ID: 1006354487

View in Genome Browser
Species Human (GRCh38)
Location 6:33546676-33546698
Sequence CTGTAGTCCCAGATACAGGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1006354487_1006354497 28 Left 1006354487 6:33546676-33546698 CCTGCCTGTATCTGGGACTACAG No data
Right 1006354497 6:33546727-33546749 TTGTATATTTAGTAGAGACGGGG 0: 838
1: 101330
2: 219637
3: 153192
4: 80726
1006354487_1006354490 -3 Left 1006354487 6:33546676-33546698 CCTGCCTGTATCTGGGACTACAG No data
Right 1006354490 6:33546696-33546718 CAGGCGCCTGCCACAACGCCCGG 0: 46
1: 4493
2: 29219
3: 60105
4: 96894
1006354487_1006354495 26 Left 1006354487 6:33546676-33546698 CCTGCCTGTATCTGGGACTACAG No data
Right 1006354495 6:33546725-33546747 TTTTGTATATTTAGTAGAGACGG 0: 1616
1: 199368
2: 142424
3: 65563
4: 38494
1006354487_1006354496 27 Left 1006354487 6:33546676-33546698 CCTGCCTGTATCTGGGACTACAG No data
Right 1006354496 6:33546726-33546748 TTTGTATATTTAGTAGAGACGGG 0: 1327
1: 168386
2: 211929
3: 125950
4: 67493

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1006354487 Original CRISPR CTGTAGTCCCAGATACAGGC AGG (reversed) Intergenic
No off target data available for this crispr