ID: 1006358837

View in Genome Browser
Species Human (GRCh38)
Location 6:33576245-33576267
Sequence TACTTGACCCCGGGAGGCGG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 244710
Summary {0: 2, 1: 180, 2: 11450, 3: 69596, 4: 163482}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1006358829_1006358837 11 Left 1006358829 6:33576211-33576233 CCACCTACTCAAGAAGAGGCTGA 0: 1
1: 1
2: 5
3: 53
4: 258
Right 1006358837 6:33576245-33576267 TACTTGACCCCGGGAGGCGGAGG 0: 2
1: 180
2: 11450
3: 69596
4: 163482
1006358826_1006358837 20 Left 1006358826 6:33576202-33576224 CCTGTAATCCCACCTACTCAAGA 0: 25
1: 2971
2: 65721
3: 157848
4: 238625
Right 1006358837 6:33576245-33576267 TACTTGACCCCGGGAGGCGGAGG 0: 2
1: 180
2: 11450
3: 69596
4: 163482
1006358828_1006358837 12 Left 1006358828 6:33576210-33576232 CCCACCTACTCAAGAAGAGGCTG 0: 1
1: 1
2: 3
3: 66
4: 324
Right 1006358837 6:33576245-33576267 TACTTGACCCCGGGAGGCGGAGG 0: 2
1: 180
2: 11450
3: 69596
4: 163482
1006358831_1006358837 8 Left 1006358831 6:33576214-33576236 CCTACTCAAGAAGAGGCTGAGGC 0: 1
1: 0
2: 2
3: 47
4: 901
Right 1006358837 6:33576245-33576267 TACTTGACCCCGGGAGGCGGAGG 0: 2
1: 180
2: 11450
3: 69596
4: 163482

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1006358837 Original CRISPR TACTTGACCCCGGGAGGCGG AGG Intronic
Too many off-targets to display for this crispr