ID: 1006339452

View in Genome Browser
Species Human (GRCh38)
Location 6:33438674-33438696
Sequence CAGAATCAGGTGTTGGAGGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 307
Summary {0: 1, 1: 0, 2: 0, 3: 22, 4: 284}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1006339452_1006339456 -5 Left 1006339452 6:33438674-33438696 CCAGCCTCCAACACCTGATTCTG 0: 1
1: 0
2: 0
3: 22
4: 284
Right 1006339456 6:33438692-33438714 TTCTGAAATTTCCCCAACCCTGG 0: 1
1: 0
2: 0
3: 17
4: 214
1006339452_1006339462 17 Left 1006339452 6:33438674-33438696 CCAGCCTCCAACACCTGATTCTG 0: 1
1: 0
2: 0
3: 22
4: 284
Right 1006339462 6:33438714-33438736 GCCACCCCCTTCCCTGCCCTTGG 0: 1
1: 1
2: 13
3: 102
4: 716

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1006339452 Original CRISPR CAGAATCAGGTGTTGGAGGC TGG (reversed) Intronic
901804470 1:11729456-11729478 CATGATCAGGTTTTGGAGTCAGG - Intergenic
902488657 1:16764665-16764687 CAGGCTCAGCTGTGGGAGGCTGG + Intronic
903116110 1:21179274-21179296 AATAATCAGGTGTTACAGGCCGG - Intergenic
903318611 1:22527938-22527960 CAGAAGCAGGTGTAGTCGGCTGG - Exonic
905626862 1:39495147-39495169 CAGAAGCAGGTGTGAGAGCCTGG - Intronic
907280010 1:53341207-53341229 CACAATCAGGTGTTGTGGGAGGG + Intergenic
908147392 1:61261151-61261173 CAGAATCAACTGTTAGAAGCTGG - Intronic
908283945 1:62572849-62572871 CACAATTAAGTGTTGGAGCCAGG + Intronic
908334858 1:63111422-63111444 AAGAATCAGGAGTTTGTGGCCGG - Intergenic
909530410 1:76675572-76675594 CAGACTCTTGGGTTGGAGGCAGG - Intergenic
915910986 1:159915336-159915358 CAGAATAAGGTGTTGGGAGATGG + Intergenic
917526290 1:175791410-175791432 TAGAATCATGTATTGCAGGCTGG - Intergenic
919495484 1:198261300-198261322 CAGAATCAGGACTTGAAGCCAGG - Intronic
919544631 1:198899609-198899631 CCAAATCAGCTGTTGGAGTCAGG - Intergenic
919912755 1:202122085-202122107 CAGAATATGGTGTTTTAGGCCGG + Intergenic
921645123 1:217605815-217605837 CAGAATCAGGTGTGGGATATAGG - Intronic
922484459 1:225962505-225962527 CAGAAGTAGGGGCTGGAGGCGGG + Intergenic
923318034 1:232800702-232800724 TATAATCAGGTCTTAGAGGCAGG + Intergenic
923531783 1:234817852-234817874 CAGGCTCAGCTGTGGGAGGCTGG - Intergenic
1063069694 10:2648881-2648903 CAGAAGCAGGTGTGGGAGCACGG - Intergenic
1063108131 10:3011776-3011798 AAGAATGAGGAGTTCGAGGCCGG - Intergenic
1063636471 10:7787747-7787769 CAGGATCAGGTCCTGGACGCGGG - Intronic
1064441026 10:15353868-15353890 CAGAATGGAGTGTTGGAGTCAGG - Intronic
1065759418 10:28968149-28968171 CTGATTCAGGTGGTGGGGGCTGG + Intergenic
1066324722 10:34346367-34346389 AAGCATCAGGGATTGGAGGCAGG + Intronic
1066656623 10:37703644-37703666 AGGAATCAGGTGCTGGAGCCCGG - Intergenic
1067343528 10:45422277-45422299 CAGAATGAGAGGATGGAGGCTGG - Intronic
1067734669 10:48840260-48840282 CAGAGTCTGGTGATGGAGGTGGG + Intronic
1068523256 10:58100965-58100987 AAGAACCAGGTGTTGGAAGTGGG - Intergenic
1070276290 10:75010651-75010673 CAGAACCAGGTTTGGGAGACAGG - Intronic
1070959248 10:80487382-80487404 CAGAACCTTGTGTTGGGGGCTGG + Intronic
1072252867 10:93595581-93595603 CAGGCTCAGGTGTTGGAGCAAGG + Intronic
1074774058 10:116753418-116753440 CAGAACCTGGTCTTGGAGCCAGG - Intergenic
1075015209 10:118905673-118905695 AATACTCAGGTGCTGGAGGCAGG + Intergenic
1075461641 10:122620444-122620466 CTGGGTCAGATGTTGGAGGCTGG + Intronic
1075619473 10:123915189-123915211 CAGAGTCAGATGTGTGAGGCAGG - Intronic
1076028679 10:127139681-127139703 CAGCATCAGGTGGAAGAGGCAGG - Intronic
1076240000 10:128897715-128897737 CAGAATCAGGTGGGGAAGGAAGG - Intergenic
1076558644 10:131346612-131346634 CAGAACCCGGTCTGGGAGGCTGG - Intergenic
1076568227 10:131413209-131413231 CAGAGTCAGCTGGTGGAGGCTGG + Intergenic
1076753437 10:132555195-132555217 CAGGACCAGGTGCTGCAGGCTGG + Intronic
1077385899 11:2269406-2269428 CAGATTGGGGTGCTGGAGGCGGG - Intronic
1079468696 11:20757760-20757782 TCAAATCAGGTTTTGGAGGCAGG - Intronic
1080561847 11:33471272-33471294 CAGAAGCAGGTGCTAGAGACAGG - Intergenic
1080871977 11:36244408-36244430 CAGAAGCAGAGGTTGGAGGTTGG - Intergenic
1080952050 11:37045157-37045179 TAGAATCAGATGTTGCAGCCAGG - Intergenic
1081608009 11:44539449-44539471 CAGAGTCAGGTTTTGAATGCAGG + Intergenic
1083300232 11:61736232-61736254 CAGAAGCAGGTGTTGGTGGGAGG - Intronic
1083303221 11:61749641-61749663 CAGAATCGCGTGGTGTAGGCGGG + Intergenic
1083767275 11:64847602-64847624 AAGAATCACGTGTGAGAGGCGGG - Intergenic
1083893489 11:65608480-65608502 CAGGATCAGGTGGTGGGGACAGG + Intronic
1084107639 11:66990370-66990392 GAGACTGAGTTGTTGGAGGCTGG - Intergenic
1084683463 11:70680354-70680376 AAGACTGAGGTGTTGGAGGGCGG + Intronic
1085094960 11:73753002-73753024 CAGAGTCAGGAGCTTGAGGCGGG + Intronic
1085391181 11:76183100-76183122 CTGAACCAAGTGTGGGAGGCTGG - Intergenic
1087133861 11:94694732-94694754 CAGAAACAGGTGATGGAAACTGG + Intergenic
1087295682 11:96370673-96370695 GAGAATCAGGGGTTGTAAGCTGG - Intronic
1087466468 11:98513246-98513268 CAAAATCAGTTGTTTAAGGCAGG + Intergenic
1089437419 11:118482084-118482106 CAGAATCAGGTGAGTGAGGAGGG + Exonic
1091641090 12:2238108-2238130 CAGAATCAGGTTTGGGAGCAAGG + Intronic
1095433559 12:42162420-42162442 CAGCATCAGATGTTGAAGCCAGG - Intronic
1096072308 12:48782239-48782261 CAGAATGTGGGGCTGGAGGCAGG - Intronic
1096196048 12:49649465-49649487 CTGAAGCAGATGTTGGAGGTGGG - Exonic
1097998009 12:65911228-65911250 TAGACTCAAGTGTTGGAGGTAGG + Intronic
1098282962 12:68879981-68880003 CAGAATGAGGTGATGGGGGAAGG + Intronic
1099107427 12:78514161-78514183 CAGACTCAGGAGTCTGAGGCAGG + Intergenic
1099562852 12:84200587-84200609 GAGAATCAGGTGTTGAAGAATGG - Intergenic
1100385210 12:94099717-94099739 GAGGAGCAGGTGGTGGAGGCAGG + Intergenic
1102081447 12:110101537-110101559 CAGAATCTGGAGTTGGGGACAGG - Intergenic
1103845757 12:123901080-123901102 CAGAAGCATGGGCTGGAGGCTGG - Intronic
1107071410 13:36273885-36273907 CAAAGTCATGTGTTAGAGGCTGG - Intronic
1108807316 13:54175004-54175026 CAGAAACAGGTGTTAAATGCAGG - Intergenic
1113549277 13:111179378-111179400 CAGAAACAGGCGTTTGAGGCCGG - Intronic
1113702795 13:112399576-112399598 CAGACTCATCTGTTGGAGGGAGG - Intronic
1116436091 14:44897125-44897147 CAGGATCAGGTGTGGGGGGCGGG - Intergenic
1117776878 14:59191888-59191910 CAGGATCAGTTGTTTCAGGCTGG + Intronic
1118332710 14:64826180-64826202 GAGAATCAGGTGTAAGAGGCAGG + Intronic
1118439782 14:65801895-65801917 CTGAAGCAGGTGTTTAAGGCGGG - Intergenic
1118716086 14:68561086-68561108 CAGAGGAAGGTGTAGGAGGCAGG - Intronic
1118869523 14:69729545-69729567 CAGAAACAGGAGTTGGGGGAAGG - Intronic
1120753372 14:88218801-88218823 CTGAAGCAGGTTTTGGAAGCAGG - Intronic
1121361063 14:93260457-93260479 AAGCATCATATGTTGGAGGCTGG - Intronic
1123663356 15:22586189-22586211 CAGCAGCAGGGGTTGGGGGCGGG - Intergenic
1123987944 15:25661541-25661563 AAGAAGCAGGTGTGGGGGGCTGG - Intergenic
1124240913 15:28027039-28027061 CAGAACAAGGTTTTGGAGCCGGG - Intronic
1124566264 15:30816853-30816875 CAGCAGCAGGGGTTGGGGGCGGG + Intergenic
1125477345 15:40055972-40055994 CTGAGTCAGGTGTGGGAGGAGGG + Intergenic
1125727960 15:41877767-41877789 CAGAACCAGGTACTGGAGTCTGG + Intronic
1126660178 15:51025592-51025614 CAGAGCCAGCTGTTTGAGGCTGG + Intergenic
1126913167 15:53436464-53436486 CTGCATCAGGGGTTGGAGGTCGG - Intergenic
1127264039 15:57346850-57346872 CAGAATCTGGGGTGGGGGGCAGG + Intergenic
1127845712 15:62868763-62868785 CCAAATAAGGAGTTGGAGGCCGG - Intergenic
1128849367 15:70936780-70936802 GAGAAAGAGATGTTGGAGGCAGG - Exonic
1129136383 15:73555967-73555989 CAGGACCAGGTGCTGGAGGGTGG - Intronic
1129171756 15:73812277-73812299 CAGGATCAGGGGATGGGGGCTGG - Intergenic
1129231356 15:74198908-74198930 CAGAATCATGTGGTGGAGAAAGG + Intronic
1134629368 16:15745881-15745903 CAGAAACAGCTGGTGTAGGCTGG - Intronic
1135264587 16:21012008-21012030 CAGTATTAAGTGTTGGAGCCAGG + Intronic
1135336224 16:21603433-21603455 AAGAATATGCTGTTGGAGGCTGG - Intronic
1135924046 16:26676637-26676659 CAAAATCAGGATTTGAAGGCAGG + Intergenic
1136025318 16:27464802-27464824 CAGCATCAGGTGCTGGAGGTCGG - Exonic
1136176974 16:28523874-28523896 CAGAAGCAGGGGTTATAGGCTGG - Intergenic
1137663534 16:50232313-50232335 CAGAATCAACTGTTGAAGACTGG - Intronic
1137760327 16:50935250-50935272 CAGAATCATGTCCTGGAGGATGG - Intergenic
1138331635 16:56220158-56220180 AAGAATCTGAGGTTGGAGGCAGG + Intronic
1138373766 16:56548426-56548448 CAGGATCAGAGGTTGGAGGGAGG - Intergenic
1138392937 16:56683335-56683357 CTGAATCAGGTGTTGAAGGAGGG - Intronic
1139337367 16:66242167-66242189 CAGTATGAGGTGTGGGAGGGTGG + Intergenic
1142247420 16:88976396-88976418 CAGAGGCAGATGCTGGAGGCCGG - Intronic
1142278666 16:89136711-89136733 CAGAGGCAGGTGGGGGAGGCAGG - Intronic
1143382144 17:6503234-6503256 CAGAGTGAGGGGTGGGAGGCTGG - Intronic
1143976736 17:10835886-10835908 AAAAATCAGGATTTGGAGGCTGG - Intronic
1144157132 17:12515975-12515997 CAAAATCAGATGTTTGAAGCTGG + Intergenic
1148686766 17:49505454-49505476 CAGAATAAGGAGAAGGAGGCTGG - Intronic
1148760322 17:49996612-49996634 CAAAATGGGGTGTGGGAGGCAGG - Intergenic
1150112825 17:62517198-62517220 CAAAACCTGGTGCTGGAGGCTGG - Intronic
1150437257 17:65163766-65163788 CAGAACCAGAGGCTGGAGGCAGG + Intronic
1151390964 17:73786395-73786417 GGCAATCAGGTTTTGGAGGCTGG + Intergenic
1152119975 17:78412624-78412646 CAGAATCTGGTGGGGAAGGCTGG - Intronic
1152171782 17:78755427-78755449 CAGAATGATGTGTTTGAGGCTGG - Intronic
1152252606 17:79219757-79219779 CAAAATCAGGTGTGGGAAACCGG - Intronic
1152350079 17:79779196-79779218 CAAACCCAGGTTTTGGAGGCTGG - Intronic
1154123725 18:11671865-11671887 CAAAACCAGGTTTTAGAGGCAGG + Intergenic
1155728645 18:29123422-29123444 CAGAATTATGTGTTGAAGGGTGG + Intergenic
1156403572 18:36761751-36761773 GAGAATCAACTGTTGGAGACAGG + Intronic
1156675989 18:39528092-39528114 CAGAAGGGGGTGTGGGAGGCAGG - Intergenic
1157523067 18:48358475-48358497 CAGAAGCAGATGCTGGAGCCAGG + Intronic
1158098036 18:53797255-53797277 GAGAAACAGGTGTTGGTGGAAGG + Intergenic
1158516804 18:58137629-58137651 CACAATCATGTTTTGGAGACTGG - Intronic
1158952028 18:62503808-62503830 CAGAAGCAGATGTTGGCAGCGGG - Intergenic
1161592115 19:5133576-5133598 GAGAACCAGGTGTTGGGGGAGGG + Intronic
1163460784 19:17436272-17436294 CAGAATGAGGAGGTGAAGGCTGG + Exonic
1163884018 19:19950172-19950194 CAGAATCTGTTGTTGGAGAGAGG - Intergenic
1164442653 19:28291239-28291261 CAGCAGCAGTTGCTGGAGGCAGG - Intergenic
1165579798 19:36852048-36852070 GAAAATCAGGTGTGGGAGGTGGG - Intronic
1166712066 19:44944134-44944156 CAAAATCAGGTGGTGAAGGGAGG + Intronic
1166732063 19:45064622-45064644 CAGAAGCAGGTGTGTGTGGCTGG + Exonic
1166764415 19:45244481-45244503 CAGAGGCGGGTGTTGGAGCCAGG - Intronic
1166871323 19:45872764-45872786 CAGGCTCAGGGGCTGGAGGCGGG - Exonic
1167303007 19:48690264-48690286 AAGAATCAGGACTTGGAGACTGG + Intergenic
1167595885 19:50427931-50427953 CAGATCCAGGAGATGGAGGCCGG + Intronic
1168292917 19:55365810-55365832 CAGGAGCAGGGGTGGGAGGCAGG - Exonic
925373275 2:3362774-3362796 AAGGAGCAGGTGCTGGAGGCAGG + Intronic
925991788 2:9260310-9260332 CAGAATCTGCTGCTGGGGGCGGG + Intronic
926076255 2:9945569-9945591 GAGAAACTGGTGTGGGAGGCAGG - Intergenic
926345625 2:11942535-11942557 CAGGAGCAGGTCTGGGAGGCAGG - Intergenic
926374097 2:12209594-12209616 CAGAAGCAAGTTCTGGAGGCCGG + Intergenic
926418151 2:12671144-12671166 CTGAATCAGGAGTGGGAGGATGG - Intergenic
926439755 2:12875459-12875481 GAGAATGAGGAGGTGGAGGCTGG + Intergenic
926900003 2:17740413-17740435 AAGAATGAGGTGTTGGCTGCTGG - Intronic
927692960 2:25221344-25221366 CAGAATAAGCTGGTGGTGGCCGG + Intergenic
929252311 2:39772534-39772556 CAGAAACAGGTTTTGGAGACAGG + Intronic
930628599 2:53727078-53727100 CAGAATCAGGGCTTGGACCCAGG - Intronic
931529924 2:63201894-63201916 AATAATCAGCTGTTGGAGGAAGG - Intronic
932737546 2:74264986-74265008 CAGAATCAGGTGTCAGAGACGGG + Intronic
932907488 2:75769310-75769332 GAGAATTAGGGGTTTGAGGCAGG + Intergenic
934744599 2:96750887-96750909 CAGAAAGAGGGGTTGGTGGCAGG + Intergenic
935386679 2:102506917-102506939 CAGAGCCAGGTGTTGGAATCCGG + Intronic
936068538 2:109349978-109350000 CAGAGTCAGGTGCGGGAGACAGG + Intronic
936949717 2:117965756-117965778 CAGTGTCAGGTGTAGGGGGCAGG - Intronic
937078946 2:119126700-119126722 GAGAAGCAGGTGGTGGGGGCTGG - Intergenic
937440134 2:121908319-121908341 CAGATGCAGGTGCAGGAGGCTGG + Intergenic
938387266 2:130875797-130875819 CAGAAGCAAGTGTGGGAGCCGGG - Intronic
938947948 2:136230843-136230865 CAGAATCAAGTCATGGAGCCAGG - Intergenic
939293564 2:140225489-140225511 CAGATTCAGGGGTGGCAGGCAGG + Intergenic
939846137 2:147248156-147248178 CAGAATCATGTCTAGGATGCTGG + Intergenic
941614738 2:167706609-167706631 CAGAAACAAGTGTGGGAAGCAGG + Intergenic
942040661 2:172059027-172059049 TAGAAACTGGTGATGGAGGCGGG - Intronic
942342097 2:174959484-174959506 CAGAATTAGTTGCTGAAGGCAGG + Intronic
945202515 2:207296812-207296834 CAGGTTCTGGTGTTGGGGGCAGG - Intergenic
945304317 2:208244245-208244267 CAGGAACAGGTGTTGGAGCCAGG + Intronic
945486757 2:210406209-210406231 CAGAAGCAGGTTTTGGAAGGCGG - Intergenic
945955880 2:216085309-216085331 GAGAATCAGGTGGGGGAGGTGGG + Intronic
948095211 2:235327972-235327994 CAGAAAAAGGTCTTAGAGGCCGG + Intergenic
948467327 2:238158740-238158762 CAGAACCAGGAGTTGCAGGGGGG + Intergenic
1170153511 20:13249332-13249354 CAGAACTAGGGGTGGGAGGCAGG - Intronic
1171360348 20:24582578-24582600 CAGCCTCAGGTGCTGGAGTCTGG - Intronic
1171492668 20:25532273-25532295 CAGATTCACGTTTTCGAGGCTGG + Intronic
1174036957 20:47674363-47674385 CAGCTTCAAGTGGTGGAGGCAGG - Intronic
1174657234 20:52181751-52181773 CAGATTCAGGAGGTGGAGCCCGG + Intronic
1174969304 20:55255676-55255698 CAGATTCAGGTGTTTGACACTGG - Intergenic
1175094024 20:56527674-56527696 CAGAAGCAGGAGAGGGAGGCAGG + Intergenic
1175233512 20:57491970-57491992 CAAAATCCGGTGCTGGGGGCTGG + Intergenic
1175254352 20:57630189-57630211 CAGAATAAGGGGTTGGGTGCTGG - Intergenic
1175766871 20:61598293-61598315 CAGGGGCTGGTGTTGGAGGCAGG - Intronic
1177196913 21:17912748-17912770 CTGGATCAGGGGTGGGAGGCAGG + Intronic
1179932103 21:44577641-44577663 CATGATCCCGTGTTGGAGGCAGG - Intronic
1182648055 22:31826511-31826533 CAGAATCAGGGGTTAAAGACAGG - Intronic
1185261349 22:49865956-49865978 CAGCATCGGGAGGTGGAGGCGGG - Intronic
952991269 3:38832998-38833020 CAGAAGCAGGAGCTGCAGGCAGG + Intergenic
954115389 3:48464371-48464393 CAGAATAGGGGGCTGGAGGCAGG + Intronic
956291405 3:67663866-67663888 GAGATTCAGGTGCTTGAGGCTGG + Intergenic
957264170 3:77939911-77939933 CAGAATGATGAGTTGGAGGAAGG + Intergenic
959944980 3:112116639-112116661 TAGAATGAAGTGATGGAGGCTGG + Exonic
960708224 3:120502183-120502205 CAGAATCAGGTGGCGGTGGCTGG - Intergenic
961139862 3:124546773-124546795 GAGAAGCAGGTGGAGGAGGCTGG + Intronic
961337062 3:126186928-126186950 CAGTTTCAGGTGGTGGCGGCTGG - Intronic
962259124 3:133892096-133892118 CAGGAGCAGGTGTTTGAGGAGGG - Intronic
965383640 3:168020389-168020411 CAGAATCAGCTGGTGGTGGGCGG + Intronic
965591588 3:170365212-170365234 CAGAATCAGGAGTTGAATACAGG + Intronic
965747298 3:171938733-171938755 CCTAATCAGGTGGTTGAGGCAGG - Intergenic
966452822 3:180081611-180081633 CAGAAGCAGATGTTGGTGACAGG - Intergenic
966632756 3:182096724-182096746 CAGAAAGAGGTTTTGGAGCCGGG - Intergenic
967268183 3:187710180-187710202 GAGAATCAGGAGTTGAGGGCAGG - Intronic
968525116 4:1052850-1052872 CAGAACCAGGTGCTGCAGGGTGG + Intergenic
968862620 4:3184726-3184748 CAGCATCAGGTGTATGAGCCTGG + Intronic
969450421 4:7269726-7269748 GAGATTAAGGTGTTGGGGGCTGG - Intronic
971698539 4:29937306-29937328 CAGAACCAGGTGTGGGGTGCTGG + Intergenic
972583126 4:40412722-40412744 CAGAATGATGTGTTGAAGGCAGG - Intergenic
975126631 4:70789868-70789890 CAGAGTCATGTGTTAGAGGAAGG + Intronic
976783502 4:88789439-88789461 AAGGATCAGGTGTAGGAGGTGGG - Intronic
977267354 4:94871190-94871212 AAGAAACAGGTCTTGGAGTCAGG - Intronic
985673969 5:1220841-1220863 CAGAATGGGGGGTTGGAGGAGGG - Intronic
985709480 5:1420185-1420207 CAGAAGCAGCTGTTGGCGGAAGG - Intronic
986389537 5:7271656-7271678 CAGTTTCAGTTGTTGGGGGCTGG + Intergenic
988506369 5:31826923-31826945 AAGACTCAGGTCTTGGAGGCAGG - Intronic
989102484 5:37835399-37835421 AAGAATGAGGTGTGGGCGGCAGG - Intronic
989697886 5:44225016-44225038 CAGAATCATGAGTTGGAAGAAGG - Intergenic
990354129 5:54949183-54949205 CAGAATCATGTGTTGCAGCCAGG + Intergenic
990494221 5:56330964-56330986 CAGATTCAGATGTGGGAGGGAGG + Intergenic
991442358 5:66664137-66664159 GAAAATCAGGAGTTTGAGGCTGG + Intronic
992603875 5:78435383-78435405 CACAATGAGGGGTTGGGGGCTGG - Intronic
993147611 5:84115199-84115221 AAGAATCAGCTCTTGGAGGTAGG + Intronic
994490829 5:100441080-100441102 CAGAAGCAGATGTTGGTGTCAGG + Intergenic
994999072 5:107104401-107104423 AAGAATCAGGTCTTGAAGGATGG - Intergenic
996358384 5:122620726-122620748 GAGGGTCAGGTGTGGGAGGCCGG + Intergenic
999191921 5:149754666-149754688 CGGAGTCAGGTGTCAGAGGCTGG + Intronic
999319798 5:150606850-150606872 CAGGCTCAGGAGTTGGGGGCAGG - Intronic
999512775 5:152270129-152270151 CAGAATCAAGAGATGGAGACAGG - Intergenic
1000017934 5:157294780-157294802 CAGAATGAGATGCTGGAGGAAGG + Exonic
1000199023 5:158989134-158989156 CTCAATTAGGTGTTGGAGGTGGG - Intronic
1001768408 5:174273338-174273360 CAGAGACTGGAGTTGGAGGCAGG - Intergenic
1002540005 5:179900353-179900375 CAGAAACAGGTGCTGGGGGTAGG - Intronic
1003386601 6:5673317-5673339 GGGAAGCAGGTGCTGGAGGCAGG - Intronic
1004029997 6:11858992-11859014 TAGAGTCAGGAGTTGGAGGTAGG + Intergenic
1005450907 6:25971324-25971346 CAGAGTCATGTGTGGGAGGCAGG - Intronic
1005759331 6:28953465-28953487 CTGATTCAGGTTTTGGAAGCTGG - Intergenic
1006339452 6:33438674-33438696 CAGAATCAGGTGTTGGAGGCTGG - Intronic
1006360535 6:33584693-33584715 CACAGTCAGGTGAGGGAGGCAGG - Intergenic
1006779868 6:36625070-36625092 GAGGATGAGGTGTTGGAAGCTGG - Intergenic
1007975909 6:46100952-46100974 GAAAATCAGGTGATGGTGGCAGG + Intergenic
1008510834 6:52274188-52274210 CAGAATAAGGTTTGGGAAGCAGG - Intronic
1011247972 6:85340085-85340107 CAGAAGCAGGTGACTGAGGCTGG - Intergenic
1013262892 6:108463890-108463912 CATAATCTGGGGCTGGAGGCAGG - Intronic
1018405106 6:163472395-163472417 CAGAAGGAGGTGATGGAGGTGGG + Intronic
1019886694 7:3911727-3911749 CTGTATTAGGTGTTGGAGGAGGG + Intronic
1021446293 7:20737044-20737066 CAGCTTCAGGAGGTGGAGGCAGG + Intronic
1021934928 7:25620895-25620917 CAGAATAAGGTGGTGGTGGCTGG - Intergenic
1021994483 7:26166491-26166513 CAGAACCAGGATTTGGCGGCAGG - Intronic
1022510321 7:30931304-30931326 CAGAGACAGGTTGTGGAGGCTGG + Intergenic
1023981111 7:45070650-45070672 CATAAAAAGCTGTTGGAGGCTGG + Intronic
1024698641 7:51883403-51883425 CAGGAGCAGGGGTAGGAGGCAGG - Intergenic
1026732616 7:72924947-72924969 CAGAAACAGGCGTTAAAGGCAGG + Intronic
1026781751 7:73272771-73272793 GAGACTCAGGGGTGGGAGGCAGG - Intergenic
1027022600 7:74826205-74826227 GAGACTCAGGGGTGGGAGGCAGG - Intronic
1027065412 7:75119704-75119726 GAGACTCAGGGGTGGGAGGCAGG + Intronic
1027111444 7:75442872-75442894 CAGAAACAGGCGTTGAAGGCAGG - Intronic
1027214135 7:76173347-76173369 AAGAATCTGGAGTTGGGGGCTGG - Intergenic
1027283673 7:76627405-76627427 CAGAAACAGGCGTTGAAGGCAGG - Intergenic
1027459721 7:78437048-78437070 CAGACTGAGGTGTGGGAGCCTGG + Intronic
1028045788 7:86117252-86117274 CAGTTTCTGGTGTTGGGGGCAGG - Intergenic
1028392138 7:90328808-90328830 CAATATCAAGTGTTGGAGACTGG + Intergenic
1030185630 7:106759027-106759049 CAGAATAAGGTGGTGGTGGGGGG - Intergenic
1032042028 7:128571119-128571141 CAAAACCTGGTGCTGGAGGCTGG - Intergenic
1033601929 7:142894578-142894600 AAGAATCGTGTGATGGAGGCTGG - Intergenic
1033864218 7:145668758-145668780 TATGATCAGGTGTTGGAGGAGGG + Intergenic
1037515378 8:19625778-19625800 CAGAACAAGGAGTTTGAGGCTGG + Intronic
1037584115 8:20264806-20264828 CAGAATAAAGGGTTGGAGCCTGG - Intronic
1037646963 8:20801008-20801030 CAGAAGCATGTGTTGGAGCTGGG + Intergenic
1039470027 8:37807710-37807732 CAGTGGCAGGTGTTGGAGACAGG + Intronic
1039476500 8:37841765-37841787 CAGAGTCAGGTGTGCGAGGCGGG + Exonic
1040029152 8:42808585-42808607 AAGAATCAGGAGTTTGAGGATGG - Intergenic
1042027845 8:64443106-64443128 CAGAATAAGGGGTGGGAGACAGG + Intergenic
1046493147 8:114979419-114979441 CAGCATCAGTTATTGCAGGCTGG - Intergenic
1046559209 8:115816360-115816382 CAGGACCAGGTGTGGGATGCGGG - Intergenic
1046839117 8:118837991-118838013 CACAATGAGGTGCTGGAGGGTGG - Intergenic
1047781175 8:128112356-128112378 CTGCACCACGTGTTGGAGGCAGG - Intergenic
1047839488 8:128735116-128735138 CAGAATCATTGGTTGGAGGTAGG - Intergenic
1049352887 8:142173499-142173521 CAGACTCAGGTGGGTGAGGCTGG - Intergenic
1052866297 9:33466477-33466499 CAGAGTCAGGAGTTGGAAGTGGG + Intronic
1053304052 9:36971470-36971492 GAGAATGTGGTCTTGGAGGCAGG + Intronic
1053308160 9:36998247-36998269 CCGAGTCTGGTCTTGGAGGCAGG + Intronic
1053383602 9:37669074-37669096 CAGAATCAGGACTTGGATCCAGG + Intronic
1055035420 9:71813042-71813064 CAGTATAAGGTCTTGAAGGCTGG - Intronic
1055605938 9:77970466-77970488 CAAAATCTGGGGTTGAAGGCAGG + Intronic
1055852578 9:80650043-80650065 CATTTTCCGGTGTTGGAGGCTGG + Intergenic
1056334512 9:85553824-85553846 CAGAATCAGGAGTTGGATTGAGG - Intronic
1057115063 9:92513171-92513193 CAGGACCAGGTGTGAGAGGCTGG - Intronic
1057170884 9:92962384-92962406 CTGAACCAGGTGGTGGTGGCAGG + Intronic
1057897489 9:98921436-98921458 CAGAAATTGATGTTGGAGGCTGG + Intergenic
1059343834 9:113615236-113615258 CAGAAACAGCCATTGGAGGCGGG + Intergenic
1059444004 9:114327099-114327121 CAGCCCCATGTGTTGGAGGCGGG + Intergenic
1059445211 9:114333878-114333900 CAGCCCCATGTGTTGGAGGCGGG + Intergenic
1061048535 9:128180625-128180647 TAGAGGCAGGTGTGGGAGGCAGG - Intronic
1203780235 EBV:96626-96648 CAGGAGCAGGAGGTGGAGGCCGG + Intergenic
1186900161 X:14045893-14045915 GAGAAAAAGGGGTTGGAGGCTGG + Intergenic
1187502043 X:19846993-19847015 CTGAATCAGCTGTAAGAGGCAGG + Intronic
1189085188 X:38015525-38015547 AAGAGTCAGGTTTTGGAGTCAGG - Intronic
1189363097 X:40368553-40368575 CAGAATCAGCTGCTCCAGGCTGG - Intergenic
1194659099 X:96609060-96609082 GAGACTCAGCTGTTAGAGGCTGG - Intergenic
1195963135 X:110405824-110405846 CAGAACCAGGTGTTGGTGTCAGG - Intronic
1196068911 X:111497648-111497670 CAGAATCAGGATTTGGATACAGG + Intergenic
1196118708 X:112025153-112025175 CAGAATTATGTGTTGGAAGTGGG + Intronic
1197175099 X:123477150-123477172 CAGAAACAGGTTTTGGAGGAGGG - Intronic
1198789544 X:140328663-140328685 CACAAACAGGATTTGGAGGCAGG - Intergenic
1201902432 Y:19057336-19057358 CAGAACAAGGTGTGGGTGGCAGG + Intergenic
1201945183 Y:19503322-19503344 CAGAAATTGGTGTTGGAGGAAGG + Intergenic