ID: 1006351125

View in Genome Browser
Species Human (GRCh38)
Location 6:33521810-33521832
Sequence GCTCGAGTTCCGGGTGGGCG CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1006351125_1006351131 -7 Left 1006351125 6:33521810-33521832 CCGCGCCCACCCGGAACTCGAGC No data
Right 1006351131 6:33521826-33521848 CTCGAGCTGGCGCGCAGCCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1006351125 Original CRISPR GCTCGAGTTCCGGGTGGGCG CGG (reversed) Intergenic
No off target data available for this crispr