ID: 1006351123

View in Genome Browser
Species Human (GRCh38)
Location 6:33521804-33521826
Sequence GTTCCGGGTGGGCGCGGGCT CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 2088
Summary {0: 11, 1: 673, 2: 708, 3: 400, 4: 296}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1006351123_1006351131 -1 Left 1006351123 6:33521804-33521826 CCGAGCCCGCGCCCACCCGGAAC 0: 11
1: 673
2: 708
3: 400
4: 296
Right 1006351131 6:33521826-33521848 CTCGAGCTGGCGCGCAGCCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1006351123 Original CRISPR GTTCCGGGTGGGCGCGGGCT CGG (reversed) Intergenic
Too many off-targets to display for this crispr