ID: 1006349496

View in Genome Browser
Species Human (GRCh38)
Location 6:33510582-33510604
Sequence GAAACAAGGCCCCAAGTGAC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1006349493_1006349496 -6 Left 1006349493 6:33510565-33510587 CCAGGACTCCACTTCTGGAAACA No data
Right 1006349496 6:33510582-33510604 GAAACAAGGCCCCAAGTGACTGG No data
1006349490_1006349496 19 Left 1006349490 6:33510540-33510562 CCACTGCTCACAGATGTGGTTAT No data
Right 1006349496 6:33510582-33510604 GAAACAAGGCCCCAAGTGACTGG No data
1006349487_1006349496 30 Left 1006349487 6:33510529-33510551 CCATGAGACACCCACTGCTCACA No data
Right 1006349496 6:33510582-33510604 GAAACAAGGCCCCAAGTGACTGG No data
1006349489_1006349496 20 Left 1006349489 6:33510539-33510561 CCCACTGCTCACAGATGTGGTTA No data
Right 1006349496 6:33510582-33510604 GAAACAAGGCCCCAAGTGACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1006349496 Original CRISPR GAAACAAGGCCCCAAGTGAC TGG Intergenic