ID: 1006351131

View in Genome Browser
Species Human (GRCh38)
Location 6:33521826-33521848
Sequence CTCGAGCTGGCGCGCAGCCC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1006351120_1006351131 24 Left 1006351120 6:33521779-33521801 CCGGCTGCTCCGAGTGTGGGGTC No data
Right 1006351131 6:33521826-33521848 CTCGAGCTGGCGCGCAGCCCTGG No data
1006351124_1006351131 -6 Left 1006351124 6:33521809-33521831 CCCGCGCCCACCCGGAACTCGAG No data
Right 1006351131 6:33521826-33521848 CTCGAGCTGGCGCGCAGCCCTGG No data
1006351121_1006351131 15 Left 1006351121 6:33521788-33521810 CCGAGTGTGGGGTCTGCCGAGCC No data
Right 1006351131 6:33521826-33521848 CTCGAGCTGGCGCGCAGCCCTGG No data
1006351125_1006351131 -7 Left 1006351125 6:33521810-33521832 CCGCGCCCACCCGGAACTCGAGC No data
Right 1006351131 6:33521826-33521848 CTCGAGCTGGCGCGCAGCCCTGG No data
1006351116_1006351131 28 Left 1006351116 6:33521775-33521797 CCAGCCGGCTGCTCCGAGTGTGG 0: 32
1: 197
2: 325
3: 337
4: 422
Right 1006351131 6:33521826-33521848 CTCGAGCTGGCGCGCAGCCCTGG No data
1006351123_1006351131 -1 Left 1006351123 6:33521804-33521826 CCGAGCCCGCGCCCACCCGGAAC 0: 11
1: 673
2: 708
3: 400
4: 296
Right 1006351131 6:33521826-33521848 CTCGAGCTGGCGCGCAGCCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1006351131 Original CRISPR CTCGAGCTGGCGCGCAGCCC TGG Intergenic
No off target data available for this crispr