ID: 1006358436

View in Genome Browser
Species Human (GRCh38)
Location 6:33574079-33574101
Sequence CATGAAGTCGACCACGAAGC GGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 40
Summary {0: 1, 1: 0, 2: 1, 3: 0, 4: 38}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1006358431_1006358436 14 Left 1006358431 6:33574042-33574064 CCCTCTGTGCAATCCACCGGGCA 0: 2
1: 0
2: 0
3: 9
4: 91
Right 1006358436 6:33574079-33574101 CATGAAGTCGACCACGAAGCGGG 0: 1
1: 0
2: 1
3: 0
4: 38
1006358430_1006358436 15 Left 1006358430 6:33574041-33574063 CCCCTCTGTGCAATCCACCGGGC 0: 2
1: 0
2: 0
3: 6
4: 85
Right 1006358436 6:33574079-33574101 CATGAAGTCGACCACGAAGCGGG 0: 1
1: 0
2: 1
3: 0
4: 38
1006358425_1006358436 23 Left 1006358425 6:33574033-33574055 CCCAGCCACCCCTCTGTGCAATC 0: 2
1: 0
2: 2
3: 14
4: 195
Right 1006358436 6:33574079-33574101 CATGAAGTCGACCACGAAGCGGG 0: 1
1: 0
2: 1
3: 0
4: 38
1006358434_1006358436 -2 Left 1006358434 6:33574058-33574080 CCGGGCAATGCAGTGATGCAGCA 0: 2
1: 0
2: 0
3: 13
4: 143
Right 1006358436 6:33574079-33574101 CATGAAGTCGACCACGAAGCGGG 0: 1
1: 0
2: 1
3: 0
4: 38
1006358433_1006358436 1 Left 1006358433 6:33574055-33574077 CCACCGGGCAATGCAGTGATGCA 0: 2
1: 0
2: 0
3: 5
4: 90
Right 1006358436 6:33574079-33574101 CATGAAGTCGACCACGAAGCGGG 0: 1
1: 0
2: 1
3: 0
4: 38
1006358426_1006358436 22 Left 1006358426 6:33574034-33574056 CCAGCCACCCCTCTGTGCAATCC 0: 2
1: 0
2: 1
3: 18
4: 223
Right 1006358436 6:33574079-33574101 CATGAAGTCGACCACGAAGCGGG 0: 1
1: 0
2: 1
3: 0
4: 38
1006358427_1006358436 18 Left 1006358427 6:33574038-33574060 CCACCCCTCTGTGCAATCCACCG 0: 2
1: 0
2: 1
3: 8
4: 114
Right 1006358436 6:33574079-33574101 CATGAAGTCGACCACGAAGCGGG 0: 1
1: 0
2: 1
3: 0
4: 38
1006358432_1006358436 13 Left 1006358432 6:33574043-33574065 CCTCTGTGCAATCCACCGGGCAA 0: 2
1: 0
2: 0
3: 7
4: 68
Right 1006358436 6:33574079-33574101 CATGAAGTCGACCACGAAGCGGG 0: 1
1: 0
2: 1
3: 0
4: 38

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1006358436 Original CRISPR CATGAAGTCGACCACGAAGC GGG Exonic
906206512 1:43990316-43990338 CACGAAGCTGACCATGAAGCGGG + Exonic
922965562 1:229688213-229688235 CATTAAGTCTACCAAAAAGCGGG + Intergenic
1080813194 11:35726522-35726544 CATGAAGTAGAGCATAAAGCAGG + Intronic
1083510900 11:63208801-63208823 CATGAAGCTGGCCATGAAGCTGG - Intronic
1084084786 11:66849991-66850013 CAGGAACTCCACCACGGAGCGGG + Exonic
1085487708 11:76881544-76881566 CATGAAGTGGTCCATGAAGTGGG - Intronic
1086405135 11:86493157-86493179 CATGGAGTTGACAACCAAGCTGG - Intronic
1087714802 11:101595445-101595467 CATGAGGTCTACCAAAAAGCAGG - Intronic
1088329102 11:108631982-108632004 CATGTATTCGACCATGATGCTGG + Intergenic
1093147594 12:15585385-15585407 CATGAAGTCTACAAAGACGCTGG - Intronic
1120399467 14:84010648-84010670 TATGAAGATGACCATGAAGCAGG - Intergenic
1130709376 15:86264733-86264755 CTTGAAGTCCACCACAGAGCTGG - Exonic
1132511269 16:342793-342815 CACGAAGTCGCCCACCAGGCAGG + Intronic
1135324906 16:21520174-21520196 CATGATGGCGACCACGATGACGG + Intergenic
1146850602 17:36218529-36218551 AATGTAGTGGACCACGAAACAGG - Intronic
1147731874 17:42609266-42609288 CTGAAAGTCGACCCCGAAGCCGG + Exonic
1148380441 17:47192940-47192962 TATGAAATAGACCAAGAAGCAGG - Intergenic
1150755656 17:67910049-67910071 CAGAAAGTAGACCACTAAGCTGG - Intronic
1151472409 17:74326418-74326440 ACTGAAGTAGACCACGGAGCGGG - Intronic
1155078952 18:22388694-22388716 CATGAAGTCAACCCTGAGGCTGG + Intergenic
1163722509 19:18904956-18904978 CATGCAGTGGAGCACAAAGCAGG - Intronic
1166660991 19:44647256-44647278 CACGGAGTCGCCCAAGAAGCCGG - Exonic
929005384 2:37388415-37388437 CATGAAGTCTAGAATGAAGCAGG - Intergenic
935408720 2:102736765-102736787 CATGAACTCGGCCCCGAGGCTGG - Exonic
1172136557 20:32690330-32690352 CATGAAGTCCACCACAAAGCGGG + Intergenic
1178829359 21:36042490-36042512 CATGAAGCCAATCTCGAAGCTGG + Intronic
1185281084 22:49970190-49970212 CATGGAGTAGACCAGGAGGCAGG - Intergenic
966644555 3:182230076-182230098 CTTGAAGTCACCCACGAAGATGG + Intergenic
995566048 5:113433903-113433925 CAAGAAGTCTGCCACCAAGCTGG - Exonic
1001776026 5:174329617-174329639 CATGAAGTAGCCCAACAAGCTGG - Intergenic
1001825486 5:174741882-174741904 CATGAAGTAGAGGAGGAAGCAGG + Intergenic
1006358436 6:33574079-33574101 CATGAAGTCGACCACGAAGCGGG + Exonic
1013287007 6:108690505-108690527 CATGAAGTGGACCAGGGAGAGGG - Intergenic
1014793415 6:125701140-125701162 CATGCAGTCCATCAGGAAGCTGG - Intergenic
1031834217 7:126662917-126662939 CATGAAGCCAGGCACGAAGCTGG + Intronic
1036989036 8:13570749-13570771 AATGAAGACGACGAAGAAGCGGG - Intergenic
1051721190 9:20039319-20039341 GATGAAGACGACCTGGAAGCTGG + Intergenic
1057950539 9:99366086-99366108 CATCAAGTCCTCCAAGAAGCAGG + Intergenic
1062724093 9:138061504-138061526 CATGAAGTGTATCACCAAGCCGG + Intronic
1195637700 X:107136302-107136324 CATAAAGTCAACCACTTAGCAGG + Intronic