ID: 1006337524

View in Genome Browser
Species Human (GRCh38)
Location 6:33428179-33428201
Sequence GCGCCCCCGCCCCACGCGCG CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 310
Summary {0: 1, 1: 1, 2: 6, 3: 29, 4: 273}

Found 17 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1006337524_1006337534 4 Left 1006337524 6:33428179-33428201 CCGCGCGCGTGGGGCGGGGGCGC 0: 1
1: 1
2: 6
3: 29
4: 273
Right 1006337534 6:33428206-33428228 GTGCGTGGGCGCGGGGAGGGGGG 0: 1
1: 1
2: 6
3: 113
4: 1001
1006337524_1006337528 -4 Left 1006337524 6:33428179-33428201 CCGCGCGCGTGGGGCGGGGGCGC 0: 1
1: 1
2: 6
3: 29
4: 273
Right 1006337528 6:33428198-33428220 GCGCGCGTGTGCGTGGGCGCGGG No data
1006337524_1006337538 18 Left 1006337524 6:33428179-33428201 CCGCGCGCGTGGGGCGGGGGCGC 0: 1
1: 1
2: 6
3: 29
4: 273
Right 1006337538 6:33428220-33428242 GGAGGGGGGTGGGGAAGCCGCGG No data
1006337524_1006337537 9 Left 1006337524 6:33428179-33428201 CCGCGCGCGTGGGGCGGGGGCGC 0: 1
1: 1
2: 6
3: 29
4: 273
Right 1006337537 6:33428211-33428233 TGGGCGCGGGGAGGGGGGTGGGG 0: 1
1: 0
2: 22
3: 344
4: 3161
1006337524_1006337526 -10 Left 1006337524 6:33428179-33428201 CCGCGCGCGTGGGGCGGGGGCGC 0: 1
1: 1
2: 6
3: 29
4: 273
Right 1006337526 6:33428192-33428214 GCGGGGGCGCGCGTGTGCGTGGG No data
1006337524_1006337542 30 Left 1006337524 6:33428179-33428201 CCGCGCGCGTGGGGCGGGGGCGC 0: 1
1: 1
2: 6
3: 29
4: 273
Right 1006337542 6:33428232-33428254 GGAAGCCGCGGTGGCGGCGGCGG No data
1006337524_1006337535 7 Left 1006337524 6:33428179-33428201 CCGCGCGCGTGGGGCGGGGGCGC 0: 1
1: 1
2: 6
3: 29
4: 273
Right 1006337535 6:33428209-33428231 CGTGGGCGCGGGGAGGGGGGTGG No data
1006337524_1006337541 27 Left 1006337524 6:33428179-33428201 CCGCGCGCGTGGGGCGGGGGCGC 0: 1
1: 1
2: 6
3: 29
4: 273
Right 1006337541 6:33428229-33428251 TGGGGAAGCCGCGGTGGCGGCGG 0: 1
1: 0
2: 4
3: 42
4: 589
1006337524_1006337532 2 Left 1006337524 6:33428179-33428201 CCGCGCGCGTGGGGCGGGGGCGC 0: 1
1: 1
2: 6
3: 29
4: 273
Right 1006337532 6:33428204-33428226 GTGTGCGTGGGCGCGGGGAGGGG 0: 1
1: 0
2: 7
3: 75
4: 859
1006337524_1006337527 -5 Left 1006337524 6:33428179-33428201 CCGCGCGCGTGGGGCGGGGGCGC 0: 1
1: 1
2: 6
3: 29
4: 273
Right 1006337527 6:33428197-33428219 GGCGCGCGTGTGCGTGGGCGCGG 0: 1
1: 0
2: 2
3: 24
4: 283
1006337524_1006337533 3 Left 1006337524 6:33428179-33428201 CCGCGCGCGTGGGGCGGGGGCGC 0: 1
1: 1
2: 6
3: 29
4: 273
Right 1006337533 6:33428205-33428227 TGTGCGTGGGCGCGGGGAGGGGG No data
1006337524_1006337531 1 Left 1006337524 6:33428179-33428201 CCGCGCGCGTGGGGCGGGGGCGC 0: 1
1: 1
2: 6
3: 29
4: 273
Right 1006337531 6:33428203-33428225 CGTGTGCGTGGGCGCGGGGAGGG 0: 1
1: 0
2: 2
3: 22
4: 317
1006337524_1006337540 24 Left 1006337524 6:33428179-33428201 CCGCGCGCGTGGGGCGGGGGCGC 0: 1
1: 1
2: 6
3: 29
4: 273
Right 1006337540 6:33428226-33428248 GGGTGGGGAAGCCGCGGTGGCGG No data
1006337524_1006337529 -3 Left 1006337524 6:33428179-33428201 CCGCGCGCGTGGGGCGGGGGCGC 0: 1
1: 1
2: 6
3: 29
4: 273
Right 1006337529 6:33428199-33428221 CGCGCGTGTGCGTGGGCGCGGGG 0: 1
1: 0
2: 4
3: 22
4: 242
1006337524_1006337530 0 Left 1006337524 6:33428179-33428201 CCGCGCGCGTGGGGCGGGGGCGC 0: 1
1: 1
2: 6
3: 29
4: 273
Right 1006337530 6:33428202-33428224 GCGTGTGCGTGGGCGCGGGGAGG 0: 1
1: 0
2: 3
3: 69
4: 628
1006337524_1006337539 21 Left 1006337524 6:33428179-33428201 CCGCGCGCGTGGGGCGGGGGCGC 0: 1
1: 1
2: 6
3: 29
4: 273
Right 1006337539 6:33428223-33428245 GGGGGGTGGGGAAGCCGCGGTGG 0: 1
1: 2
2: 15
3: 84
4: 948
1006337524_1006337536 8 Left 1006337524 6:33428179-33428201 CCGCGCGCGTGGGGCGGGGGCGC 0: 1
1: 1
2: 6
3: 29
4: 273
Right 1006337536 6:33428210-33428232 GTGGGCGCGGGGAGGGGGGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1006337524 Original CRISPR GCGCCCCCGCCCCACGCGCG CGG (reversed) Intronic