ID: 1006344060

View in Genome Browser
Species Human (GRCh38)
Location 6:33465786-33465808
Sequence CAAAATGCTGATAGCAATAT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1006344056_1006344060 4 Left 1006344056 6:33465759-33465781 CCTAGAGACTTGTTGAATGGCTT 0: 1428
1: 1886
2: 1423
3: 807
4: 580
Right 1006344060 6:33465786-33465808 CAAAATGCTGATAGCAATATGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1006344060 Original CRISPR CAAAATGCTGATAGCAATAT GGG Intergenic
No off target data available for this crispr