ID: 1006347219

View in Genome Browser
Species Human (GRCh38)
Location 6:33492406-33492428
Sequence TTGTGGGTCTGGTGGCCACA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1006347219_1006347228 7 Left 1006347219 6:33492406-33492428 CCCTGTGGCCACCAGACCCACAA No data
Right 1006347228 6:33492436-33492458 GCATGCTCCAGAGGGACAGGAGG No data
1006347219_1006347225 -2 Left 1006347219 6:33492406-33492428 CCCTGTGGCCACCAGACCCACAA No data
Right 1006347225 6:33492427-33492449 AAAGTCTTAGCATGCTCCAGAGG No data
1006347219_1006347227 4 Left 1006347219 6:33492406-33492428 CCCTGTGGCCACCAGACCCACAA No data
Right 1006347227 6:33492433-33492455 TTAGCATGCTCCAGAGGGACAGG No data
1006347219_1006347230 21 Left 1006347219 6:33492406-33492428 CCCTGTGGCCACCAGACCCACAA No data
Right 1006347230 6:33492450-33492472 GACAGGAGGACTTAAGACCCAGG No data
1006347219_1006347231 24 Left 1006347219 6:33492406-33492428 CCCTGTGGCCACCAGACCCACAA No data
Right 1006347231 6:33492453-33492475 AGGAGGACTTAAGACCCAGGAGG No data
1006347219_1006347226 -1 Left 1006347219 6:33492406-33492428 CCCTGTGGCCACCAGACCCACAA No data
Right 1006347226 6:33492428-33492450 AAGTCTTAGCATGCTCCAGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1006347219 Original CRISPR TTGTGGGTCTGGTGGCCACA GGG (reversed) Intergenic
No off target data available for this crispr