ID: 1006337524

View in Genome Browser
Species Human (GRCh38)
Location 6:33428179-33428201
Sequence GCGCCCCCGCCCCACGCGCG CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 310
Summary {0: 1, 1: 1, 2: 6, 3: 29, 4: 273}

Found 17 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1006337524_1006337541 27 Left 1006337524 6:33428179-33428201 CCGCGCGCGTGGGGCGGGGGCGC 0: 1
1: 1
2: 6
3: 29
4: 273
Right 1006337541 6:33428229-33428251 TGGGGAAGCCGCGGTGGCGGCGG 0: 1
1: 0
2: 4
3: 42
4: 589
1006337524_1006337530 0 Left 1006337524 6:33428179-33428201 CCGCGCGCGTGGGGCGGGGGCGC 0: 1
1: 1
2: 6
3: 29
4: 273
Right 1006337530 6:33428202-33428224 GCGTGTGCGTGGGCGCGGGGAGG 0: 1
1: 0
2: 3
3: 69
4: 628
1006337524_1006337537 9 Left 1006337524 6:33428179-33428201 CCGCGCGCGTGGGGCGGGGGCGC 0: 1
1: 1
2: 6
3: 29
4: 273
Right 1006337537 6:33428211-33428233 TGGGCGCGGGGAGGGGGGTGGGG 0: 1
1: 0
2: 22
3: 344
4: 3161
1006337524_1006337535 7 Left 1006337524 6:33428179-33428201 CCGCGCGCGTGGGGCGGGGGCGC 0: 1
1: 1
2: 6
3: 29
4: 273
Right 1006337535 6:33428209-33428231 CGTGGGCGCGGGGAGGGGGGTGG No data
1006337524_1006337528 -4 Left 1006337524 6:33428179-33428201 CCGCGCGCGTGGGGCGGGGGCGC 0: 1
1: 1
2: 6
3: 29
4: 273
Right 1006337528 6:33428198-33428220 GCGCGCGTGTGCGTGGGCGCGGG No data
1006337524_1006337531 1 Left 1006337524 6:33428179-33428201 CCGCGCGCGTGGGGCGGGGGCGC 0: 1
1: 1
2: 6
3: 29
4: 273
Right 1006337531 6:33428203-33428225 CGTGTGCGTGGGCGCGGGGAGGG 0: 1
1: 0
2: 2
3: 22
4: 317
1006337524_1006337538 18 Left 1006337524 6:33428179-33428201 CCGCGCGCGTGGGGCGGGGGCGC 0: 1
1: 1
2: 6
3: 29
4: 273
Right 1006337538 6:33428220-33428242 GGAGGGGGGTGGGGAAGCCGCGG No data
1006337524_1006337534 4 Left 1006337524 6:33428179-33428201 CCGCGCGCGTGGGGCGGGGGCGC 0: 1
1: 1
2: 6
3: 29
4: 273
Right 1006337534 6:33428206-33428228 GTGCGTGGGCGCGGGGAGGGGGG 0: 1
1: 1
2: 6
3: 113
4: 1001
1006337524_1006337536 8 Left 1006337524 6:33428179-33428201 CCGCGCGCGTGGGGCGGGGGCGC 0: 1
1: 1
2: 6
3: 29
4: 273
Right 1006337536 6:33428210-33428232 GTGGGCGCGGGGAGGGGGGTGGG No data
1006337524_1006337542 30 Left 1006337524 6:33428179-33428201 CCGCGCGCGTGGGGCGGGGGCGC 0: 1
1: 1
2: 6
3: 29
4: 273
Right 1006337542 6:33428232-33428254 GGAAGCCGCGGTGGCGGCGGCGG No data
1006337524_1006337527 -5 Left 1006337524 6:33428179-33428201 CCGCGCGCGTGGGGCGGGGGCGC 0: 1
1: 1
2: 6
3: 29
4: 273
Right 1006337527 6:33428197-33428219 GGCGCGCGTGTGCGTGGGCGCGG 0: 1
1: 0
2: 2
3: 24
4: 283
1006337524_1006337532 2 Left 1006337524 6:33428179-33428201 CCGCGCGCGTGGGGCGGGGGCGC 0: 1
1: 1
2: 6
3: 29
4: 273
Right 1006337532 6:33428204-33428226 GTGTGCGTGGGCGCGGGGAGGGG 0: 1
1: 0
2: 7
3: 75
4: 859
1006337524_1006337529 -3 Left 1006337524 6:33428179-33428201 CCGCGCGCGTGGGGCGGGGGCGC 0: 1
1: 1
2: 6
3: 29
4: 273
Right 1006337529 6:33428199-33428221 CGCGCGTGTGCGTGGGCGCGGGG 0: 1
1: 0
2: 4
3: 22
4: 242
1006337524_1006337526 -10 Left 1006337524 6:33428179-33428201 CCGCGCGCGTGGGGCGGGGGCGC 0: 1
1: 1
2: 6
3: 29
4: 273
Right 1006337526 6:33428192-33428214 GCGGGGGCGCGCGTGTGCGTGGG No data
1006337524_1006337539 21 Left 1006337524 6:33428179-33428201 CCGCGCGCGTGGGGCGGGGGCGC 0: 1
1: 1
2: 6
3: 29
4: 273
Right 1006337539 6:33428223-33428245 GGGGGGTGGGGAAGCCGCGGTGG 0: 1
1: 2
2: 15
3: 84
4: 948
1006337524_1006337533 3 Left 1006337524 6:33428179-33428201 CCGCGCGCGTGGGGCGGGGGCGC 0: 1
1: 1
2: 6
3: 29
4: 273
Right 1006337533 6:33428205-33428227 TGTGCGTGGGCGCGGGGAGGGGG No data
1006337524_1006337540 24 Left 1006337524 6:33428179-33428201 CCGCGCGCGTGGGGCGGGGGCGC 0: 1
1: 1
2: 6
3: 29
4: 273
Right 1006337540 6:33428226-33428248 GGGTGGGGAAGCCGCGGTGGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1006337524 Original CRISPR GCGCCCCCGCCCCACGCGCG CGG (reversed) Intronic
900116990 1:1033180-1033202 GCGCCCCCGACTCCCGCGCGGGG - Intronic
900137226 1:1122694-1122716 GCCCCACCTCCCCACGGGCGAGG - Intergenic
900641586 1:3690308-3690330 GCGCACCTGCCCCCTGCGCGGGG - Intronic
901086548 1:6614742-6614764 GGGCCCCCGCCCCCCGCCCGCGG + Intronic
902386168 1:16077083-16077105 GCGTCCCCGCCCCACCCCCAGGG - Intergenic
903078113 1:20787349-20787371 CCGGCCCCGCCTCCCGCGCGTGG + Intergenic
903788295 1:25875562-25875584 GCGGCCCCGCCCCAAGCCGGGGG + Intergenic
904822814 1:33256385-33256407 GAGCCCCCGCGCCAGGCGCCCGG - Intergenic
906044502 1:42817323-42817345 GCGCCCCTCCCCCCGGCGCGCGG - Intronic
906197197 1:43936441-43936463 GCGCCCCCGCTGCCCGAGCGCGG - Exonic
906481631 1:46203302-46203324 CCGCCCCCGCGCCGCGCGGGCGG + Intronic
906720009 1:47997456-47997478 GCCCCCCCGCCCCCCGCGCCAGG - Intergenic
907947200 1:59146887-59146909 GCGCCCCCGCGCCGCGCTGGTGG - Intergenic
912532758 1:110338504-110338526 GGAGCCCCGCCCCCCGCGCGCGG - Exonic
912879138 1:113390983-113391005 GCGCCCCGGCCGCCCGCGCGGGG + Exonic
913994779 1:143643092-143643114 GCGCGTCAGCCCCACTCGCGTGG + Intergenic
914869178 1:151458981-151459003 GCGCCCCCGCCCACCGCGAGTGG - Intronic
916588444 1:166167094-166167116 CCGCCTCAGCCCCACGTGCGGGG - Intergenic
918114099 1:181482549-181482571 GCGTCCCCGCCCCTCCCGCCTGG + Intronic
923008177 1:230068002-230068024 GCGCCCCTGCGCCCCGAGCGAGG + Intronic
923631187 1:235650176-235650198 GCGCCCCCGCCCCGCCCCCCCGG + Intronic
924801492 1:247331949-247331971 GCTCCCCCGCCCCCCGGCCGAGG + Intergenic
924926863 1:248692035-248692057 GCGCTCCCGCGCCACGCGAATGG - Intergenic
1062764189 10:48722-48744 GCCCTCCCGCCCCACGCAGGTGG - Exonic
1062795811 10:344374-344396 CCGCCCCCGCCCCACCCTTGGGG - Intronic
1064938521 10:20706962-20706984 GCTCCCCCGCCCCAGCCACGTGG + Intergenic
1070570918 10:77638629-77638651 GCGCCCCCAGCCCAGGCGCGGGG + Intergenic
1071086834 10:81875263-81875285 GCGCCCGCGCCCGGCCCGCGCGG + Intergenic
1072591668 10:96832870-96832892 CCACCCCTCCCCCACGCGCGGGG + Intronic
1073325585 10:102642708-102642730 GCGTCCCCGTCACCCGCGCGGGG - Intergenic
1076116820 10:127906956-127906978 GGGCGCCCGCCCCACCTGCGAGG - Intergenic
1076582480 10:131520886-131520908 TCGCCCCCGCCCCACAGGCCCGG + Intergenic
1076706878 10:132307269-132307291 GCGCCTCCGCCCACCGCCCGTGG - Intronic
1076850055 10:133088292-133088314 GGGCCCCCGCCCCGCGCGCCCGG + Intronic
1077008370 11:369533-369555 CCGCCGCCGCCCCAGGAGCGCGG + Intergenic
1077016320 11:400519-400541 GCGCCCCCGCCCGCAGAGCGTGG + Exonic
1077227232 11:1443661-1443683 GCGCCCCCCCGCCACGCTCTGGG - Intronic
1077404807 11:2378080-2378102 GCGCCCCCGCCCCACCATCCAGG - Intronic
1077809082 11:5619539-5619561 CCGCCCCCGCCCCACTTGCTTGG - Intronic
1083176282 11:60952003-60952025 GAGCCCCCACCCCACGCCCAGGG - Intronic
1083207431 11:61161200-61161222 GCGCCCCTGCCCCTCGCGGTGGG - Intronic
1083774238 11:64885620-64885642 GCGCGCACGCCACACGCACGTGG + Intronic
1083888780 11:65585451-65585473 GTGCCCCCGCCCCGCGCGCACGG + Exonic
1084021343 11:66420067-66420089 CCGCCCCCGCCCCCGGCCCGCGG + Intergenic
1084102366 11:66958110-66958132 GCGCCCCTCCCCCTCGCGCGGGG - Intronic
1084165297 11:67372611-67372633 CCGCCCCCGCCCCCGCCGCGGGG - Intronic
1084285576 11:68128532-68128554 CCAACCCCGCCCCTCGCGCGAGG - Intergenic
1084295767 11:68212967-68212989 GCAGCCCCGCCCCCCGCGCCCGG + Intronic
1084393040 11:68891060-68891082 GCGTCCCCGCCCCACTCCCCTGG + Intergenic
1085396885 11:76210851-76210873 CCGCCCCCGCCCCCCGCGCGCGG - Intergenic
1088481010 11:110296489-110296511 GCGCCCCAGCCACACGCCGGCGG - Exonic
1089667006 11:120026775-120026797 CCGCCCCCGCCCCAACAGCGTGG - Intergenic
1090788657 11:130070585-130070607 GCGGCCCCGGCCTTCGCGCGCGG + Intronic
1092184682 12:6470311-6470333 GCGCCCCTGCCCCGCCCGTGGGG + Intronic
1093641071 12:21527618-21527640 CTGCCCCCTCCCCACGCCCGGGG + Intronic
1093736408 12:22625308-22625330 GCGCCCCCAGCCCTCCCGCGAGG + Exonic
1094218574 12:27970542-27970564 GCGCCCACGCCCCCGGCACGGGG - Intronic
1095810676 12:46371499-46371521 GCGCCCCCGCCCCTCGCGCGCGG - Intronic
1096116812 12:49059962-49059984 GCGCCCCGGCCGCCCGCGCCGGG + Intergenic
1097046173 12:56189239-56189261 GCGCCCCAGCCCCTCCCCCGCGG - Intronic
1100854373 12:98745936-98745958 GGCCCCTCGCCCCAGGCGCGGGG + Intronic
1101910460 12:108857337-108857359 GCCCCCCTGCCCCGCACGCGCGG + Intronic
1102136934 12:110583166-110583188 CCGCCCCTGCCCGACGCGCGGGG + Exonic
1105975401 13:25468607-25468629 GCGCCCCCGCCGTCCCCGCGCGG + Intronic
1106157356 13:27171380-27171402 GCGCCCCCTCCCCAGCCGCCTGG + Intronic
1108541986 13:51453348-51453370 CCGCGGCCGCCCCGCGCGCGCGG - Intronic
1112567614 13:100564814-100564836 GCCCCCCCGCCCCCTGCCCGGGG - Intronic
1112570348 13:100588492-100588514 GCGCCCGTGGCCCCCGCGCGGGG + Intronic
1113779761 13:112969289-112969311 GCGCCCCCTCCGCACTCGCACGG + Exonic
1113874382 13:113585128-113585150 GCGTCCGCGCCCCACGCTGGAGG + Intronic
1114485171 14:23057656-23057678 CCGCCCCCGCCCCCGCCGCGCGG - Intergenic
1114649019 14:24271458-24271480 GCACCCCCGCCCCCCGCGGGCGG + Exonic
1117058038 14:51932888-51932910 GCGCCCCCACCCCACCCCCCAGG - Intronic
1117478134 14:56118203-56118225 GCGCCCCCTCCCCCGGCGCGTGG - Intronic
1119410254 14:74425981-74426003 GCGCCCCCGCCTCGCGGTCGCGG + Exonic
1121114373 14:91332991-91333013 GCACCCCCGACCCCCGCCCGAGG - Intronic
1123025066 14:105420323-105420345 GCGCCCCCCCGCCACCCCCGCGG - Intronic
1123047618 14:105526544-105526566 GCGCCCCTCCCCCGCCCGCGCGG - Intergenic
1126150915 15:45522869-45522891 GCGCCCCAGCCCTGCGCGCCAGG - Intergenic
1127342908 15:58065896-58065918 GCGCTCCCGCCCCCCGGCCGCGG + Exonic
1127433297 15:58933209-58933231 GTGCCCCCGCCCCGCGCCCCGGG - Intronic
1127922467 15:63504418-63504440 CCGCCCCCGCCCAGCCCGCGGGG - Intergenic
1128280066 15:66387144-66387166 GGACCCCCGCCCCACCCGCCCGG - Exonic
1128322007 15:66701111-66701133 CCGCCCTCTCCCCCCGCGCGCGG - Intergenic
1128635277 15:69298871-69298893 GCCGCCCCGCCCCGCGCGGGAGG + Intergenic
1130656375 15:85794600-85794622 GGGCCCCGGCCCCAGCCGCGGGG + Intronic
1130656418 15:85794695-85794717 GCGCCCCCGCTCCCTGCGCTGGG - Intronic
1131215071 15:90529816-90529838 CTGCCCCGGCCCCACGCTCGCGG - Intergenic
1132365278 15:101252153-101252175 GGGCCCCCGCCCGGCGCCCGCGG + Intergenic
1132512927 16:352982-353004 TGGTCCCCGCCCCACGCCCGAGG - Intergenic
1132648508 16:1010020-1010042 CGGCCCCCGCCCCACACGAGGGG - Intergenic
1132802754 16:1762371-1762393 GCGCCGCCGCTTCACGCGGGTGG + Exonic
1133097685 16:3458321-3458343 GCGCCCGCGCCCCCGGCGCACGG + Intronic
1133131064 16:3676361-3676383 GCCCCCCCGCCCCCCGCCCGAGG - Intronic
1133219917 16:4315644-4315666 GCGGCCCCGCCCCCGGCCCGAGG - Intronic
1133225842 16:4339997-4340019 GCGCCCCTGCCCCTCCCACGGGG - Intronic
1133234675 16:4382301-4382323 GCGCTGCAGCCCCACGCGCAGGG - Exonic
1136414680 16:30096039-30096061 GCGCCCCTGCCCAGCCCGCGAGG - Exonic
1138247882 16:55480439-55480461 CCGCCCCCGCCCCACGCGCCGGG - Intronic
1139761467 16:69187472-69187494 ACGCGCCCGCCTCACCCGCGGGG - Exonic
1139826692 16:69762571-69762593 GCGCGCCCACCCCACTCGGGCGG - Intronic
1141490365 16:84368464-84368486 GCAGCCCCGCCCCAGGGGCGGGG + Intergenic
1141989550 16:87602405-87602427 CCGCCCCCGCCCCCGGAGCGCGG - Intronic
1142156379 16:88534485-88534507 GCGCCACCGCCCGGCGCGCTCGG + Exonic
1142252051 16:88996483-88996505 GCCCCCCCGCTCCACGCCAGGGG - Intergenic
1142352743 16:89587345-89587367 CCGCCCCCGCCCCGCTCCCGAGG + Intronic
1142440466 16:90094510-90094532 GCCCTCCCGCCCCACGCAGGTGG + Intergenic
1142670628 17:1485933-1485955 CCGCCCCCGCCCCCGGCCCGCGG - Intronic
1143541746 17:7573284-7573306 GCACCCCCGCCTCTCGCGAGTGG - Intronic
1143554263 17:7650989-7651011 GCGTCCCCGCCCCACCCCCGCGG + Intronic
1143596243 17:7915980-7916002 GCGCAGGCGCACCACGCGCGCGG + Intergenic
1143661480 17:8327099-8327121 CCGCGCCCGCCCCTCCCGCGGGG + Intergenic
1144128114 17:12221136-12221158 GCGCCCCCGCCCCCCGCCGTGGG + Intergenic
1145214706 17:21042852-21042874 TCGCCGCCGCCCCCCGCGCGCGG - Exonic
1145248270 17:21283955-21283977 GCGCCCGCGCTCCAGGCGCCCGG - Intergenic
1145990119 17:29074326-29074348 GAGCCCCCACCCCACACGAGAGG + Exonic
1147168641 17:38605810-38605832 GCGCCCCCGGCCCGCCCGCCTGG - Exonic
1147211160 17:38873222-38873244 GCGCTCCCTCCCCACTCGAGGGG + Intronic
1147890593 17:43713972-43713994 CCGCGCCCGCCCCCCGCGCCGGG - Intergenic
1148080969 17:44967696-44967718 GCGCCGCTGCCCCCCGCGCCCGG + Exonic
1148323705 17:46771703-46771725 GCGCCCCCGGCCCCGGCGCCGGG + Intronic
1150326680 17:64263311-64263333 GCGGACCCGCCCCGCGCCCGCGG + Intergenic
1151558675 17:74859815-74859837 GCGCCCCCTCCTCCCGCGGGGGG - Exonic
1151821970 17:76501420-76501442 GCGCCGCCGCCCCGCCCCCGAGG - Intronic
1151966580 17:77434658-77434680 GCACCCCCGCCCCAGACGTGAGG + Intronic
1152175179 17:78782388-78782410 GAGGCCCCGCCCCTCGCCCGAGG + Intergenic
1152197213 17:78924926-78924948 GCGACCCCAGCCCCCGCGCGGGG - Intronic
1152684765 17:81688556-81688578 GCCCCCACGCCCCACTCGGGGGG + Intronic
1152815274 17:82404193-82404215 GAGCCCCCGCCCCGCGGGCCCGG - Intronic
1152831172 17:82497658-82497680 GCGCCCACACCCCCCGCGCTCGG + Intergenic
1152957100 18:49047-49069 GCCCTCCCGCCCCACGCAGGTGG - Exonic
1153006297 18:500872-500894 GCGCCCTGGCCCCACTCGCGCGG + Intergenic
1153900816 18:9615091-9615113 GCGCCGCCTCCCCACCCGCCCGG + Intronic
1155054495 18:22171786-22171808 GCGCGCCCGCGCCGCCCGCGTGG - Exonic
1157353967 18:46917045-46917067 GCGCCCCGACCCCCCGCGCCAGG + Intronic
1158434943 18:57428783-57428805 GCGCCGCCACCCCGCGCCCGCGG + Intergenic
1159511258 18:69400837-69400859 CCGCCCCCTCCCCCCGCGCCGGG + Intergenic
1159947893 18:74457394-74457416 GCACCTCCGCCCCAGGCGCGGGG - Intronic
1160613837 18:80109345-80109367 GCGCCTCCGCCCCGCGCGGCGGG - Exonic
1160861220 19:1237933-1237955 GCGCGCCCGCTCCGCGCGCCCGG + Exonic
1160967668 19:1753740-1753762 GCGCCGCCGCCGAGCGCGCGTGG - Exonic
1161051130 19:2164460-2164482 CCGCTCCCACCCCAGGCGCGCGG - Intronic
1161210328 19:3062352-3062374 GCGCCCCCTCCCCGCGCGCCCGG + Intronic
1161401602 19:4067976-4067998 CCCCCCCCCCCCCAGGCGCGCGG - Intergenic
1162369441 19:10270147-10270169 GAACCCCTGCCCTACGCGCGAGG - Intergenic
1162495506 19:11021221-11021243 GCGCCCCCTCCCGACCCGCATGG + Intronic
1163480895 19:17555724-17555746 GCGCCGCCGGCCCGCGCGTGGGG - Exonic
1163631282 19:18419247-18419269 GCGCCCCCACCCCCCGCGGCGGG + Intronic
1163633844 19:18429579-18429601 GTGCCCCCTCCCCACCCTCGGGG + Intronic
1164834757 19:31349901-31349923 GCGCCCCCGCCCCCGGCCCCAGG + Intergenic
1165305525 19:35000553-35000575 CCGCCCCCTCCCCAAGCCCGCGG - Intronic
1165867850 19:38949910-38949932 CCGCCCCCGCCTCGCTCGCGCGG + Intronic
1165924860 19:39320749-39320771 GCGCCCCCGCCCGCCGCTCCCGG + Intergenic
1167505665 19:49869847-49869869 ACGCCCCCGCCCCACTCCCGGGG - Exonic
1167921464 19:52786344-52786366 GCGCCCCGGCCCCAGCCCCGGGG - Intronic
1168307318 19:55442650-55442672 CCGCGCCCGCCCCGCCCGCGGGG + Exonic
925108344 2:1312274-1312296 GCGTCCCTGCCCCACGCAGGCGG + Intronic
927606498 2:24491230-24491252 CCGCCACCGCCCCCCGCTCGCGG - Intergenic
927937978 2:27086152-27086174 GCGGCCTCTCCCCACGCCCGGGG + Exonic
928928027 2:36598034-36598056 CCGCCTCCGCCCCAGGCTCGGGG + Exonic
929242486 2:39666395-39666417 GCGTCCCCGGCGCCCGCGCGTGG + Intronic
930700919 2:54456981-54457003 GCCCCCGCTCCCCACCCGCGGGG - Intronic
931763687 2:65436582-65436604 GCCCCCCCGCCCCGGGCGTGCGG + Intergenic
932624068 2:73284304-73284326 GCGCCCCCGCCTCCCTCTCGGGG + Exonic
934661423 2:96145534-96145556 CCGCCCCCGCCCCTCACGTGGGG + Intergenic
935137751 2:100322203-100322225 GCGCCGCCCCCAGACGCGCGTGG - Exonic
935371950 2:102356364-102356386 CCGCCCCCGCCCCAGCCTCGGGG + Exonic
935592768 2:104856357-104856379 CCGCACCCGCACCACGCGCAGGG + Exonic
935692565 2:105744741-105744763 GGGTCCCCGCCCCGCGCGCCCGG + Intergenic
937083917 2:119158387-119158409 GCGGCCCCGCTCCCCGCGCTCGG + Exonic
937354201 2:121187855-121187877 GCGCCTCCGCCCCACACCCAGGG + Intergenic
937909405 2:127068341-127068363 GTCCACACGCCCCACGCGCGGGG + Intronic
938058214 2:128232945-128232967 GCCCCCCAGCCTCACGCGGGAGG - Intergenic
938296404 2:130182158-130182180 GCGCTCCCGCCCCTCCCGCCAGG + Exonic
941476158 2:165953816-165953838 GCGACCCCGCCCCTCCCGCTGGG - Exonic
942067292 2:172283776-172283798 GCCCCCCGGCCCCACCCCCGAGG - Intergenic
942505454 2:176637658-176637680 AGGCCCCCGGCCCACGCACGAGG - Intergenic
944675947 2:202034245-202034267 GCGCGCACGCCCCCCGCGCCTGG - Intergenic
946179581 2:217941558-217941580 GCGCCCACGCCCCAGGCCAGAGG + Intronic
946716487 2:222559159-222559181 GCGCCCCCCCCCCCCCCGCCCGG + Exonic
947523348 2:230864821-230864843 GCGCCCCCTTCCCGCCCGCGGGG - Intronic
947765086 2:232633110-232633132 GCTCCCCCGCCCCACGCTCCGGG + Intronic
948206893 2:236167331-236167353 GCGCCCCCGCTCGACCCCCGCGG - Intronic
948207261 2:236168705-236168727 GCGCCCCCGGCCCAGCCGTGGGG - Intergenic
949004296 2:241636845-241636867 GCGCCCCCGCCCCCCGCGTTCGG + Intronic
1169244586 20:4015568-4015590 GCGGGCCCGCCCCTCGCGAGGGG - Intronic
1169849541 20:10034864-10034886 CCGCCTCCGCCCCTCGCGCCTGG - Intronic
1169905667 20:10600874-10600896 GAGCCCCCTCCCCACCCGCCTGG + Intronic
1172274986 20:33674469-33674491 CCGCCCCCGCCCCGCCCCCGCGG + Intergenic
1172656454 20:36541410-36541432 GGGCCCCCGCACCCCGCCCGCGG + Intergenic
1172684879 20:36746014-36746036 GCGCCTCCGCCCGGCCCGCGGGG - Intronic
1173165962 20:40687709-40687731 GCGCACCCGCCCGTCGCCCGCGG + Exonic
1173221868 20:41137889-41137911 GCTCCCACGACCCCCGCGCGGGG - Intronic
1175399468 20:58692569-58692591 GCGGCCCTGCCCAACACGCGGGG - Intronic
1176071592 20:63229500-63229522 GCGGCCCCACCCCACGCGTGGGG + Intergenic
1176125276 20:63472273-63472295 GCGCCCGCGCCGCCCGCGCGAGG + Exonic
1176131726 20:63499184-63499206 GCGCCCCGCCCCCTCCCGCGCGG - Exonic
1176173554 20:63707416-63707438 GCTCCCACGCTTCACGCGCGCGG + Intronic
1176194704 20:63831630-63831652 GCGCCCTTGCCCCGCGAGCGCGG + Intergenic
1176380690 21:6111019-6111041 CCGCCCCCGCCGCCCGGGCGGGG - Intergenic
1176381046 21:6112015-6112037 GCGCCCCCGCCGCCCGCGGTCGG - Intronic
1178992438 21:37366965-37366987 GCGCCCGCACCCCCCGCTCGGGG - Intronic
1179209723 21:39314215-39314237 AGGCCCCCGCCCCAGGAGCGCGG - Intronic
1179411640 21:41167691-41167713 GGGCCCCGGCCCCGCGCGCTTGG - Intergenic
1179742426 21:43426225-43426247 GCGCCCCCGCCGCCCGCGGTCGG + Intronic
1179742782 21:43427221-43427243 CCGCCCCCGCCGCCCGGGCGGGG + Intergenic
1180871745 22:19150435-19150457 GCGCCCCCGGCCCCCGCGCGCGG - Intergenic
1183093688 22:35540328-35540350 CGGCCCCGGCCCCACGCGCCCGG + Intergenic
1183220174 22:36507073-36507095 GCGGCTCCGCCCCTCGCGCCCGG + Exonic
1183504693 22:38202506-38202528 GCGCCCCCGCCCCCGCCGGGCGG - Intronic
1184207600 22:43014954-43014976 GCGCCCCCGCGTCCCGCCCGCGG + Intronic
1185116212 22:48939767-48939789 GCGCCCCCGCCCCCCGAGGCCGG + Intergenic
950487877 3:13283321-13283343 GCGCCCCCGCACCAGGCGTCGGG + Intergenic
951411478 3:22372335-22372357 GAGCCCCAGCCCCTCGCGCCTGG + Intronic
952942428 3:38454505-38454527 GCGCCCCCAGCCCACGCCCCCGG - Intronic
953326104 3:42013709-42013731 GCGCCCCCGCCCGCCGCCCCGGG + Intergenic
954376044 3:50194682-50194704 GCGCCCCCGCCCCACGATCGCGG + Intronic
954401302 3:50321226-50321248 CCGCCCCCGCCCCACACGTGGGG + Exonic
955060051 3:55486333-55486355 GCGACCCCGCTCCCCGCGCCGGG + Intronic
956605012 3:71065091-71065113 GCGCCCCGGCCCCCTCCGCGCGG + Intronic
960047613 3:113212428-113212450 GCGCCCCGGCCCCATGCTCCAGG + Intronic
966181874 3:177196495-177196517 GCGCCCCCGCCCCGGACGCGCGG + Intronic
966411780 3:179652909-179652931 CCGCGCCCGGCCCACGCGCAGGG + Exonic
967685198 3:192409626-192409648 CAGCCCCCGCCCCACCCGAGCGG - Intronic
967904179 3:194487038-194487060 GCCCCTCCGCCCTCCGCGCGGGG - Intronic
968462204 4:731648-731670 GCTCCCCCGCCCCTCGTGGGTGG + Intronic
968479169 4:826231-826253 CCGCCCCCGCCCGGCGCCCGCGG - Intergenic
969474322 4:7412678-7412700 GGGCCCCCGCCCCAGGGGTGGGG - Intronic
969559618 4:7939098-7939120 GCGGCCGGGACCCACGCGCGTGG + Exonic
975616425 4:76251854-76251876 GCGCCCCCGCGCGGCCCGCGTGG - Intronic
976276578 4:83284653-83284675 GCGCGCCTGCCGCACGCGCCAGG + Exonic
977809718 4:101346102-101346124 CCGCCCCCGCCCCGCGCGGAAGG + Intronic
981782795 4:148445256-148445278 TCCCTCCCGCCCCCCGCGCGAGG - Intergenic
985441367 4:189984362-189984384 GCCCTCCCGCCCCACGCAGGTGG - Intergenic
986747987 5:10760968-10760990 CCGCCCCCGGCACCCGCGCGTGG + Intronic
988557785 5:32253061-32253083 GTGCCCCCACCCCACCCACGAGG + Intronic
992042428 5:72848686-72848708 GCGCCCCCGGCCCAGGCACCAGG - Intronic
992080878 5:73233666-73233688 GCGTCCCCGCCCCTCGCCTGAGG - Intergenic
994197562 5:96936391-96936413 GCGCCGCCGCCGCTCGCCCGGGG + Intronic
997454245 5:134005397-134005419 GCGCCTCCGACCCGCCCGCGCGG + Intergenic
997984480 5:138492013-138492035 GCGCCCCTGCGCCCCGCCCGCGG + Intergenic
1002648520 5:180674194-180674216 GCCTCCCCGCTCCACGAGCGCGG - Intergenic
1003290683 6:4776293-4776315 GCCGCCCCGCCCCTCCCGCGCGG + Intronic
1005965120 6:30721495-30721517 TGGGCCCCGCCCCTCGCGCGCGG + Intronic
1006137141 6:31902036-31902058 CCGCCGCCGCCGCGCGCGCGGGG - Intronic
1006337524 6:33428179-33428201 GCGCCCCCGCCCCACGCGCGCGG - Intronic
1006362199 6:33592922-33592944 ACGACCCCGCCCCACGCCTGCGG - Intergenic
1006369138 6:33633601-33633623 GCGCCTCCGCCAGACGCGCCCGG - Intronic
1007423673 6:41734312-41734334 GCGCCCCAGCCCCGCGCCCCGGG - Intronic
1009431900 6:63573536-63573558 GGGCCGCCGCCCCGCGCACGCGG - Intronic
1010198500 6:73263201-73263223 GCGACCCCGCCGGAAGCGCGCGG + Intronic
1011517210 6:88166855-88166877 GCGCCCCCTCCCTCCGCGCAAGG + Intergenic
1013033702 6:106360648-106360670 GCGCCCCCGCGCGGCGCGGGCGG - Intergenic
1013220693 6:108074777-108074799 ACGGCCCCGCCCCCTGCGCGCGG + Intronic
1015626348 6:135183117-135183139 GCGGCCCCGCCCCGCGGGGGCGG - Intronic
1019298499 7:291176-291198 GCGGCGCGGCCCCAAGCGCGAGG + Intergenic
1019343015 7:517364-517386 GCGCCCCTTCCCTCCGCGCGCGG - Intronic
1019343061 7:517562-517584 GCGCCGCCGCCCCGGGCCCGAGG + Intronic
1019539321 7:1544688-1544710 ACGCCTCCGCCCCACGGGTGAGG - Exonic
1020020242 7:4862052-4862074 GCGCACCCGCCGCCAGCGCGAGG + Intronic
1020080385 7:5283250-5283272 GCGGCCCAGCCCCCCGCGCCCGG + Intronic
1022230554 7:28409182-28409204 CCGACCCCGCCCCGCCCGCGCGG - Intronic
1023773692 7:43583343-43583365 CCGCCGCCGCCCCAGGCCCGCGG + Exonic
1025198530 7:56948929-56948951 GCGGCCCAGCCCCCCGCGCCCGG - Intergenic
1025673421 7:63628004-63628026 GCGGCCCAGCCCCCCGCGCCCGG + Intergenic
1026360261 7:69597456-69597478 TCGGCCCCGCCCCTCGCCCGCGG + Intergenic
1026765058 7:73155093-73155115 CCGCCGCCGCCCCCCGCGCCCGG + Intergenic
1027041531 7:74964848-74964870 CCGCCGCCGCCCCCCGCGCCCGG + Exonic
1027082111 7:75237521-75237543 CCGCCGCCGCCCCCCGCGCCCGG - Intergenic
1027232585 7:76281489-76281511 GCACCCACGCCGCCCGCGCGGGG + Exonic
1029366394 7:100119266-100119288 CCGCCCCCGCCACCCGAGCGCGG + Intronic
1029390692 7:100272067-100272089 CCGCCGCCGCCCCCCGCGCCTGG - Exonic
1029640227 7:101815797-101815819 GCGGCCCGGCCTCGCGCGCGCGG - Intergenic
1029746443 7:102517864-102517886 CCGCCCCCGCCCCACGTGCGGGG + Intergenic
1029764380 7:102616843-102616865 CCGCCCCCGCCCCACGTGCGGGG + Intronic
1031162440 7:118184273-118184295 GCGACCCCGGCTCACGCCCGCGG - Intronic
1032024598 7:128431191-128431213 ACGCCCCCGCCCCACAAGCAGGG + Intergenic
1032215284 7:129952693-129952715 CCGCCGCCGCCCCCCGCACGGGG + Exonic
1034129742 7:148704153-148704175 GCGGCCCCCCCCCACCCCCGTGG + Intronic
1035664822 8:1373255-1373277 GCGCCGCCGCCACGCGCGTGCGG + Intergenic
1037805198 8:22054976-22054998 GCGCTCCTGCCCCACGCCCTGGG + Intronic
1037826847 8:22164986-22165008 GAGCCCCCTCCCCGGGCGCGCGG + Exonic
1039064913 8:33599504-33599526 GCGCCCTCCCTCCGCGCGCGGGG - Intronic
1039608384 8:38901101-38901123 CCGCCCCCGCCTCCCCCGCGCGG + Intergenic
1039868856 8:41528969-41528991 GCGCCCCCTCCCGACGCTCTTGG + Intergenic
1043847197 8:85177206-85177228 CCGCCCCCTCCCCAAGCCCGGGG - Intronic
1044821979 8:96160992-96161014 GCGCCCCCGCGGGACGCGCGCGG + Intergenic
1045063762 8:98427943-98427965 GCGCCCCCGCGCGGCGCGGGCGG + Exonic
1045304818 8:100950639-100950661 GCGCCCCCGCCCAAGCCGTGGGG + Intronic
1046077940 8:109334551-109334573 GCGTCCCCGACCCGCGCTCGCGG + Intronic
1049532231 8:143160327-143160349 TCCGCCCCGCCCCTCGCGCGGGG - Intronic
1050385504 9:5086194-5086216 CCGCCCCCGCCACCAGCGCGAGG + Intronic
1053398936 9:37800839-37800861 ACGCCCCCGCCCCCCGCTCCGGG - Exonic
1057259669 9:93576677-93576699 CCGCCCCCGCCGCCCCCGCGCGG + Exonic
1058861188 9:109119296-109119318 CCGCCCCCGTCCCCCGCCCGTGG - Intronic
1060700724 9:125747308-125747330 CCGCCCCCTCCCCGCGCGGGCGG + Intergenic
1060811082 9:126611861-126611883 GCGCCCCCGCCCCAGATGCCCGG + Intergenic
1061283553 9:129610298-129610320 CCGCCCCCCCCCCACCGGCGTGG + Intronic
1061990866 9:134157836-134157858 GCGTCCCCGACCCAGGCGCAGGG + Intronic
1062022586 9:134326420-134326442 GCGCCGCCGCCGCGCGCGCCCGG - Intronic
1062389227 9:136327463-136327485 GCGCCCCCTCCCCGCGCGGGCGG + Exonic
1062596269 9:137301313-137301335 GCGCCCCGCCCCCACCCGCGAGG + Exonic
1062741067 9:138175582-138175604 GCCCTCCCGCCCCACGCAGGTGG + Intergenic
1188736687 X:33726333-33726355 CCCCGCCCTCCCCACGCGCGGGG + Intergenic
1189002870 X:36963959-36963981 GCGCCCCAGGCCCCCGCCCGCGG + Intergenic
1190266749 X:48831502-48831524 GTTCCCCCGCCCCACGCTCGGGG + Intronic
1190893970 X:54597569-54597591 GCCCCCCCGCCCCAATCCCGTGG + Intergenic
1192274701 X:69616741-69616763 GGGCCCTCGCCCTACCCGCGAGG - Intronic
1196735187 X:118976250-118976272 GCGCCCCTCCCCCGCGCGAGCGG + Intronic
1198733323 X:139758428-139758450 GCTCCCCCGCCCCTCCCCCGAGG + Intronic