ID: 1006337528

View in Genome Browser
Species Human (GRCh38)
Location 6:33428198-33428220
Sequence GCGCGCGTGTGCGTGGGCGC GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1006337524_1006337528 -4 Left 1006337524 6:33428179-33428201 CCGCGCGCGTGGGGCGGGGGCGC 0: 1
1: 1
2: 6
3: 29
4: 273
Right 1006337528 6:33428198-33428220 GCGCGCGTGTGCGTGGGCGCGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1006337528 Original CRISPR GCGCGCGTGTGCGTGGGCGC GGG Intronic
No off target data available for this crispr