ID: 1006351120

View in Genome Browser
Species Human (GRCh38)
Location 6:33521779-33521801
Sequence GACCCCACACTCGGAGCAGC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1006351120_1006351131 24 Left 1006351120 6:33521779-33521801 CCGGCTGCTCCGAGTGTGGGGTC No data
Right 1006351131 6:33521826-33521848 CTCGAGCTGGCGCGCAGCCCTGG No data
1006351120_1006351126 11 Left 1006351120 6:33521779-33521801 CCGGCTGCTCCGAGTGTGGGGTC No data
Right 1006351126 6:33521813-33521835 CGCCCACCCGGAACTCGAGCTGG No data
1006351120_1006351122 -1 Left 1006351120 6:33521779-33521801 CCGGCTGCTCCGAGTGTGGGGTC No data
Right 1006351122 6:33521801-33521823 CTGCCGAGCCCGCGCCCACCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1006351120 Original CRISPR GACCCCACACTCGGAGCAGC CGG (reversed) Intergenic
No off target data available for this crispr