 20:24363546-24363568 TTCGGGACAGAGAATGAGGATGG + Intergenic
1171364073 20:24611651-24611673 CTCCAGGCAGAGGCTGAGGAGGG - Intronic
1171481320 20:25457960-25457982 CTCGGAGCACAGACTGTGGAGGG - Intronic
1171846976 20:30283292-30283314 CTGGGGGCTGGGACTGGGGCTGG + Intergenic
1172227776 20:33316734-33316756 CTGGGGGCAGAGGCAAGGGAAGG + Intergenic
1172353139 20:34259636-34259658 CTGGGGCAGGAGACTGAGGCAGG + Intronic
1172719663 20:36990010-36990032 GTGGGGGCAGAGGCCTAGGAGGG + Intergenic
1172902656 20:38346413-38346435 CTGGGGGCAGTTCCTGAGGCTGG - Exonic
1173850242 20:46213228-46213250 CTGCTGGCAGAGGCTGGGGAAGG - Intronic
1173872524 20:46350891-46350913 CTGGGGGCAGAGAAGCAGGAGGG + Intronic
1173929586 20:46807569-46807591 CTGGGGGAAGGGACAGAGGAAGG + Intergenic
1173972553 20:47163974-47163996 CTGCTGGCAGAGACGGTGGAAGG - Intronic
1174388731 20:50203744-50203766 GTGGGGCCAGAGACTGAACAGGG - Intergenic
1174524501 20:51160356-51160378 CTGGGGGCTGAGTCTGAGGTTGG + Intergenic
1174737455 20:52978232-52978254 GTGGGGGCACAGACTGAGCCTGG + Intronic
1174992740 20:55530091-55530113 CTGGGGGCAGGGAGTGGGCAAGG + Intergenic
1175502452 20:59460156-59460178 CAGGGAGAAGAGACTGAGGTTGG + Intergenic
1175536514 20:59718420-59718442 CTGGGGTCAGAGACCTTGGAGGG - Intronic
1176078970 20:63262262-63262284 GGAGGGGCAGAGACTGGGGAGGG - Intronic
1176103268 20:63374172-63374194 CTGGGGCCAGTCACTGAGGGTGG - Intronic
1176367757 21:6044122-6044144 CTGTGGGCGGAGACGGGGGAGGG - Intergenic
1176374426 21:6080128-6080150 CCAGGGGCAGAGGCTGAGAAGGG + Intergenic
1176452586 21:6877212-6877234 TTGGAGGCAGATTCTGAGGATGG + Intergenic
1176830759 21:13742261-13742283 TTGGAGGCAGATTCTGAGGATGG + Intergenic
1177063137 21:16397565-16397587 CTGGGAGCAGAGACTAGGGAGGG + Intergenic
1177185239 21:17786415-17786437 GGTGGGGCAGAGACTGAGGTGGG - Intergenic
1177840856 21:26232227-26232249 TTGGGAACAGAGACTAAGGAGGG + Intergenic
1178582552 21:33848742-33848764 CTGGGGGCAGGTGCAGAGGAGGG - Intronic
1178670876 21:34590685-34590707 CTGGGGCCAGGGACTGAGAAAGG + Intronic
1178944708 21:36937166-36937188 CTGGGGACAGTGACAGGGGAGGG - Exonic
1179388305 21:40963141-40963163 AAGGAGGAAGAGACTGAGGAAGG + Intergenic
1179415516 21:41195286-41195308 CAGGTGGTAGAGACTAAGGAGGG + Intronic
1179515547 21:41903892-41903914 CCAGGGGAAGAAACTGAGGAAGG + Intronic
1179632924 21:42689659-42689681 CTGGGGCCAGAGAATTAGAAGGG - Intronic
1179709480 21:43204849-43204871 GTGGGGGGAGACACTGAGAAGGG - Intergenic
1179727295 21:43347633-43347655 CTGGGGGCCGGCACTGTGGACGG - Intergenic
1179749050 21:43458117-43458139 CCAGGGGCAGAGGCTGAGAAGGG - Intergenic
1179755762 21:43494420-43494442 CTGTGGGCGGAGACGGGGGAGGG + Intergenic
1179825919 21:43966450-43966472 CTGTGGGCAGAGGCAGTGGACGG - Intronic
1179957344 21:44749019-44749041 GTGGGGGCAGTGGATGAGGAGGG + Intergenic
1179960613 21:44765325-44765347 CTGTGGGCAGAGGCTGACGTGGG - Intergenic
1180185143 21:46135712-46135734 CTGGGAGGGGAGACTGGGGAGGG - Intergenic
1180487598 22:15816902-15816924 ATGGCGGCAGTGACTCAGGAAGG - Intergenic
1180575096 22:16766193-16766215 CTGGGAGAAGAGATTAAGGAAGG + Intergenic
1180631556 22:17233619-17233641 CAGGGAGCAGAGGCTGAGAAGGG - Intergenic
1180785887 22:18547564-18547586 CTGTGGGCAGTGAGGGAGGAGGG - Intergenic
1180894352 22:19317742-19317764 CTGGGGGCAGTGGCTCAGGCCGG - Intergenic
1181131173 22:20733289-20733311 CTGTGGGCAGTGAGGGAGGAGGG - Intronic
1181242812 22:21487118-21487140 CTGTGGGCAGTGAGGGAGGAGGG - Intergenic
1181455721 22:23059166-23059188 CTGGGGGCAGGGACTTGGGCTGG - Intergenic
1181893345 22:26084309-26084331 CTCGAGGGAGAGACTGAGGCTGG + Intergenic
1181960736 22:26619860-26619882 GTGGGGGCAGAGAAGGGGGATGG + Intergenic
1182064849 22:27423388-27423410 GTGGGGGCAGGGAGTGAGTAGGG + Intergenic
1182414078 22:30209883-30209905 CTGATGGAAAAGACTGAGGATGG + Intergenic
1182476031 22:30576802-30576824 CTGGGAGCAGAGAATCAGGCTGG + Exonic
1182737619 22:32542088-32542110 ATGGGGGAACAGACTGTGGAGGG + Intronic
1183197486 22:36363442-36363464 CTGGAGGGAGAGACAGAGGGAGG + Intronic
1183249479 22:36719784-36719806 TTGGGAGGAGAGAATGAGGACGG + Intergenic
1183358345 22:37371167-37371189 CTGGGGGCAGGGGGTGAGGGAGG - Exonic
1183749921 22:39714023-39714045 CTTGGGGCAGGGGCTGAGGGAGG + Intergenic
1183752571 22:39730027-39730049 TTGGGGGCAGAGGCGGGGGACGG - Intergenic
1184088977 22:42282677-42282699 CTGGGGGCAGAGACCTGGGAGGG + Intronic
1184115094 22:42417614-42417636 GTTGGGGCAGAGAGTGAGGAGGG + Intronic
1184257335 22:43294737-43294759 CACGGGGCAGAGAAGGAGGAGGG - Intronic
1184380816 22:44143878-44143900 GAGGGGGAAGAGAGTGAGGAAGG - Intronic
1184486119 22:44780707-44780729 GTGAGGGCAGGGCCTGAGGATGG - Intronic
1184516269 22:44964764-44964786 CTTGGGCCCGAGACTGGGGATGG - Intronic
1184666214 22:45990430-45990452 TTGGGGGCAGAGTCTGGAGACGG + Intergenic
1184783193 22:46659246-46659268 CTGAGGGTGGAGACTGAGGGGGG - Intronic
1185094963 22:48801060-48801082 GTTGGGCCAGGGACTGAGGAGGG + Intronic
1185161557 22:49232929-49232951 CTGGGGGCACAGGCTGGGGCAGG + Intergenic
1185163671 22:49244638-49244660 CTGGGGGCAGTGACTGGAGCAGG + Intergenic
1185367618 22:50444095-50444117 CTGGGGACAGTGACAAAGGACGG + Exonic
1185402300 22:50625452-50625474 CTGTGGGCAGAGCCTGGGGAGGG + Exonic
949162217 3:894856-894878 CTGGGTACAGAGACTAGGGAGGG + Intergenic
950146864 3:10656295-10656317 ATGGGGTCAGGGACTGAGCATGG + Intronic
950152115 3:10695978-10696000 CTGGGGGCTGGGATTGAGGTGGG - Intronic
950866074 3:16190305-16190327 CTGGAGGGGGAGCCTGAGGATGG - Intronic
951425873 3:22544581-22544603 CTGGGTGCAGAGACTGGGTGGGG - Intergenic
951521373 3:23613878-23613900 CTGGGAGAAGATACTGATGATGG - Intergenic
951894752 3:27600238-27600260 CTGGGAGCAGAGACTAGGGAGGG - Intergenic
952663574 3:35878534-35878556 CTGGGCACAGAGACTAGGGAGGG + Intergenic
953027314 3:39152718-39152740 CGGGGAGGAGAAACTGAGGAAGG + Intronic
953077251 3:39581980-39582002 CTGGGCACAGAGACTAGGGAGGG + Intergenic
953479952 3:43242856-43242878 ATGGGGGCAGAAACTCAGAAGGG + Intergenic
953927258 3:46988775-46988797 CTGAGGGCAGGGACAGAGCAGGG + Intronic
954288858 3:49638402-49638424 ATGGAGGAAGAGACTGAGGTTGG + Intronic
954413956 3:50383817-50383839 TTGGGGGCAGGGAATGGGGAAGG + Intronic
954438642 3:50509544-50509566 CTGGGAGCAGGTACAGAGGACGG - Intergenic
954536362 3:51362161-51362183 CTGGGAACCGAGACTTAGGATGG - Intronic
954710167 3:52501615-52501637 CTGGGGGCAGAGGGTGGGCAGGG - Intronic
954711154 3:52505704-52505726 CTTGGGGCAAAGACTGTGAAGGG - Exonic
954821274 3:53330450-53330472 CTCAGGGCAGTGGCTGAGGATGG + Intronic
954854142 3:53627905-53627927 CAGGAGGCAGAGGCTGAGGTAGG + Intronic
954963859 3:54592616-54592638 GTAGGGGAAGAGAGTGAGGAAGG + Intronic
955003543 3:54949065-54949087 CTGGGGGCACTGGATGAGGAAGG - Intronic
957078374 3:75618765-75618787 CGGCTGGCAGAGACAGAGGAGGG - Intergenic
957728979 3:84107228-84107250 CTGAGGCCGGAGACTGAGGCAGG + Intergenic
957904977 3:86542637-86542659 TTGGGGACAGAGACTAGGGAGGG + Intergenic
958755360 3:98245142-98245164 CTGGGAGCAGAGACTAGGGAGGG - Intergenic
959543822 3:107570857-107570879 CTGGGAGTAGAGACTAGGGAGGG + Intronic
961014072 3:123454036-123454058 CTGGGGGCAGAGGAGGAGGAGGG - Intergenic
961636346 3:128335362-128335384 CTGGGTGGGGTGACTGAGGAGGG + Intronic
962343084 3:134601655-134601677 TCGGTGGCAGAGACTGCGGAGGG + Intronic
962405160 3:135094303-135094325 CAGTGGGCAGAGACTGGGAAGGG - Intronic
962433678 3:135345375-135345397 CTGAGAGCAGAGAAGGAGGATGG + Intergenic
962660514 3:137596991-137597013 CTGGGAACAGAGACTAGGGAGGG - Intergenic
963237939 3:142973918-142973940 CTGGCTGCAGACACTCAGGAAGG + Intronic
963425097 3:145114475-145114497 CTGGGCACAGAGACTAGGGAGGG - Intergenic
963520330 3:146355074-146355096 CTGGGCACAGAGACTAAGGAGGG - Intergenic
963521507 3:146363572-146363594 CTGGGCACAGAGACTAAGGAGGG - Intergenic
964176210 3:153827829-153827851 TTGGGAGCAGAGACTAGGGAGGG + Intergenic
964720436 3:159764034-159764056 CTGGGGGCGGGAACTGAGAAGGG - Intronic
964763906 3:160159960-160159982 CTGTAGGCAGAAGCTGAGGATGG - Intergenic
964818808 3:160747376-160747398 CGGGGGGCAGAGAGAGAGGGAGG - Intergenic
965070211 3:163909086-163909108 CTGGGAACAGAGACTAGGGAGGG - Intergenic
965105345 3:164346335-164346357 CTGGGCACAGAGACTAGGGAGGG + Intergenic
965726989 3:171728202-171728224 CAGGAGGCAGAGGCTGAGGCAGG + Intronic
965794743 3:172428111-172428133 CTGGGGCATGACACTGAGGAGGG - Intergenic
966397538 3:179518359-179518381 TTGGGAACAGAGACTAAGGAGGG - Intergenic
966892502 3:184417451-184417473 CGGGGGGCGGAGAGGGAGGAGGG + Intronic
966924107 3:184633467-184633489 CTGGGGGCAGAGTCGGGGAAGGG - Intronic
967005483 3:185378732-185378754 TTGGGAGCAGAGACTAGGGAGGG + Intronic
967055362 3:185825133-185825155 CCGGGGGCAGAGGCGGAGGCGGG + Intergenic
967066345 3:185920385-185920407 CTGGGGGAGGAGACTCAGGTGGG + Intronic
967159698 3:186724805-186724827 CGGGGGGCTGAGGCTGAGGCAGG - Intronic
967658229 3:192075264-192075286 CTGGGCACAGAGACTAGGGAGGG + Intergenic
967921690 3:194618948-194618970 CTGGGCCCAGAGGCTGAGGGTGG + Intronic
968235411 3:197028056-197028078 CTAGGCGCAGAGACAGGGGAAGG + Intronic
968531455 4:1094134-1094156 CTGAGGCAGGAGACTGAGGATGG - Intronic
968599800 4:1503587-1503609 CTGGGGGCAGCCGCTGAGGGTGG - Intergenic
968726110 4:2248533-2248555 CTGGGGGGACAGACTCAGGCAGG + Exonic
969021443 4:4142738-4142760 CGGCTGGCAGAGACAGAGGAGGG - Intergenic
969564931 4:7971897-7971919 CTGGGGGCCCAGGCTGAGCAGGG - Intronic
969608955 4:8216558-8216580 CTGGCCGCCGAGTCTGAGGAGGG + Intronic
969710434 4:8840238-8840260 ATGGGGTCAGAGAGTGACGAGGG + Intergenic
969792001 4:9498761-9498783 CGGCTGGCAGAGACAGAGGAGGG + Intergenic
970041975 4:11807790-11807812 CTGGGCACAGAGACTAGGGAGGG - Intergenic
970252384 4:14129240-14129262 ATGGGGCCAGGGACTTAGGAAGG + Intergenic
970429636 4:15976938-15976960 CTGGGAGCAGTGACTGGGGGAGG + Intronic
971190299 4:24421686-24421708 ATGGAGGCAGTGGCTGAGGAAGG - Intergenic
971274531 4:25183233-25183255 CTGGGGGCAGGGACAGATGCAGG - Intronic
972381582 4:38524799-38524821 TTGGGGGCAAAGAGTCAGGAAGG + Intergenic
972926347 4:44013827-44013849 ATGGGGCCACAAACTGAGGATGG + Intergenic
973195373 4:47433684-47433706 GTGGGGTCCAAGACTGAGGAGGG - Intergenic
973710216 4:53622491-53622513 CTGGGGTGAGAGAGTGAGGGAGG - Intronic
973751009 4:54021309-54021331 TTGGGAGCAGAGACTAGGGAGGG - Intronic
973981932 4:56314703-56314725 CTGGGGGAAGAGGAGGAGGAGGG + Exonic
975083257 4:70305927-70305949 CAGGAGGCAGAGACTGTGGGGGG - Intergenic
975151955 4:71032722-71032744 TTGGGAGCAGAGACTAGGGAGGG - Intergenic
975736078 4:77382530-77382552 CCGGGGACAGAAATTGAGGAGGG + Intronic
975736733 4:77388689-77388711 CTGAGGGTAAAGATTGAGGATGG - Intronic
975801208 4:78059873-78059895 CTGGGGGTAGAGACGGGGGGCGG + Intronic
975832119 4:78380342-78380364 CTGGCGACAGAGAGAGAGGATGG + Intronic
976550538 4:86389918-86389940 ATGGGGGCAGAGAGAGAGGGAGG - Intronic
976587117 4:86811372-86811394 CTGGGGACAGAGTTTGAGAATGG + Intronic
977066606 4:92324309-92324331 CTGGGGACAGAGAGAAAGGATGG - Intronic
977225454 4:94387638-94387660 CTGGGAACAGAGACTAGGGAGGG + Intergenic
978422189 4:108544431-108544453 CTGGGAGAAGAAAATGAGGAAGG + Intergenic
978655557 4:111061676-111061698 CTGGGGACAAAGAATGAGGATGG + Intergenic
980214582 4:129835216-129835238 ATGGGGTCAGAGACGTAGGAGGG - Intergenic
980491470 4:133533359-133533381 TTGGGAACAGAGACTAAGGATGG + Intergenic
980953472 4:139404951-139404973 CTGAGGGCAGGTACTGAGAAGGG - Intronic
981551761 4:145948646-145948668 CTGGGGATAGAGCCTGAAGAAGG - Intergenic
982159026 4:152548665-152548687 ATGGTGGCAGAGCCTGAGCAGGG - Intergenic
982497226 4:156107650-156107672 CTGGGCACAGAGACTAGGGAGGG + Intergenic
983082632 4:163406002-163406024 ATGGGGGCAGAAAATGAGGAAGG - Intergenic
983818020 4:172156288-172156310 CTTGGGGCTGGGCCTGAGGAGGG + Intronic
983857774 4:172666914-172666936 CAGGAGGCAGATTCTGAGGAGGG + Intronic
984411603 4:179404719-179404741 TTGGGAGCAGAGACTAGGGAGGG - Intergenic
984701728 4:182822747-182822769 CTGGGGGCAGCGGCAGACGAGGG - Intergenic
985057513 4:186048402-186048424 TTGGGAACAGAGACTGGGGAGGG + Intergenic
985118581 4:186616462-186616484 CTGGGGCCAGAGGGTGAGAAGGG - Intronic
985482096 5:119704-119726 CTGGGGCCAGTCACTGAGGCTGG + Intergenic
985781574 5:1874374-1874396 GTGGGGGGAGAGACAGAGGGAGG + Intergenic
985805384 5:2039265-2039287 CTGTGGGAAGGGACTGGGGAAGG - Intergenic
986002930 5:3644246-3644268 CTGGGGGCATTAATTGAGGATGG + Intergenic
986178513 5:5372264-5372286 CTGGTGGTAGAAACTGAGCAGGG - Intergenic
987182643 5:15384421-15384443 CAGGGGCCAGAGACAGAGGCTGG - Intergenic
987204732 5:15613479-15613501 CTGAGGGTAGAGGCTGTGGAAGG + Intronic
987281921 5:16421534-16421556 CTGGGCACAGAGACTAGGGAGGG - Intergenic
987487390 5:18539849-18539871 CTGGGCACAGAGACTAGGGAGGG - Intergenic
989594812 5:43146481-43146503 CTGGAGGCTGAGGCTGAGGCAGG + Intronic
989615274 5:43332159-43332181 TTGGGAGCAGAGACTAGGGAGGG + Intergenic
989689018 5:44118913-44118935 TTGGGAGCAGAGACTAGGGAGGG + Intergenic
990004531 5:50930749-50930771 CTGGGTGCAGAGGCTCAGGCCGG + Intergenic
990565242 5:57021191-57021213 CTGGGAGCAGAGACTAGGGAGGG + Intergenic
991509765 5:67363825-67363847 CTTGGGGGAAAGAGTGAGGAAGG + Intergenic
992063013 5:73075640-73075662 CTGGGGGCAGAGGGTGCGGTGGG + Intronic
992091632 5:73322838-73322860 CAGTGTGCAGTGACTGAGGAAGG + Intergenic
992388796 5:76311811-76311833 CTGGTGGCAGGGACTGGGGACGG - Intronic
993547650 5:89231631-89231653 CTGGGGTCACAGACTTAGGGAGG - Intergenic
994324702 5:98435740-98435762 TTGGGAGCAGAGACTAGGGAGGG - Intergenic
994375909 5:99015535-99015557 TTGGGAGCAGAGACTAGGGAGGG + Intergenic
994566363 5:101450663-101450685 CTGGGGGCAGAGGCTGAAATGGG + Intergenic
995899487 5:117050550-117050572 CTGGGCACAGAGACTAGGGAGGG + Intergenic
996049996 5:118921405-118921427 CTGAGGTCAGAGGCTGAGGTGGG + Intronic
996329204 5:122311537-122311559 CTGGGAGAAGAGACTCGGGAAGG - Intronic
996509788 5:124305301-124305323 CTGGGCACAGAGACTAGGGAGGG - Intergenic
996726368 5:126676173-126676195 CGGTGGGCAGAAACTGAGGCAGG - Intergenic
997157118 5:131572995-131573017 CTGGGAGCAGAGACTAGGGAGGG - Intronic
997886500 5:137634859-137634881 CTGAGGGCTGAGAGTGAGGTTGG + Intronic
997964558 5:138347034-138347056 CTGGGGGCCGAGCCTGGGAATGG + Exonic
998224467 5:140315795-140315817 CTGGGCACAGAGGCTGAGGTGGG + Intergenic
999487112 5:152007953-152007975 AGGCGGGGAGAGACTGAGGAGGG + Intergenic
999513865 5:152280786-152280808 AAGGGGGCAGTGAGTGAGGAAGG + Intergenic
999772733 5:154787696-154787718 CTGGGAGCAGAGAAAGAGCAGGG + Intronic
1000122317 5:158209009-158209031 CTGAGGGCAGAGAGTGGAGAGGG + Intergenic
1000197306 5:158972182-158972204 CTGGGGACACAGATTGAGGTGGG - Intronic
1000606809 5:163335541-163335563 TTGGGAGCAGAGACTAGGGAGGG - Intergenic
1001088860 5:168722162-168722184 CTTTGGGCAGAGAGTGGGGAAGG + Intronic
1001192400 5:169643258-169643280 ATGGTGGCAGAAACTGAGGCTGG + Intronic
1001295172 5:170494100-170494122 CTGAGTGAGGAGACTGAGGAAGG - Intronic
1001331569 5:170766201-170766223 CTGGGCACAGAGACTAGGGAGGG + Intronic
1001791223 5:174459439-174459461 CTGGGGGCAGAGAGTAATTATGG - Intergenic
1001880556 5:175240482-175240504 CTGGTGTCGCAGACTGAGGAGGG - Intergenic
1002289353 5:178188979-178189001 GTGGGGGCAGAGATTGGCGAGGG + Intergenic
1002565846 5:180112816-180112838 TCGGGTGCAGTGACTGAGGATGG + Intronic
1003848235 6:10196194-10196216 CCGCAGGCAGAGAGTGAGGAAGG - Intronic
1004106143 6:12668910-12668932 CTGGGCACAGAGACTGGGGAGGG - Intergenic
1004251035 6:14023354-14023376 CTGGGGCCACACCCTGAGGACGG - Intergenic
1004331804 6:14728697-14728719 ATGTGGGCAGAGAAGGAGGAGGG + Intergenic
1004768698 6:18758249-18758271 CTGGGCACAGAGACTAGGGAGGG + Intergenic
1004820324 6:19361106-19361128 TTGGATGCAGAGAATGAGGAAGG - Intergenic
1005786694 6:29251424-29251446 ATGGGAGCAGAGACTAGGGAGGG + Intergenic
1006088918 6:31616321-31616343 CTGGGGGCAGAGGATGGGGATGG - Intronic
1006335123 6:33416362-33416384 CTGGGGGCAGAGACTGAGGAGGG + Exonic
1006336399 6:33423170-33423192 TTGGGGGCAGAGAAAGATGAAGG - Intronic
1006460137 6:34153311-34153333 CTGAGGCCAGAGACTGAGCCAGG - Intronic
1006735149 6:36268080-36268102 CTGGGGCTGGAGAATGAGGAAGG - Intronic
1006909861 6:37556931-37556953 AAGGGGGCAGAGCCAGAGGAGGG + Intergenic
1007084708 6:39135216-39135238 CTGAGAGCAGAGACTACGGAGGG + Intergenic
1007290878 6:40785821-40785843 CTGGGAGCAGTGAGTGGGGATGG - Intergenic
1007308652 6:40927252-40927274 CTGGGGAAAGTGACTGAAGAGGG + Intergenic
1007351564 6:41277345-41277367 CAGGGGGCAGAGACGGGGGCAGG + Intronic
1007436393 6:41815437-41815459 TGGGGGGCAGAGACTGAGAAGGG + Intronic
1007621990 6:43221008-43221030 TGGGTGGCAGAGGCTGAGGAAGG - Intronic
1007679624 6:43625317-43625339 ATGGGGCCAGACTCTGAGGATGG - Intronic
1007889104 6:45269937-45269959 CTGGGAGCAGGGAGTGAGTAGGG - Intronic
1007957400 6:45929990-45930012 CTGGGGGCTGGGAGGGAGGAAGG + Intronic
1008453150 6:51676038-51676060 CTGGTGGCAGAGGAGGAGGAAGG + Intronic
1009030734 6:58055400-58055422 CTGGGGGCAGATGGTGAGGGTGG + Intergenic
1009206588 6:60809861-60809883 CTGGGGGCAGATGGTGAGGGTGG + Intergenic
1009343491 6:62587469-62587491 CTGGGCACAGAGACTAGGGAGGG - Intergenic
1014115465 6:117663901-117663923 CTGGGAGCAGAGACTAGGGAGGG + Intergenic
1015910164 6:138161817-138161839 CTGGGGCCGGAGAGTGAGGCTGG - Intergenic
1016180142 6:141135891-141135913 CAGAGGCCAGAGACTGAGCATGG + Intergenic
1016393338 6:143597017-143597039 CTGGGAGCAGAAACGCAGGAGGG - Intronic
1016740439 6:147522909-147522931 CTGGGGACAGAGACTGTGAGGGG + Intronic
1017018284 6:150118711-150118733 CTGCGGGCACAGCCTGGGGAAGG + Intergenic
1017258466 6:152361105-152361127 CCAGGGGCAGAGACAGAGCAAGG + Intronic
1017269691 6:152491709-152491731 CTGGGAGCAGAGACTAGGGAGGG - Intronic
1018167375 6:161110897-161110919 CAGTGGACAGAGACTGAGGATGG - Intronic
1018857792 6:167687926-167687948 CCGGGGGAAGAGACACAGGAGGG - Intergenic
1019322404 7:421711-421733 CGGGCTGCAGAGACTGAGGCTGG - Intergenic
1019341627 7:511316-511338 GTGGGGCCAGAGACTGGGGGTGG + Intronic
1019341644 7:511360-511382 GTGGGGCCAGAGACTGGGGGTGG + Intronic
1019477276 7:1249945-1249967 CTGGGGGGAGGGACGGAGGGAGG + Intergenic
1019484861 7:1284835-1284857 ATGGGGGCAGAGCCTAGGGATGG + Intergenic
1019564200 7:1671497-1671519 CTGGGGACAGAAGCTGTGGAGGG + Intergenic
1019579223 7:1751738-1751760 CTGGGGGCAGCCACAGAGGAGGG + Intergenic
1019616906 7:1967698-1967720 GTGGTGCCAGAGAGTGAGGAAGG + Intronic
1019712040 7:2522193-2522215 CTGGGGGAAGGGAGGGAGGAGGG + Intronic
1019816167 7:3202365-3202387 CTGGGGGCTGATCCTGAGGAAGG + Intergenic
1019938876 7:4273755-4273777 CCTGGGGAAGAGACTGAGCATGG - Intergenic
1020260968 7:6530729-6530751 CAGAGGGCCGAGACTGAGGTTGG - Intronic
1020308866 7:6854767-6854789 CGGCTGGCAGAGACAGAGGAGGG - Intergenic
1020365557 7:7377455-7377477 CTGGGGCAGGAAACTGAGGATGG + Intronic
1020498630 7:8888950-8888972 CTGGTGGGAGAAACTGAGAAAGG - Intergenic
1020794086 7:12661087-12661109 TTGGGAGCAGAGACTAGGGAGGG - Intergenic
1021205676 7:17777021-17777043 CTGGGGATAGGGAATGAGGAGGG - Intergenic
1021393497 7:20122102-20122124 CTGGGGACAGAGACTAGGGAGGG - Intergenic
1021495763 7:21272999-21273021 CTGGGGGCAGGGAGTCAGGCTGG - Intergenic
1021660501 7:22914642-22914664 TTGGGAGCAGAGACTAGGGAGGG - Intergenic
1022045608 7:26620053-26620075 CATGGGGCAGGGACTGAAGAGGG - Intergenic
1022082977 7:27042508-27042530 GTAGGGGAAGAGAATGAGGACGG - Intergenic
1022300187 7:29095662-29095684 GTGGGGGCTGAGGCGGAGGAAGG - Intronic
1023357623 7:39382841-39382863 CTGGGGGCAGAGAGCCAGGCAGG + Intronic
1023738085 7:43252254-43252276 CTGGGGGCAGAAACCTGGGAAGG - Intronic
1023855461 7:44180624-44180646 GTGGGGGCCGATCCTGAGGAAGG + Intronic
1023873211 7:44273755-44273777 TTGGGGGCAGAGGATGAGGCTGG - Intronic
1023883540 7:44335097-44335119 ATGGGGGCAGGGACTGGGAAAGG - Intergenic
1023940390 7:44765540-44765562 CTGGGGGCAGGGACTGAGGGGGG - Exonic
1024374024 7:48617994-48618016 CCTGGGGCAGAGAGTGAGGTAGG - Intronic
1024739371 7:52337836-52337858 CTGGGAGCAGAGACTAGAGAGGG + Intergenic
1024862205 7:53857850-53857872 CTGAGGGCAGAGGCATAGGATGG - Intergenic
1024957037 7:54933266-54933288 CTGGTGGCAGAGAGGGAGGGAGG + Intergenic
1025079313 7:55968167-55968189 ATGGGGGCAGACAGGGAGGAGGG - Intronic
1025988937 7:66480082-66480104 CAGGAGGCTGAGGCTGAGGAAGG + Intergenic
1026400821 7:70011153-70011175 CTGAGGGGAGCCACTGAGGATGG + Intronic
1026466688 7:70660567-70660589 GTGGGGGAAGAGACAAAGGAAGG - Intronic
1026671249 7:72392461-72392483 CTGATGGGAGAGACTGAGGAAGG + Intronic
1026910488 7:74088963-74088985 CCTGGGACAGTGACTGAGGATGG + Intronic
1026941681 7:74290705-74290727 CTGTGGGCAGAGGAGGAGGAGGG + Intronic
1026969658 7:74460380-74460402 CTAGGTGCAGAGGCTGAGGTGGG - Intronic
1027152668 7:75743688-75743710 CTGGGTCCAGAGAGTGACGAGGG - Intergenic
1027158111 7:75782786-75782808 TTGGGAGCAGAGACTAGGGAGGG - Intronic
1027270294 7:76515182-76515204 CTAGGGGCTGAGGCTGGGGAGGG - Exonic
1027354300 7:77341192-77341214 TTGGGAGCAGAGACTAGGGAGGG - Intronic
1027880658 7:83831133-83831155 ATGTGGCCAGAAACTGAGGAAGG + Intergenic
1027965435 7:84999675-84999697 CAGAGGGCAGAGCATGAGGAGGG - Exonic
1028270259 7:88779362-88779384 CTGAGGCCAGAGGATGAGGAAGG + Intronic
1028590028 7:92484002-92484024 TTGGGAGCAGAGACTAGGGAGGG + Intergenic
1028674446 7:93442694-93442716 CTGAGAGCAGAGGCTGTGGATGG - Intronic
1028690059 7:93641390-93641412 CTGGGCACAGAGACTAGGGAGGG - Intronic
1028905759 7:96152356-96152378 CGGGAGGCAGAGCCTGAGGCAGG + Intronic
1029413980 7:100431534-100431556 CCGGGGGCAGAGGGTGAGGAAGG + Exonic
1029540727 7:101180478-101180500 CTGGGGAGTGGGACTGAGGATGG + Intergenic
1029647640 7:101868444-101868466 CTGGGGGAAAAGACTGAGACAGG - Intronic
1029686992 7:102155851-102155873 CTGGGTGCAGGGAGTGGGGAAGG - Intronic
1029853481 7:103489302-103489324 CTGCTGGAAGAGGCTGAGGAAGG + Intronic
1030163735 7:106532618-106532640 CTGGGAGCAGAGACTAGGGAGGG + Intergenic
1030658765 7:112196634-112196656 CTGGTGACAGAGAGTGGGGAAGG + Intronic
1030991979 7:116311936-116311958 ATGGGGGCAGAAACTGAGTCAGG - Intronic
1031066827 7:117114512-117114534 GTGATGGCAGAGACTGAAGAAGG - Intronic
1031364864 7:120889828-120889850 CTGGGCACAGAGACTAGGGAGGG + Intergenic
1031422578 7:121568199-121568221 CTGGGCACAGAGACTAGGGAGGG + Intergenic
1032081455 7:128860508-128860530 AGGGGGGCAGAGAGTGAGGATGG - Intergenic
1032192717 7:129773761-129773783 CAGATGGCAGAGACTGAGGCTGG - Intergenic
1033084594 7:138330524-138330546 TTGGGAGCAGAGACTAGGGAGGG - Intergenic
1034324682 7:150220087-150220109 CAGGGGTCGGTGACTGAGGATGG - Intergenic
1034626836 7:152499987-152500009 CTGGGGGCAAATTGTGAGGAAGG - Intergenic
1034628836 7:152514935-152514957 CTTGGAGCAGAGTCTGAGGTGGG - Intergenic
1034768509 7:153749144-153749166 CAGGGGTCGGTGACTGAGGATGG + Intergenic
1034897356 7:154886084-154886106 CTGGGAGCAGAGAAGGAGGGCGG - Intronic
1034929196 7:155147905-155147927 CAGGGGGAAGAGAGAGAGGAGGG - Intergenic
1035087031 7:156269092-156269114 CTGGGGGCAGATGGGGAGGAGGG + Intergenic
1035201880 7:157272961-157272983 CAGTGGGCAGGAACTGAGGACGG - Intergenic
1035266607 7:157693036-157693058 CCCTGGGCAGAGACAGAGGAGGG + Intronic
1035671950 8:1424869-1424891 CTGGGGAGGGAGAATGAGGAGGG + Intergenic
1035817871 8:2561174-2561196 TTGGGTGCAGAGGCTCAGGAGGG - Intergenic
1035901375 8:3461442-3461464 ATGGGGCCAGGAACTGAGGAGGG + Intronic
1036010544 8:4717075-4717097 CTCGGGGCAGAGAGGGAAGAAGG - Intronic
1036372015 8:8170121-8170143 CTGGGAACAGAGACTAGGGAGGG - Intergenic
1036505015 8:9347328-9347350 CGGGGGAAAGAGACTTAGGAAGG + Intergenic
1036638417 8:10566944-10566966 ATGGGGGCAGAGACACAGGGTGG - Intergenic
1036798028 8:11769876-11769898 CAGGCGGCTGAGACGGAGGAGGG - Exonic
1036878885 8:12495520-12495542 CTGGGAACAGAGACTAGGGAGGG + Intergenic
1036920619 8:12851014-12851036 CTGGGGGAAAAGACGGAGGCTGG - Intergenic
1037583561 8:20261350-20261372 CTGGGGCCAGATTCTGAGAAGGG - Intronic
1037761522 8:21744939-21744961 TTGGGGTCAGTGGCTGAGGATGG - Intronic
1037913248 8:22756848-22756870 CTAGGTCCAGAGACTGAGGGAGG - Intronic
1037940213 8:22945590-22945612 CTGGAGGCAGAGAGTGGGGATGG - Intronic
1037949824 8:23011664-23011686 CTGGGGCCAGAGACCCAGGCAGG + Intronic
1038244770 8:25845337-25845359 CAGGAGGCAGAGGCTGAGGCAGG - Intronic
1038319636 8:26514693-26514715 TTGGGGGTGGAGACGGAGGACGG + Intronic
1038388912 8:27176318-27176340 CAGTGAGCAGAGATTGAGGAAGG + Intergenic
1038435403 8:27532197-27532219 CTGAGGGGAGAGGGTGAGGAGGG - Intronic
1038736329 8:30173186-30173208 CTGGGGGCTGATAATGAGGGCGG - Intronic
1038740954 8:30216144-30216166 CTGGCTGTAGAGACAGAGGAGGG - Intergenic
1039265836 8:35823011-35823033 CTGAGTGGACAGACTGAGGAGGG - Intergenic
1039494315 8:37969247-37969269 CTGGGGGCTGGGAGTTAGGAAGG + Intergenic
1039499118 8:38002893-38002915 TTGGGAGCAGAGACTAGGGAGGG + Intergenic
1039554953 8:38468683-38468705 CAGGGGGCGGAGGCGGAGGAGGG - Intronic
1039873593 8:41567330-41567352 CTGCGGGCACAGCCTGAAGAGGG + Intergenic
1039885093 8:41650042-41650064 CGGGGGGCAGAGGACGAGGAGGG - Intronic
1040452206 8:47559449-47559471 AGGGGGTCAGAGGCTGAGGAAGG - Intronic
1040647895 8:49420975-49420997 TTGGGAGCAGAGACTAGGGAGGG - Intergenic
1041206671 8:55506423-55506445 CTGGGGGTAGTGACTGATCAAGG - Intronic
1041748491 8:61234200-61234222 CAGGGGGTAGAGAATGAGGGTGG + Intronic
1041763104 8:61387976-61387998 CTGTGGGTAGATACCGAGGAGGG + Intronic
1043856820 8:85274091-85274113 CTTGGGACTGAGCCTGAGGAGGG + Intronic
1045355920 8:101388996-101389018 ATGGGGACAGAGAAGGAGGATGG - Intergenic
1045489104 8:102655776-102655798 GTGGGGGCGGAGCCTGAGGCCGG + Exonic
1045506369 8:102781570-102781592 CTGAGGGCAGCGTCTGGGGAGGG + Intergenic
1046583240 8:116119615-116119637 CTTGGGGAAGAGGCAGAGGATGG - Intergenic
1046638161 8:116695734-116695756 GTGGAGTCAGAGACTGAGCAAGG + Intronic
1047135296 8:122071175-122071197 CTTGGGACTGAGTCTGAGGAGGG - Intergenic
1047196618 8:122727551-122727573 CTTGGGGGAGAGAATGATGAGGG - Intergenic
1047574485 8:126137768-126137790 CTGGGGGAAGAGAGTGAAGGGGG + Intergenic
1047757027 8:127926697-127926719 CCGGGGACAGATCCTGAGGAGGG - Intergenic
1048016321 8:130500588-130500610 CTGGAAGCAGAGCCTGAGGCAGG - Intergenic
1048765827 8:137843416-137843438 CTGGAGGCAGAGGTCGAGGAGGG - Intergenic
1048801099 8:138194293-138194315 GCGGAGGCAGAGACAGAGGAGGG - Intronic
1048933958 8:139340063-139340085 CTGGGTGCAGAGATTCCGGAAGG - Intergenic
1049479673 8:142815884-142815906 TTGGGAGCAGAGACTGGGGCGGG + Intergenic
1049510478 8:143024546-143024568 AAGGGGGCAGAGGCTGTGGATGG - Intergenic
1049511387 8:143028439-143028461 AAGGGGGCAGAGGCTGTGGATGG - Intergenic
1049580582 8:143408829-143408851 CTGGGGGCAGAGCCTGGACAGGG + Intergenic
1049682275 8:143924755-143924777 CTGCGGGCCGAGACGGAGCAGGG - Exonic
1050117474 9:2277083-2277105 CTGGGAACAGAGACTAGGGAGGG - Intergenic
1050140352 9:2510917-2510939 TTGGGAGCAGAGACTAGGGAGGG - Intergenic
1050219633 9:3372657-3372679 CTGGAGGCAGAGGTTGAGGCAGG - Intronic
1050287458 9:4118109-4118131 CTGGGGGCGGCGGCAGAGGAGGG + Exonic
1050503294 9:6321488-6321510 CGGGGGGAAGAGTGTGAGGAAGG + Intergenic
1051683917 9:19637290-19637312 CAGTGGGCAGAGACTGGGCAGGG + Intronic
1051849405 9:21489871-21489893 CTGGGCGCAGAGACTAGGAAGGG + Intergenic
1052834430 9:33240155-33240177 CTGGGGCCTGCGCCTGAGGAAGG - Exonic
1053060087 9:35023833-35023855 TTGGGAGCAGAGACTAGGGAGGG + Intergenic
1053078585 9:35155423-35155445 CTGGGAGCAGAGACTAGGGAGGG + Intergenic
1053177979 9:35943136-35943158 CAGGGGGCAGGGGCAGAGGAAGG + Intergenic
1055626602 9:78182324-78182346 CTGGGAACAGAGACTAGGGAGGG - Intergenic
1056391758 9:86147300-86147322 TTGGGAGCAGAGACTAGGGAGGG - Intergenic
1056580765 9:87886961-87886983 CTGGGTGCAGGGATGGAGGAAGG - Exonic
1057075875 9:92137935-92137957 CTGGGCGCAGGGACTGAGAAGGG - Intergenic
1057191371 9:93089754-93089776 CTGGGGGCAGGGAAGGAGGGAGG - Intergenic
1057743610 9:97733968-97733990 CTGGTGGCAGAGGCAGAGGGAGG + Intergenic
1058082444 9:100714261-100714283 TTGGGGCCAGAGACAGAGGGTGG - Intergenic
1058187248 9:101869487-101869509 CTAGAAGCAGAGACTGAGGAGGG - Intergenic
1058649111 9:107158581-107158603 CTGGGGGCAGACTCTGGGGCAGG - Intergenic
1058713391 9:107701156-107701178 CTTGTGCCAGAGAATGAGGAGGG - Intergenic
1058826300 9:108778646-108778668 CTGGGGGCAGCTGCTCAGGATGG - Intergenic
1059207712 9:112482411-112482433 TAGAGGGCAGAGTCTGAGGAAGG - Intronic
1059323429 9:113486993-113487015 CTTGGAGCTGAGAGTGAGGAGGG + Intronic
1059385656 9:113962309-113962331 ATGGTGGCAGGGACTGAAGAGGG - Intronic
1060209284 9:121700047-121700069 CTGGGGGCACAGCCTGAGGCTGG + Intronic
1060396660 9:123321216-123321238 CTGGGAGCAGAGGCTATGGAAGG - Intergenic
1060521411 9:124296146-124296168 CTGGTGGCAGAAGCCGAGGATGG - Intronic
1060553035 9:124494703-124494725 CTGGGGCCAGAGACTCAGAGGGG + Intronic
1060920157 9:127414819-127414841 TTGGGAGCAGAGACTAGGGAGGG - Intergenic
1061298186 9:129688469-129688491 CCTGGGGCAGAGACTGTGGGAGG - Intronic
1061563448 9:131421581-131421603 CTGGGGGCAGTGAGAGAGAAAGG - Intronic
1061594123 9:131617962-131617984 CTAGGGGCTGACACTGAAGAGGG - Intronic
1061791783 9:133063004-133063026 CTGGGGGCAGGGACTGGGCCGGG - Intronic
1061795458 9:133083570-133083592 CTGGGGGCAGGGACTGGGCCGGG - Intronic
1061897986 9:133658431-133658453 GTGGGGGCAAAGGCTGAGGGGGG + Exonic
1062049082 9:134437980-134438002 CCGGGGGCAGAGCCTGCGGGAGG - Intronic
1062171517 9:135137397-135137419 CTGGGGGCAGGGAGGGAGGAAGG + Intergenic
1062248828 9:135584128-135584150 CTGGGGGCTGATTCTGGGGAAGG + Intergenic
1062315292 9:135964231-135964253 CTGGGGGAACAGAGAGAGGAGGG + Intergenic
1062452106 9:136620164-136620186 GCAGGGGCAGAGACTGGGGAGGG - Intergenic
1203516595 Un_GL000213v1:7303-7325 TTGGAGGCAGATTCTGAGGATGG - Intergenic
1185464142 X:345334-345356 CACGGGGCAGCGACTGGGGAAGG + Intronic
1185492270 X:526714-526736 CTGGGGAAAGAGACCCAGGAAGG - Intergenic
1186112994 X:6276372-6276394 CTGGGGACAGAGACTAGGGAGGG + Intergenic
1186748692 X:12598452-12598474 CTGGCAGGAGAGAATGAGGATGG - Intronic
1186964510 X:14772800-14772822 CTGGTGGCCTGGACTGAGGAGGG + Intergenic
1188419368 X:29976799-29976821 CTGGGAACAGAGACTAGGGAGGG - Intergenic
1188552533 X:31379040-31379062 TTGGGAACAGAGACTGGGGAGGG - Intronic
1189171647 X:38915221-38915243 CTGTGAGCTGAGAGTGAGGAGGG + Intergenic
1190013383 X:46804976-46804998 CTGGGGGCAGGGAGTGAGGTGGG - Intergenic
1190119162 X:47646401-47646423 CTGGGCACAGAGGCTGAGGTGGG - Intronic
1190259056 X:48786641-48786663 CTGGGGGCTGAGACTGACCTGGG - Exonic
1190491886 X:50990624-50990646 CTGAGGGCAGAGAGGGAGGCAGG - Intergenic
1190501276 X:51081056-51081078 CTGAGGGCAGAGAGGGAGGCAGG + Intergenic
1190911527 X:54776060-54776082 CTGGGGGCAGAGTTGGAGGGTGG - Intronic
1190919690 X:54840148-54840170 CTGGGGGCAGAGGTGGAGGGTGG + Intergenic
1191883082 X:65861540-65861562 CTTGAGGTAGAGACTGAGAAGGG + Intergenic
1192247393 X:69385026-69385048 AAGGTGGCAGAGACTGATGATGG - Intergenic
1192318231 X:70067863-70067885 CAGGGGGCACAGGCTGGGGAGGG + Intergenic
1192442313 X:71183592-71183614 CTGGAAGCAGAAACTGGGGAGGG - Intergenic
1192454469 X:71265701-71265723 TTGGGAGCAGAGACTAGGGAGGG - Intergenic
1192764773 X:74129365-74129387 TTGGGAGCAGAGACTAGGGAGGG + Intergenic
1192914255 X:75636470-75636492 TTGGGAGCAGAGACTAGGGAGGG + Intergenic
1192935974 X:75858802-75858824 TTGGGAGCAGAGACTAGGGAGGG + Intergenic
1193536939 X:82728047-82728069 TTGGGAGCAGAGACTAGGGAGGG - Intergenic
1193885816 X:86983332-86983354 CTGGGCACAGAGACTAGGGAGGG - Intergenic
1194503103 X:94703002-94703024 TTGGGCACAGAGACTGGGGAGGG + Intergenic
1195017071 X:100790632-100790654 CTGGGAGCAGAGACTAAGGAGGG + Intergenic
1195306154 X:103585802-103585824 CAGTGGGCAGAGGGTGAGGAAGG + Intronic
1195993278 X:110704664-110704686 CTGGGGACAGTGATTGAGCAGGG + Intronic
1196047714 X:111273691-111273713 ATCAGGGAAGAGACTGAGGATGG + Intergenic
1196584997 X:117419159-117419181 CTGGGAGCAGAGACTAGGGAGGG - Intergenic
1196992815 X:121347199-121347221 TTGGGGACAGAGACTAGGGAGGG + Intergenic
1197358074 X:125461424-125461446 TTAGGAGCAGAGACAGAGGAAGG + Intergenic
1197812857 X:130463537-130463559 CTGGGGGCTGAGGGTGGGGATGG - Intergenic
1198222258 X:134613375-134613397 CTATGGGCAGAGGCGGAGGAAGG + Intronic
1198495758 X:137191156-137191178 CTGGGGGGAGATACTGAGATGGG + Intergenic
1198598335 X:138260312-138260334 CTGGGCACAGAGACTAGGGAGGG - Intergenic
1199764704 X:150932663-150932685 TTGGAGGGAGAGACTGAGCATGG - Intergenic
1199970019 X:152852800-152852822 CTGGTGGCAGTGACTGGGTAGGG - Intronic
1200007957 X:153100227-153100249 CTGGGAGCAGAGACTAGGGAGGG + Intergenic
1200021878 X:153218653-153218675 CAGAGGGCAGAGCCTCAGGATGG - Intergenic
1200068239 X:153515141-153515163 CTGGGGTCAGAGAATAGGGAGGG + Intergenic
1200419824 Y:2952861-2952883 CTGAGGGGAGAGAATGGGGAGGG + Intronic
1200888677 Y:8298756-8298778 CCGGGGCAAGAGACTGCGGAGGG + Intergenic