ID: 1006358205

View in Genome Browser
Species Human (GRCh38)
Location 6:33573037-33573059
Sequence GTGTCTATAAGGAGAGAGGA AGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 346
Summary {0: 2, 1: 1, 2: 1, 3: 26, 4: 316}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1006358193_1006358205 30 Left 1006358193 6:33572984-33573006 CCCCCAGGGATGGGGGTGAGAGC 0: 2
1: 1
2: 3
3: 40
4: 383
Right 1006358205 6:33573037-33573059 GTGTCTATAAGGAGAGAGGAAGG 0: 2
1: 1
2: 1
3: 26
4: 316
1006358196_1006358205 27 Left 1006358196 6:33572987-33573009 CCAGGGATGGGGGTGAGAGCCTT 0: 2
1: 1
2: 1
3: 59
4: 1041
Right 1006358205 6:33573037-33573059 GTGTCTATAAGGAGAGAGGAAGG 0: 2
1: 1
2: 1
3: 26
4: 316
1006358202_1006358205 2 Left 1006358202 6:33573012-33573034 CCTGTAGTGAATGGGTTGGGAGC 0: 3
1: 0
2: 0
3: 8
4: 74
Right 1006358205 6:33573037-33573059 GTGTCTATAAGGAGAGAGGAAGG 0: 2
1: 1
2: 1
3: 26
4: 316
1006358194_1006358205 29 Left 1006358194 6:33572985-33573007 CCCCAGGGATGGGGGTGAGAGCC 0: 2
1: 1
2: 1
3: 31
4: 353
Right 1006358205 6:33573037-33573059 GTGTCTATAAGGAGAGAGGAAGG 0: 2
1: 1
2: 1
3: 26
4: 316
1006358199_1006358205 8 Left 1006358199 6:33573006-33573028 CCTTCACCTGTAGTGAATGGGTT 0: 3
1: 0
2: 0
3: 12
4: 82
Right 1006358205 6:33573037-33573059 GTGTCTATAAGGAGAGAGGAAGG 0: 2
1: 1
2: 1
3: 26
4: 316
1006358195_1006358205 28 Left 1006358195 6:33572986-33573008 CCCAGGGATGGGGGTGAGAGCCT 0: 2
1: 1
2: 0
3: 22
4: 384
Right 1006358205 6:33573037-33573059 GTGTCTATAAGGAGAGAGGAAGG 0: 2
1: 1
2: 1
3: 26
4: 316

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1006358205 Original CRISPR GTGTCTATAAGGAGAGAGGA AGG Exonic
902039080 1:13479868-13479890 GGGTCTACCAGGAGAGAAGAGGG - Intronic
905503187 1:38455525-38455547 CTGTCTATATGGACTGAGGATGG + Intergenic
906273676 1:44500783-44500805 GAGTCTCTAAAGAGAGAGGAGGG + Intronic
906947817 1:50310435-50310457 GTGTGTGTCAGGAGAGAGGTTGG - Intergenic
907281365 1:53349370-53349392 GTGACTGTGAGGAGACAGGAGGG - Intergenic
907799579 1:57751388-57751410 GGGTCTATAAGGGGAGACAAAGG + Intronic
909077222 1:71064450-71064472 ATGTCTACAAGGAGAGAAGTGGG - Exonic
909804969 1:79863113-79863135 TTGTCTAAGATGAGAGAGGATGG + Intergenic
910789133 1:91032963-91032985 GTGTTTTTAAAGAGAGAGCATGG + Intergenic
911256782 1:95642335-95642357 GTCTCTAGAAGGAGACAGGCAGG - Intergenic
911657965 1:100466232-100466254 GTGTCTATCTGGAGAGAAAAGGG - Intronic
911711969 1:101084242-101084264 ATGTATATATGGTGAGAGGAAGG - Intergenic
913311126 1:117495510-117495532 GTATCTGTAAGGATAGGGGAAGG - Intronic
916740916 1:167646318-167646340 GCGGCTATAAGGAGAGAAGCAGG + Intronic
919611074 1:199746320-199746342 GTGTCCATGATGAGAGAGGCAGG + Intergenic
920657414 1:207887199-207887221 GTGTCTTGGAGGAGAGATGAGGG + Exonic
920946854 1:210537417-210537439 GTGTCTATGAAGTGAGAAGAGGG - Intronic
920953447 1:210596140-210596162 GTTTCTATAAGGTGTAAGGAAGG + Intronic
922647704 1:227306621-227306643 ATCTCTATAAGTAGAGAGTATGG + Intronic
922686859 1:227646368-227646390 GTAACTCTAAGGAAAGAGGATGG - Intronic
922996135 1:229963092-229963114 GTGTAAACAAGGAGAGAGGTGGG + Intergenic
924405762 1:243744283-243744305 GTGACTGTAAGGGTAGAGGAAGG + Intronic
1063244637 10:4205571-4205593 CTGTCTTTCAGGAGAAAGGACGG + Intergenic
1063863728 10:10341443-10341465 GTGTTTATGAGGAGAGATGCAGG + Intergenic
1065356851 10:24850632-24850654 GTGTCTTTAAAGAGGGGGGAGGG + Intronic
1065433808 10:25686042-25686064 GTGTGTGTTAGGAGAGAGAAAGG - Intergenic
1067697027 10:48542890-48542912 GTGTCTGTATGTAGAAAGGAAGG + Intronic
1069632026 10:69902866-69902888 AAGTCTTGAAGGAGAGAGGAAGG - Intronic
1069659082 10:70111742-70111764 CTTTTTAAAAGGAGAGAGGAGGG + Exonic
1070358529 10:75663953-75663975 GTGTCTTTAAGAGGAGAGTAGGG + Intronic
1071348434 10:84715549-84715571 GTGACTGTAAAGAGAGAGGGAGG + Intergenic
1071369977 10:84941230-84941252 GTGTCTAAGAGGAGAGAGGAAGG + Intergenic
1071594419 10:86908855-86908877 ATGCCCACAAGGAGAGAGGAAGG + Intronic
1073931831 10:108585327-108585349 GTCTTTATAAGGAGACAGAAAGG + Intergenic
1074181438 10:111068402-111068424 GTCTTTATAAGGAAAGAAGAGGG + Intergenic
1074325604 10:112447547-112447569 GTGTCTATGAGGCGCGAGGCTGG + Intronic
1074708174 10:116154560-116154582 GTGACTAGAAGGAGTTAGGAGGG + Intronic
1074847413 10:117410542-117410564 GTGTCTCTAAAGGGAGAAGATGG + Intergenic
1075359171 10:121814262-121814284 GTGTCTAAAGGCAGACAGGAAGG + Intronic
1075392663 10:122103783-122103805 TTGTCTTGCAGGAGAGAGGAAGG + Intronic
1075896786 10:126003059-126003081 GAGACTATAAAGAGAGAGAATGG - Intronic
1077087342 11:760546-760568 GTGTTGATCAGGACAGAGGAAGG - Intronic
1077669004 11:4140282-4140304 GTCCCTATAAGGAAAGAGAAAGG - Intergenic
1078090484 11:8261915-8261937 GTGTGTAGGAAGAGAGAGGATGG - Intronic
1078215513 11:9308541-9308563 GTGGCTATAAGGAAAGAATAAGG - Intronic
1078939903 11:15990889-15990911 GTATCTAAAAATAGAGAGGAAGG - Intronic
1079582348 11:22081195-22081217 TTGTCTTTTAGGGGAGAGGATGG - Intergenic
1079723678 11:23851550-23851572 GTGTAGACAAGGAAAGAGGATGG - Intergenic
1080517897 11:33040224-33040246 GTGTCTAAAAAGAGAGCCGAGGG - Intronic
1080848823 11:36050053-36050075 TTGTTTATTTGGAGAGAGGAGGG + Intronic
1081264917 11:41008661-41008683 GTGTCTTCAAGGTGGGAGGAAGG - Intronic
1084604098 11:70162450-70162472 GTGGGGACAAGGAGAGAGGAGGG + Intronic
1085546338 11:77321697-77321719 GGGGCTATAATGAGAAAGGAAGG + Intronic
1086861561 11:91930799-91930821 GTGTCTATGTGGAGAGAGGTCGG + Intergenic
1087071954 11:94089949-94089971 ATGTCTATGAGGTGAGGGGAGGG - Intronic
1087294560 11:96355760-96355782 GTATCTTTAGGTAGAGAGGATGG - Intronic
1087943995 11:104136003-104136025 GAGTCTGGAAGGAGAAAGGAGGG + Intronic
1088919976 11:114253676-114253698 GTGTCTTCATGGGGAGAGGAAGG - Intergenic
1088998672 11:115029372-115029394 CTGTCTTTAAGGATAGAGGAAGG + Intergenic
1089185448 11:116611760-116611782 GTGTTACTAAGGAGAAAGGAGGG + Intergenic
1089529000 11:119114389-119114411 GTGTATAAAAGAAGAGATGAGGG - Intronic
1089654331 11:119935862-119935884 GGGTCTATAAGGAAAGCAGAGGG + Intergenic
1090050528 11:123374351-123374373 GGGTTTATTATGAGAGAGGAAGG - Intergenic
1090508422 11:127344938-127344960 GTGTCTACACTGAGAGAGAAAGG + Intergenic
1090847884 11:130546032-130546054 GTATCTATAAGGAGAGAGGAAGG + Intergenic
1091618295 12:2066647-2066669 GTGAATAAAAGGAGAGGGGAGGG + Intronic
1091705432 12:2690239-2690261 GTGTCAGAAAGGAGAGAGGCAGG + Intronic
1092216400 12:6686637-6686659 GTTTCTATCAGGATGGAGGATGG + Intronic
1092498160 12:9018747-9018769 TTGTATATCAAGAGAGAGGAGGG - Intergenic
1093834966 12:23817748-23817770 GGCTCTGTAAGTAGAGAGGAGGG - Intronic
1093936590 12:25008244-25008266 GTGTCCTGAAGGAGAGAGGCAGG + Intergenic
1096456139 12:51788645-51788667 GTGCCTATAAAGGGAGTGGATGG - Intronic
1096462312 12:51828863-51828885 GTGTTTCTAATGAGAAAGGAAGG - Intergenic
1096561354 12:52438059-52438081 GAGTTTATATGGAAAGAGGAGGG + Intergenic
1096985751 12:55755685-55755707 ATGACTATAATGAGATAGGAAGG + Exonic
1098105730 12:67068471-67068493 GTCTCTAGAAGGGGAGAGGAGGG - Intergenic
1098129045 12:67329067-67329089 GACTCCAAAAGGAGAGAGGAGGG - Intergenic
1099683312 12:85856131-85856153 GTGACAAGAAGGAGAGAAGAGGG - Intergenic
1100214643 12:92434959-92434981 CTGTCTCTAAAGAAAGAGGAAGG - Intergenic
1100337271 12:93642960-93642982 GTGTCTATGAGGATAGGGGAAGG + Intergenic
1101030202 12:100650876-100650898 ATATCTATTAGGAGAGAAGAGGG - Intergenic
1102538568 12:113601083-113601105 AGGAGTATAAGGAGAGAGGAGGG + Intergenic
1103927292 12:124429922-124429944 GGGTGTTTTAGGAGAGAGGAAGG - Intronic
1104275860 12:127327196-127327218 GTGTGTAGAAGGAAAGAGGAAGG + Intergenic
1106043290 13:26114410-26114432 GTGTCTATGGTGACAGAGGATGG + Intergenic
1106300536 13:28460256-28460278 GGGTCTCTAAGGAGTGAAGAGGG - Intronic
1107503189 13:41002079-41002101 GAGTATATAAGGTGAGGGGAAGG + Intronic
1108313537 13:49218029-49218051 TTGGGTCTAAGGAGAGAGGAGGG + Intergenic
1111636690 13:90913858-90913880 GTATCTGTAATGACAGAGGAGGG + Intergenic
1114492273 14:23110661-23110683 ATGGGGATAAGGAGAGAGGATGG + Intergenic
1116789284 14:49322551-49322573 GTGTATATATGGAAAGATGAAGG + Intergenic
1118102756 14:62624936-62624958 GTGTGTGAAAGGAAAGAGGAGGG - Intergenic
1118174805 14:63427678-63427700 GTGGCTATAAGGACAAAGCAAGG + Intronic
1118989293 14:70783385-70783407 CTTTCTATAAGGACAGTGGATGG - Intronic
1119020747 14:71110592-71110614 GTGTTTATAAGGAAAGGGAAGGG - Exonic
1119080581 14:71689841-71689863 GTGTCTGTAAGGAAGGAGGGAGG - Intronic
1119256286 14:73200752-73200774 GTTTCAAGAAGGAGAGAGGCTGG + Intronic
1121155234 14:91677043-91677065 TTTTCTATAAGGTGTGAGGAAGG - Intronic
1121702921 14:95969808-95969830 GAGACTAGGAGGAGAGAGGAGGG - Intergenic
1123452196 15:20375372-20375394 GTTTGTATAAGGTGAAAGGAAGG - Intergenic
1124702340 15:31927086-31927108 GGGTAGATAAGGAGATAGGATGG - Intergenic
1124725630 15:32153559-32153581 GTGTCTAGAAGAACAGAGGGTGG - Intronic
1125459994 15:39896865-39896887 GTCTCTATAAAGAGAGAGAGAGG + Intronic
1126794433 15:52248623-52248645 ATGTATATAAGGAAAGAGTAAGG - Intronic
1128647097 15:69385715-69385737 GTGTATATGAAGAAAGAGGATGG - Intronic
1129107552 15:73320040-73320062 GTGTGTGTAAGTAGAGAAGAGGG + Exonic
1131031153 15:89186933-89186955 GTGTCTGGAAGGAGAGCAGAGGG + Intronic
1133966804 16:10537603-10537625 GTGTCTCAATAGAGAGAGGAGGG - Intronic
1134071772 16:11264761-11264783 GTTTCTATTAGGAGAGGGTATGG - Intronic
1134310173 16:13068529-13068551 GAGTTTAGATGGAGAGAGGATGG + Intronic
1135889200 16:26342117-26342139 GTGGCTTGAAGGAGAGAGGAAGG - Intergenic
1136265741 16:29117064-29117086 GTGTCTGGGAGGAGAGAGAATGG + Intergenic
1136855770 16:33655993-33656015 ATGTTTATAGGGATAGAGGAAGG - Intergenic
1137501127 16:49012612-49012634 ATGTCTTTAAGGAGAGAAGCAGG - Intergenic
1138569090 16:57856450-57856472 GTGTCTAAAAAAAGAAAGGAAGG + Intronic
1138748401 16:59390149-59390171 ATTTCTATAAGCAAAGAGGAAGG + Intergenic
1139073777 16:63417976-63417998 TTCTCTATTAGGAGAGATGAGGG + Intergenic
1139572665 16:67823012-67823034 GTGTCTAGAAGGCAAGAGGCTGG + Intronic
1140514732 16:75533712-75533734 CTGTGTAAAAGGAGAGAGAAAGG + Intronic
1141782274 16:86170910-86170932 ATGTCTACATGGAGAGAGTAAGG + Intergenic
1142054559 16:87984998-87985020 GTGTCTGGGAGGAGAGAGAATGG + Intronic
1203117355 16_KI270728v1_random:1504474-1504496 ATGTTTATAGGGATAGAGGAAGG - Intergenic
1143228023 17:5324406-5324428 GTGTATATATGGAGAGAGATGGG - Intronic
1143421953 17:6800348-6800370 GTCTTCATGAGGAGAGAGGAAGG - Intronic
1143660286 17:8320505-8320527 GTGACTAGCAGGAGAGAGAAAGG + Intronic
1144311401 17:14017411-14017433 GTGTCGACAAGGAGTGAGGGTGG - Intergenic
1144673297 17:17145165-17145187 CTGTCTCTGAGGAGTGAGGAAGG - Intronic
1145835041 17:27948505-27948527 TTGTCTATGAGGAGAATGGAGGG - Intergenic
1146657902 17:34645753-34645775 GTGTCTATGTGTAGAGAGGGTGG - Intergenic
1147014412 17:37479504-37479526 CTGTCTAGAAGCAAAGAGGAAGG - Exonic
1153143679 18:2003256-2003278 GTGTGTGTAAGGAGACAGAAAGG + Intergenic
1153197049 18:2611837-2611859 ATGTCTTTCAGGGGAGAGGATGG - Intronic
1154058912 18:11039923-11039945 GTGTCTATACGGGGTGGGGAGGG - Intronic
1157747290 18:50147033-50147055 CTGTCTGTAAGGAGACAAGATGG - Intronic
1158098252 18:53799638-53799660 GTGGCTATAAAGAGATGGGAAGG + Intergenic
1159160530 18:64638392-64638414 GTGTCAGTAATGAGAGTGGAGGG - Intergenic
1159915932 18:74187686-74187708 GTGGCAAGGAGGAGAGAGGAAGG - Intergenic
1159994998 18:74955829-74955851 GTGTGTGCAGGGAGAGAGGATGG - Intronic
1160174517 18:76581639-76581661 GTGTGCATGAGGAGGGAGGAAGG - Intergenic
1161002089 19:1915644-1915666 GTGTTTATAAGAAGAGATGGAGG + Intronic
1161412245 19:4123371-4123393 ATGTCTCTAAGAGGAGAGGATGG - Intronic
1163034099 19:14561625-14561647 GTGGCTATAAGGTGAGAAGTGGG + Intronic
1164470824 19:28530307-28530329 GTGTGTATCTGGAGAGAGTAGGG - Intergenic
1164592291 19:29513484-29513506 GGGGGTATAAGGAGAAAGGAGGG + Intergenic
1166900364 19:46056900-46056922 GGGTGTATAGGGAGAGAAGAGGG - Intronic
1167815850 19:51880339-51880361 ATGTCTGTGAGGAGAGAGCAAGG - Exonic
925260672 2:2525700-2525722 GTTTCTGTAAGGAAGGAGGAGGG + Intergenic
925363255 2:3294440-3294462 GTGTGTGTTTGGAGAGAGGATGG - Intronic
925363298 2:3294638-3294660 GTGTGTGTTTGGAGAGAGGATGG - Intronic
925363325 2:3294769-3294791 GTGTGTATGTAGAGAGAGGATGG - Intronic
925363413 2:3295220-3295242 GTGTATGTGTGGAGAGAGGACGG - Intronic
925363484 2:3295554-3295576 GTGTGTGTGTGGAGAGAGGATGG - Intronic
925363498 2:3295619-3295641 GTGTGTGTATGTAGAGAGGATGG - Intronic
925363505 2:3295654-3295676 GTGTGTGTGAGTAGAGAGGACGG - Intronic
925363517 2:3295719-3295741 GTGTGTGTATGTAGAGAGGATGG - Intronic
925363582 2:3296026-3296048 GTGTGTGTGAGTAGAGAGGATGG - Intronic
925363670 2:3296447-3296469 GTGTGTGTGTGGAGAGAGGATGG - Intronic
926644936 2:15280325-15280347 GTGCTTAGAAGGAAAGAGGAAGG + Intronic
926827396 2:16920405-16920427 ATATCTATTAAGAGAGAGGAAGG + Intergenic
927020872 2:19015716-19015738 TTTTCTATAAGGTGTGAGGAAGG + Intergenic
927324393 2:21786828-21786850 TTATCTCTAGGGAGAGAGGAAGG + Intergenic
927843261 2:26458281-26458303 GGGTCCAGAAGGACAGAGGATGG - Intronic
928180939 2:29067843-29067865 GTGGCTTGAAAGAGAGAGGACGG - Intronic
928235503 2:29535974-29535996 GTGTAAATCGGGAGAGAGGAAGG - Intronic
928430850 2:31217365-31217387 GGGTTTAGAAGGTGAGAGGATGG - Intronic
928744395 2:34394594-34394616 GTATCTTTTAGGAAAGAGGAAGG - Intergenic
931727922 2:65129531-65129553 TTGTCTCTAAGGGGAGGGGATGG - Intronic
931752330 2:65341022-65341044 ATATCTCTAAGGAGAGAGAAAGG + Intronic
935899526 2:107775862-107775884 GTGTCTCTAAAGAGATAGGAGGG - Intergenic
936798405 2:116235751-116235773 GTTTGTATAAGGTGTGAGGAAGG - Intergenic
937826418 2:126372591-126372613 GGGTCTTTAAGGACACAGGATGG - Intergenic
939247847 2:139648022-139648044 TTTTCTATAAGGTGTGAGGAAGG + Intergenic
940349882 2:152671553-152671575 CTATCTCTAAGGAGAGAGGGAGG - Intronic
940634448 2:156280967-156280989 GTGTCCAAAAGGAGACAGGGAGG + Intergenic
941391030 2:164914890-164914912 GTGTGTGGAAGGAGAGAGTATGG + Intronic
941867492 2:170349959-170349981 GTGTGTATATTGAGAGAGGAAGG - Intronic
943617222 2:190107148-190107170 GTATCTAAAATGTGAGAGGAGGG + Intronic
944287683 2:197970243-197970265 GTGTGTAAAAAGAGAGAGCATGG + Intronic
944451508 2:199848335-199848357 GTGTCTATACAGAGAAAAGAGGG + Intronic
944517931 2:200531101-200531123 ATGTCTTTAAGGAGGCAGGAAGG + Intronic
945256081 2:207804373-207804395 GTGTGCAGAAGGAGACAGGAAGG + Intergenic
945634209 2:212326855-212326877 CTGTCTGTAAGGATAGAGAATGG + Intronic
945775850 2:214104892-214104914 GTGTCTGAAAGGGGAGGGGAAGG + Intronic
946167934 2:217876734-217876756 GTCTTTATAAGAAGAGATGAGGG + Intronic
946907175 2:224428640-224428662 TTGTGTATAAAGAGAGAGAATGG - Intergenic
947434739 2:230063402-230063424 GAGGCTGGAAGGAGAGAGGAGGG - Intronic
947496076 2:230638095-230638117 GTATCCATTAGGAGACAGGAGGG + Intergenic
947637352 2:231686777-231686799 GTGCCTACAAGGAGAAAGGGAGG - Intergenic
948645787 2:239403041-239403063 CTGTGTATAAGGAGAAAGGTGGG + Intergenic
1170341137 20:15328284-15328306 GTGGCCAGAGGGAGAGAGGAGGG + Intronic
1171295466 20:24012947-24012969 GTGTCTTTACAGAGAGAAGAGGG - Intergenic
1172136360 20:32689414-32689436 GTGTCTATAAGGAGAGAGGAAGG + Intergenic
1173171240 20:40725737-40725759 CTGTCTTTAAGGAGAAAGAAGGG - Intergenic
1174103101 20:48142201-48142223 CTGTGTATGAGGAGGGAGGAGGG - Intergenic
1174727114 20:52874506-52874528 GTAACTAAAAGGAGAGAGGTAGG - Intergenic
1175961590 20:62639932-62639954 ATGTCCATAAAGAGAGAGGGAGG + Intergenic
1178301040 21:31453347-31453369 GTGTCTATAGGTAGGGAGAACGG + Intronic
1178336355 21:31747009-31747031 GTGTGAATCAGGAGAGAGGGTGG + Intergenic
1178511945 21:33212737-33212759 GTGTGTAGAGGGAGAGAGAAGGG + Intergenic
1179145784 21:38766213-38766235 GTCTTTATAAGAAGAGAAGAAGG + Intergenic
1179466570 21:41579705-41579727 TTTTCTGTAAGCAGAGAGGAGGG - Intergenic
1181291376 22:21796376-21796398 ATGTCTTAAAGAAGAGAGGAAGG + Intronic
1182093026 22:27608962-27608984 ATGGCTAGGAGGAGAGAGGAGGG + Intergenic
1182985798 22:34714959-34714981 GTGTGTATATGGACAGAGGTGGG - Intergenic
1185029234 22:48432864-48432886 GTGTCTATATCCAGAGAGAAGGG + Intergenic
950110599 3:10416375-10416397 TTGGCTAAAAAGAGAGAGGAAGG - Intronic
950596751 3:13990880-13990902 GTTTCTATAAGGTGTAAGGAAGG + Intronic
951172514 3:19558174-19558196 GTGTGTATAAGGTGTAAGGAAGG + Intergenic
951420879 3:22483357-22483379 TTTTCTATAAGGAGTAAGGAAGG - Intergenic
951537209 3:23751025-23751047 GTGTGGGTAGGGAGAGAGGAAGG - Intergenic
952448031 3:33402480-33402502 GTGTCTATAGGTAGAGAGAGAGG - Intronic
952952726 3:38537987-38538009 ATCTCTATAGGGAGAGATGAGGG - Intronic
954264075 3:49459830-49459852 GAGTGAATAAGGAAAGAGGAGGG - Intergenic
955177765 3:56633840-56633862 GTGTCTGTAAATGGAGAGGATGG + Exonic
955592028 3:60547411-60547433 TTGTTTATAAAGAGAGAGTAGGG - Intronic
956009803 3:64818399-64818421 GTGGTTATCAGGAGAGAGAAGGG - Intergenic
956643145 3:71433367-71433389 GTGTCTATCAGAACAGAGCAAGG + Intronic
959408053 3:105985872-105985894 GTGGCTACAAGAAGAGATGATGG - Intergenic
960206949 3:114913754-114913776 TTGTATATAATGAGAGAGAAGGG + Intronic
960600267 3:119450298-119450320 GTGTTTAAAATGAGACAGGAGGG - Intronic
961817095 3:129556688-129556710 ATTTCTATAAGGAGGCAGGATGG + Exonic
962243620 3:133772612-133772634 TTCTCTATAAGGATAGAGGCTGG - Intronic
962403493 3:135081055-135081077 GTCTCTAGATGGAGATAGGATGG - Intronic
967089389 3:186122279-186122301 GTGCCTAGAAGGAGGGAGGGTGG - Intronic
967938533 3:194748428-194748450 GTGTCTGTAACGTGAGAGGTCGG + Intergenic
968714931 4:2149780-2149802 GTGTCTAAAAAGAGAGAGAGAGG + Intronic
969515032 4:7642444-7642466 GTGACTATAAGGGGAGAAAAAGG + Intronic
969789389 4:9481528-9481550 ATATCCATAGGGAGAGAGGATGG - Intergenic
970306548 4:14738452-14738474 AAGTATTTAAGGAGAGAGGAAGG - Intergenic
970662722 4:18304425-18304447 GTGTGTATAAGCAGAGAGTGAGG - Intergenic
972302562 4:37798838-37798860 GTGTCTAAAAGGAAAGAGAAAGG + Intergenic
972371418 4:38427178-38427200 GTGTATATAAGAAGAGTGAATGG - Intergenic
972984311 4:44745159-44745181 GTTTCTATAAGGTGTGAGGAAGG + Intergenic
973120461 4:46515515-46515537 GTGTCTATAGTTAAAGAGGAAGG - Intergenic
973595006 4:52479020-52479042 GTGGCAATAGGGAAAGAGGAAGG - Intergenic
975003985 4:69264483-69264505 ATGTTTATAAGGAGAAAGGTAGG + Intergenic
975698528 4:77039105-77039127 ATGTCCATTAGGAGAGAGTAGGG - Intronic
977030831 4:91880675-91880697 GTGTCTGTAAGGAGTGAGGGAGG - Intergenic
977757662 4:100692492-100692514 GTGTATATAAGAAGAGTAGATGG - Intronic
979875668 4:125887877-125887899 GTGTCTACAAGGATAGTGGATGG - Intergenic
983317845 4:166154836-166154858 GTGGCTAAGAGGAGAGAGAAGGG + Intergenic
983860577 4:172700864-172700886 GTGTATCTATGGAAAGAGGAGGG + Intronic
983891623 4:173035553-173035575 GTGTGTATGAGGAGAGAGCATGG - Intronic
983954910 4:173686274-173686296 GACTCTGTAAGGAGAGAGCATGG - Intergenic
984595118 4:181657978-181658000 GACTCTAAAAGGAGGGAGGAAGG + Intergenic
986529847 5:8724992-8725014 GTGTCTCTAAGAAGAGAAAAAGG - Intergenic
986856856 5:11879157-11879179 GTGTCTATGAAAGGAGAGGAAGG + Intronic
988158885 5:27493321-27493343 TTGTCTCTATGGAAAGAGGAAGG - Intergenic
988809796 5:34773228-34773250 TTGTATATAGGGAGAGAGGAGGG - Intronic
990994984 5:61723659-61723681 GTGTCTAGAAGGAGAGTAGGTGG - Intronic
991544560 5:67767100-67767122 GTGTCTATAAGGACTGGGGTTGG - Intergenic
993760732 5:91793572-91793594 GTGTATATATAGAGAGAGGGGGG - Intergenic
994044271 5:95290633-95290655 GTGGCCAGAAGGAGAGAGGGAGG + Intergenic
995994169 5:118279660-118279682 GTGTCTCTACTGAGAGAGCAGGG + Intergenic
998030271 5:138860852-138860874 GGGTCTATCAGGAGAGAAGATGG + Intronic
1000126577 5:158251022-158251044 GTGTACTTAAGGAGACAGGAAGG - Intergenic
1000249314 5:159479146-159479168 GTGGTTACAGGGAGAGAGGAAGG - Intergenic
1000613702 5:163404629-163404651 GTGTGTGTAAGGAGGGAGGGGGG - Intergenic
1002606079 5:180383527-180383549 GTGTCTAGATAGAAAGAGGAAGG + Intergenic
1002962098 6:1924814-1924836 GAGCCTATATGGAGAGAGGTGGG + Intronic
1003271440 6:4611185-4611207 CTGTTCATAAGGAGAGAGAAAGG + Intergenic
1003382737 6:5639633-5639655 GTGGATAGAAGAAGAGAGGAAGG - Intronic
1003683602 6:8279545-8279567 GTGTCCATTAGGAGACAAGATGG + Intergenic
1004095211 6:12547536-12547558 GTGTCCAGGAGGAGAGAAGAGGG - Intergenic
1004584599 6:16987340-16987362 GTGTCCCTAAGGGAAGAGGAAGG - Intergenic
1005094880 6:22103936-22103958 GTGTCTCTCAGGAGAGATGAGGG + Intergenic
1005164796 6:22907375-22907397 GTGTGTGTAGGGAGTGAGGATGG - Intergenic
1005993287 6:30916661-30916683 GATTCTATAGGAAGAGAGGAGGG - Intronic
1006358205 6:33573037-33573059 GTGTCTATAAGGAGAGAGGAAGG + Exonic
1006795285 6:36728525-36728547 ATGTTTATCAGCAGAGAGGAAGG + Intronic
1006861914 6:37177416-37177438 GTGGCTATAAAGAGGAAGGAAGG + Intergenic
1008912172 6:56746636-56746658 GAAGCTATAAGGAGAGAGGTTGG + Intronic
1009439398 6:63658754-63658776 GTGTTTATAACGAGAGAGAGAGG + Intronic
1011207724 6:84918347-84918369 GTGTGTATCAGGGGAGAGGATGG + Intergenic
1012208709 6:96494138-96494160 GGGTCTATCAGAAGGGAGGAGGG + Intergenic
1014015546 6:116526145-116526167 TTGTCTATAGGGAAAGAGGTAGG - Intronic
1014964106 6:127725142-127725164 GTTTATATAAGCAGAGAGGGAGG - Intronic
1015019994 6:128461708-128461730 GTTTCTTTTAGGAGAGAGAAAGG - Intronic
1016143039 6:140636993-140637015 GTCTATATAAGGAGAGAAGAAGG + Intergenic
1016713674 6:147201338-147201360 GTGTCTCTGAGCACAGAGGATGG + Intergenic
1018325762 6:162666171-162666193 ATGTCTATAAGAAAAGAGGAGGG + Intronic
1018995551 6:168707147-168707169 GTGTCTGTAAAGAGTTAGGAAGG - Intergenic
1019026836 6:168972910-168972932 GTGTGTGTATGGAGAGAGAAAGG - Intergenic
1019088185 6:169501339-169501361 GTGTCTGTGAGGACAGAGGGTGG + Intronic
1019362586 7:612590-612612 GTGGCTATTAGAGGAGAGGAAGG + Intronic
1020934157 7:14439478-14439500 TTATCTATGAGGAGAGAGGATGG - Intronic
1021199521 7:17712500-17712522 GGGCCTATCAGGGGAGAGGACGG + Intergenic
1021311697 7:19105671-19105693 GTGTCTTTTGAGAGAGAGGAGGG + Intronic
1024167253 7:46747253-46747275 GTGTCTAGAGGGAGGAAGGAGGG - Intronic
1025280630 7:57624439-57624461 TTGTCTATTACAAGAGAGGATGG + Intergenic
1025304100 7:57841068-57841090 TTGTCTATTACAAGAGAGGATGG - Intergenic
1025621590 7:63176822-63176844 GACTCTAAAAGGAGAGAGGAAGG - Intergenic
1028346494 7:89790158-89790180 TTTTCTATAAGGTGTGAGGAAGG + Intergenic
1029467713 7:100736686-100736708 GTGGCTAGATGGAGAGAGAAGGG + Intronic
1029668246 7:102009686-102009708 GATTCTGTAAGGAGAGAGAAGGG - Intronic
1030952772 7:115812781-115812803 GTGTCTCTAATTAGAGTGGAAGG + Intergenic
1030964233 7:115969768-115969790 GTGGCTGTAGGGAGAGATGATGG + Intronic
1031391138 7:121216546-121216568 GAGTCTAAAACCAGAGAGGAAGG - Intronic
1031596069 7:123650550-123650572 GTGGCTATTAGGAGTGGGGAGGG + Intergenic
1032482093 7:132255419-132255441 GTGCCTATAAGGACAGATGCTGG - Intronic
1033548115 7:142420936-142420958 GTGTCTGTATGGACAGTGGAGGG + Intergenic
1034021907 7:147653646-147653668 GGGTGTATAAGCAGAGGGGAGGG + Intronic
1034118919 7:148609611-148609633 TTCTCTCTAAGGAGGGAGGAAGG + Intronic
1035162260 7:156959785-156959807 GTGTGTTGAAGGAGAAAGGAAGG + Intronic
1035925811 8:3726396-3726418 GTCTCTATAATTAGAAAGGATGG + Intronic
1035976520 8:4318338-4318360 GTGCATAAAAAGAGAGAGGAGGG - Intronic
1037729119 8:21508506-21508528 GTGTCTAATAGGAGAGATGAAGG - Intergenic
1038366015 8:26936107-26936129 GTTTGTATAAGGTGTGAGGAAGG + Intergenic
1038917874 8:32046782-32046804 GTGACTACAAGGAGATAGCATGG + Intronic
1039225127 8:35379757-35379779 GTGTGTATGAGGAGAGACAAAGG + Intronic
1039470302 8:37809350-37809372 GGGTCTATCTGGGGAGAGGAGGG - Intronic
1039521293 8:38174577-38174599 GGATATATAAGGAGAGATGAGGG + Intronic
1041212146 8:55563371-55563393 GTGTAGGTAAGGTGAGAGGAGGG + Intergenic
1043462817 8:80477982-80478004 GTGTCAATTAGGAGAAGGGAGGG + Intergenic
1044328027 8:90882756-90882778 TTGTCTGTAAAGAGAGAGAAGGG + Intronic
1045559331 8:103245752-103245774 GTGACTGGAAGGAGAGAGGGAGG + Intergenic
1045855049 8:106755381-106755403 GTGTACAGGAGGAGAGAGGATGG - Intergenic
1046612542 8:116442036-116442058 GTGCCTAGAAGGTGAGGGGAAGG - Intergenic
1050221317 9:3393818-3393840 GACTCTAAAAGGAGAGAGGGTGG + Intronic
1052661551 9:31439408-31439430 CTGTCTATAAGGAGAAAAGTGGG - Intergenic
1056245909 9:84695125-84695147 CTATCTATAAGGAGGGAGGATGG + Intronic
1057282136 9:93720635-93720657 GTCTCTGTCAGGAGGGAGGAGGG - Intergenic
1057908715 9:99002114-99002136 GGGAATAAAAGGAGAGAGGAGGG - Intronic
1058689133 9:107504494-107504516 GTGTATGTTAGGGGAGAGGAGGG - Intergenic
1058968188 9:110056169-110056191 GTGTGTAGAAGGTGTGAGGAAGG + Intronic
1060248246 9:121964657-121964679 GAGTGTATTAGGAGAGAGGAAGG - Intronic
1186399332 X:9242236-9242258 GTGACTAGAAGGAATGAGGAAGG - Intergenic
1186976437 X:14911531-14911553 GTGTGTAAAAAGAAAGAGGAAGG + Intronic
1187066759 X:15847956-15847978 CTGTGGATAAGGAGCGAGGATGG - Intronic
1187678283 X:21739977-21739999 GTTTTAATAAGTAGAGAGGAAGG - Intronic
1188294922 X:28435663-28435685 GTTTCTATAAGCAGAGTGTAAGG + Intergenic
1188458541 X:30395484-30395506 GTGTCTATAGACAGAGGGGAAGG + Intergenic
1189194838 X:39144105-39144127 GTGCCTCTCAGGAGAGAGGCAGG - Intergenic
1189756642 X:44278628-44278650 GAGTCTATAGGGAAGGAGGAAGG - Intronic
1191916217 X:66204160-66204182 TTGTCTATAAGGACACAGCATGG + Intronic
1192764231 X:74125970-74125992 CTGGGTATAAGGTGAGAGGATGG + Intergenic
1193212646 X:78825815-78825837 ATGTCTTTAAGGAAAGATGATGG + Intergenic
1193248429 X:79258957-79258979 GTGTCTTTGTGGAGAGAGGTAGG + Intergenic
1193673424 X:84417876-84417898 CTTTCTCTAACGAGAGAGGAGGG + Intronic
1193797049 X:85890037-85890059 GACTCTAAAAGGAGGGAGGAAGG + Intronic
1193899145 X:87154026-87154048 GTGTCTATAAGCCAAGAGGTGGG - Intergenic
1194590003 X:95788682-95788704 TTGTCTGTAAGGAGTGAGAAAGG - Intergenic
1196920150 X:120576993-120577015 GTTGCTAGAAGCAGAGAGGAAGG + Intergenic
1197121250 X:122895659-122895681 GTCTATATAAGGAAAGAGGGAGG - Intergenic
1198263386 X:134987066-134987088 GTGTCTAGCATGAGAGAGAAGGG + Intergenic
1199030793 X:142996814-142996836 ATGTCTATAAAGATAGAGGAGGG + Intergenic