ID: 1006359503

View in Genome Browser
Species Human (GRCh38)
Location 6:33579525-33579547
Sequence GAGCCTCAGAACACCCACCA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 177
Summary {0: 1, 1: 0, 2: 1, 3: 10, 4: 165}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1006359501_1006359503 1 Left 1006359501 6:33579501-33579523 CCAGGCTTCCGAGGGGAGCAGGT 0: 1
1: 0
2: 1
3: 10
4: 162
Right 1006359503 6:33579525-33579547 GAGCCTCAGAACACCCACCAAGG 0: 1
1: 0
2: 1
3: 10
4: 165
1006359493_1006359503 15 Left 1006359493 6:33579487-33579509 CCTCTACCAACACCCCAGGCTTC 0: 1
1: 0
2: 1
3: 20
4: 354
Right 1006359503 6:33579525-33579547 GAGCCTCAGAACACCCACCAAGG 0: 1
1: 0
2: 1
3: 10
4: 165
1006359495_1006359503 9 Left 1006359495 6:33579493-33579515 CCAACACCCCAGGCTTCCGAGGG 0: 1
1: 0
2: 2
3: 18
4: 226
Right 1006359503 6:33579525-33579547 GAGCCTCAGAACACCCACCAAGG 0: 1
1: 0
2: 1
3: 10
4: 165
1006359490_1006359503 22 Left 1006359490 6:33579480-33579502 CCAACTCCCTCTACCAACACCCC 0: 1
1: 1
2: 3
3: 44
4: 747
Right 1006359503 6:33579525-33579547 GAGCCTCAGAACACCCACCAAGG 0: 1
1: 0
2: 1
3: 10
4: 165
1006359498_1006359503 3 Left 1006359498 6:33579499-33579521 CCCCAGGCTTCCGAGGGGAGCAG 0: 1
1: 0
2: 0
3: 24
4: 238
Right 1006359503 6:33579525-33579547 GAGCCTCAGAACACCCACCAAGG 0: 1
1: 0
2: 1
3: 10
4: 165
1006359499_1006359503 2 Left 1006359499 6:33579500-33579522 CCCAGGCTTCCGAGGGGAGCAGG 0: 1
1: 0
2: 0
3: 22
4: 233
Right 1006359503 6:33579525-33579547 GAGCCTCAGAACACCCACCAAGG 0: 1
1: 0
2: 1
3: 10
4: 165
1006359489_1006359503 25 Left 1006359489 6:33579477-33579499 CCTCCAACTCCCTCTACCAACAC 0: 1
1: 0
2: 2
3: 94
4: 965
Right 1006359503 6:33579525-33579547 GAGCCTCAGAACACCCACCAAGG 0: 1
1: 0
2: 1
3: 10
4: 165
1006359492_1006359503 16 Left 1006359492 6:33579486-33579508 CCCTCTACCAACACCCCAGGCTT 0: 1
1: 0
2: 2
3: 17
4: 246
Right 1006359503 6:33579525-33579547 GAGCCTCAGAACACCCACCAAGG 0: 1
1: 0
2: 1
3: 10
4: 165
1006359502_1006359503 -7 Left 1006359502 6:33579509-33579531 CCGAGGGGAGCAGGTAGAGCCTC 0: 1
1: 0
2: 0
3: 18
4: 230
Right 1006359503 6:33579525-33579547 GAGCCTCAGAACACCCACCAAGG 0: 1
1: 0
2: 1
3: 10
4: 165

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1006359503 Original CRISPR GAGCCTCAGAACACCCACCA AGG Intronic
901240213 1:7688551-7688573 GAGACCCAGAACACCCACCATGG + Intronic
903070497 1:20724699-20724721 GGGCCTCAGCCCACTCACCATGG + Intronic
903853322 1:26321084-26321106 GAGCCCCAGGGCACCCCCCAAGG + Intergenic
904462395 1:30687906-30687928 GAGCCACTCAACACCCCCCATGG + Intergenic
905895191 1:41541163-41541185 CAGCATCAGCACACCCTCCATGG - Intronic
908243503 1:62208520-62208542 GAGCCACTGCACCCCCACCAGGG - Intronic
910556550 1:88540954-88540976 GGGCCTCAGTACACCAAACAAGG + Intergenic
912864888 1:113248137-113248159 GAGCCTCATCACTCCCTCCAGGG - Intergenic
913259894 1:116988452-116988474 GAGCCTCAGAAAACCCTACTGGG - Exonic
914361455 1:146939216-146939238 ATGCCACAGAACACCCGCCAGGG - Intronic
916713430 1:167431725-167431747 GGGTCTCAGTACAGCCACCAAGG - Exonic
919768764 1:201143907-201143929 GAGCAACAGGGCACCCACCACGG + Exonic
920847351 1:209605364-209605386 CAGTCTCAGAACACCCACTCTGG - Intronic
921370517 1:214418248-214418270 GAGCCTCAGACGACCCACAGTGG + Intronic
923255876 1:232220959-232220981 CTGACCCAGAACACCCACCATGG - Intergenic
923701708 1:236306045-236306067 AATCCTCAGAACAACCACCGAGG + Intergenic
924798229 1:247308474-247308496 GTGCCTCAAAACACCTACCCAGG - Exonic
1063104684 10:2982767-2982789 GTGCCTCAGACCAGCCTCCAGGG - Intergenic
1076091794 10:127693022-127693044 AGGCCTCTGAACACACACCAGGG + Intergenic
1076404701 10:130203927-130203949 GAGCCTAAGAACGCCCATCCTGG - Intergenic
1077329583 11:1978152-1978174 GAGACACAGCACAGCCACCAGGG + Intronic
1083116316 11:60463036-60463058 GATCATCAGAAGACCCCCCAGGG - Exonic
1083748524 11:64748071-64748093 GACCCTCAGCGCCCCCACCACGG + Intronic
1083899977 11:65638778-65638800 GAGCCCGAGAACACCCCTCAAGG + Intronic
1084549597 11:69833256-69833278 GAGCTTCAGAAGTCCCACCCCGG + Intergenic
1084894397 11:72254915-72254937 GACCCTCAGAACTCCCTCCAGGG + Intergenic
1089319996 11:117619196-117619218 AAGCCTGAGACCAGCCACCAGGG - Intronic
1089647628 11:119890577-119890599 CAGCCCCAGAACAACCCCCAGGG + Intergenic
1089909069 11:122077395-122077417 GAGTTTGAGAACCCCCACCATGG - Intergenic
1202812562 11_KI270721v1_random:33331-33353 GAGACACAGCACAGCCACCAGGG + Intergenic
1097288620 12:57896328-57896350 GTGTCCCAGAACACCCAGCAGGG - Intergenic
1102454335 12:113062596-113062618 GTGCCACAGGACACCCAGCATGG + Intronic
1102511495 12:113418549-113418571 GGGCCGCAAAACACCCACCCCGG - Intronic
1103281785 12:119764116-119764138 AAGCCCCCGACCACCCACCAAGG + Intronic
1105994265 13:25655112-25655134 GGACATCAGACCACCCACCATGG - Intronic
1109274480 13:60288399-60288421 CAACCTCAGAACATCCATCAGGG - Intergenic
1113789341 13:113019290-113019312 GAGCCTCAGACCACGTGCCAGGG - Intronic
1115521452 14:34236691-34236713 GAGCCTCAGAACATAAACCCTGG - Intronic
1119182202 14:72612850-72612872 CAGCCTCTGCACAGCCACCAGGG - Intergenic
1121999678 14:98636563-98636585 TATCCCCAGAACACCCACCATGG + Intergenic
1123783657 15:23647817-23647839 GAGCCTCTGAACAGCCACGTAGG - Exonic
1124351023 15:28955777-28955799 GACCCTCAGGGAACCCACCAAGG - Intronic
1125586687 15:40825629-40825651 GAGCCCCTGCCCACCCACCAGGG - Intronic
1127659850 15:61090171-61090193 GATCCTCAGAACCCAGACCAGGG - Intronic
1128082340 15:64864142-64864164 GAGCCTCAGAGGCCCCAGCAGGG - Intronic
1129079640 15:73027424-73027446 GAGCACCTGAACACCCACTAGGG + Intergenic
1129470706 15:75751888-75751910 GAGCCCCAAAACCCTCACCAAGG + Intergenic
1129476075 15:75785455-75785477 GATCCTCAGACAACCCAACAAGG - Intergenic
1129604315 15:77017407-77017429 GAGCCTCAGAGAACTCTCCAGGG - Intronic
1130286505 15:82559608-82559630 GAGCCACAGCACATCCAGCAAGG + Intronic
1132041127 15:98525282-98525304 GAGCCACAGAGCAGGCACCAGGG + Intergenic
1132300035 15:100769505-100769527 GATCCTCAGGAAACCCACCCAGG - Intergenic
1132999272 16:2840986-2841008 GAGCCTCCTCACAGCCACCAAGG + Intergenic
1136448040 16:30335867-30335889 GAGCTTCTGTCCACCCACCAGGG - Intergenic
1139207490 16:65043447-65043469 CAGCCTCAGACCACCCTGCATGG + Intronic
1140216071 16:73010078-73010100 TAGCATCAGAACACCCACGGAGG + Intronic
1141029385 16:80574410-80574432 TGGACTCAGAACACTCACCATGG + Intergenic
1141949750 16:87332904-87332926 GACCCTCAAAACAGCCCCCAAGG + Intronic
1142047829 16:87936961-87936983 GAGCTTCTGTCCACCCACCAGGG + Intergenic
1142195580 16:88737896-88737918 TGGCCTCAGCCCACCCACCATGG + Intronic
1142259607 16:89036574-89036596 CGGCCTCAGGACACCCACCCCGG + Intergenic
1142259624 16:89036625-89036647 CAGCGTCAGGACACCCACCCCGG + Intergenic
1142259639 16:89036676-89036698 CAACCTCAGGACACCCACCCCGG + Intergenic
1142352507 16:89586613-89586635 GTGGCTCTGAACACCTACCAGGG - Intronic
1142600666 17:1052170-1052192 GGGCCTCAGAACACACAGAACGG + Intronic
1142995478 17:3757475-3757497 GAGCCACAGGAAACACACCAAGG - Intronic
1144441976 17:15291960-15291982 GCCCCTCAGCACACCCACCTTGG + Intergenic
1147894283 17:43740304-43740326 GGGCCTCAGCACACCTACTATGG + Intergenic
1152573977 17:81132224-81132246 GAGCCTCAGCTTCCCCACCAGGG - Intronic
1152696581 17:81800645-81800667 GAGACTCAGAAGCCCCACCCTGG - Intergenic
1154063907 18:11088824-11088846 CAGCCTCATAACTCACACCAAGG + Intronic
1157202065 18:45667949-45667971 CAGCCTGAGATCGCCCACCAGGG - Exonic
1161146633 19:2682785-2682807 GAGCCTCAGAAGAGCTGCCAGGG + Intronic
1161981021 19:7630431-7630453 GAATCCCAGAACTCCCACCAAGG - Intronic
1162086227 19:8250979-8251001 GAGCCTCAGAACTCCTACTCGGG - Intronic
1163849301 19:19654400-19654422 GAGCCTCTGGCCACCCACCTCGG + Intronic
1164130568 19:22357832-22357854 GAGCATCAGAAGACCCATAAGGG + Intergenic
1164866595 19:31609524-31609546 GAGCATCAGAACACCCAGGCAGG - Intergenic
1164920612 19:32085931-32085953 GACCCTCTGAACCCCCAACAGGG - Intergenic
1166383855 19:42369736-42369758 GAGCCTCAGACCCCCGACCCTGG + Intronic
1167294263 19:48640108-48640130 GAACATCAGATCAACCACCAGGG - Exonic
1167718355 19:51159125-51159147 GAGCCTGAGAACAAAAACCAGGG + Intergenic
1168402522 19:56093584-56093606 GAGCCTCAGACAACTGACCAGGG - Intronic
1168514928 19:57003208-57003230 GTGCCTATGAACACCCACCTAGG - Intergenic
926141946 2:10373041-10373063 GAGCCTCAGAACACTGCCCAGGG - Intronic
929932717 2:46271335-46271357 GGGCCTCAGATCAGCCTCCAGGG - Intergenic
930887686 2:56346487-56346509 GAGCCTCTGTACAGCCACCGTGG + Intronic
931546727 2:63396551-63396573 GAGCGTGAGAGCACACACCATGG + Intronic
931650080 2:64460287-64460309 GAACCACAGAACAGCCCCCACGG - Exonic
932076456 2:68668746-68668768 TAGCCTCAGAACTCCCATCTTGG - Intergenic
932441196 2:71736724-71736746 GTGCTTCAGAACATCCACCCAGG - Intergenic
937747590 2:125433300-125433322 GAGCCTCACAGCCTCCACCAGGG - Intergenic
937830131 2:126410658-126410680 GAGACTGTGAACACCCACCCAGG + Intergenic
938086419 2:128405041-128405063 GAGCCCCAGCACAGCCACCACGG - Intergenic
943289536 2:186051055-186051077 GAGCCTCACTAGACCCACCGAGG - Intergenic
946108639 2:217394465-217394487 GAGCATTAGAACAGCCATCAGGG - Intronic
948970400 2:241421296-241421318 CAGCCTCAGGACCCCCAGCAAGG + Intronic
1169250944 20:4060845-4060867 GGACCTCAGAACACCAACCCTGG - Intergenic
1169345409 20:4824280-4824302 GAGCCTCAGGCCAACCCCCAAGG + Intergenic
1171960924 20:31493622-31493644 AAGCCTCTGAACACCAACCTTGG + Intergenic
1172563045 20:35906391-35906413 GAGCCTGAGCACAGCCACCATGG - Intronic
1173252847 20:41373805-41373827 GAGCCCCAGATTAGCCACCAAGG - Intergenic
1173292792 20:41729199-41729221 GGGCATCAGAACACCCCCAATGG + Intergenic
1175186171 20:57180807-57180829 GGGCCCCAGGACACCCGCCAGGG + Intronic
1178834477 21:36084998-36085020 GAGCCACACAACACCCAGCCTGG - Intergenic
1179970632 21:44835335-44835357 GGGCCTCAGAAATCTCACCAGGG - Intergenic
1179994727 21:44968613-44968635 GAGCCTCAGCACCCACACCTGGG - Intronic
1180079102 21:45478162-45478184 GAGCCTCCTCACACCCACAAGGG - Intronic
1181459636 22:23078544-23078566 GAGCCCCAGAACAGCCAGCGTGG - Intronic
1184336871 22:43858986-43859008 GACCCTGAGAACAGCCACCCTGG + Intronic
1184900717 22:47444898-47444920 GAGCCTCCTAGCACCCAACAGGG + Intergenic
949890583 3:8730935-8730957 GAGCCTCCTTACACACACCAAGG + Intronic
951776240 3:26313151-26313173 GAGCCCCAGAGCACTCACCCTGG + Intergenic
954452304 3:50578341-50578363 GAGCCTCAGTGCCCCCTCCATGG + Intronic
958022200 3:88011336-88011358 GAGCATGAGAACACACACCTAGG + Intergenic
963115275 3:141723671-141723693 CAGACCCAGAACACCCAGCAAGG + Intergenic
967640896 3:191861871-191861893 GAACTTCAGAACATTCACCAGGG + Intergenic
968602621 4:1517471-1517493 GACCCACAGAGCTCCCACCAGGG + Intergenic
969675261 4:8610918-8610940 GAGTCTCATGACCCCCACCAGGG + Intronic
969705989 4:8791881-8791903 GGACCTCAGAACTCCCACCTGGG + Intergenic
972987050 4:44777643-44777665 GGCCCACAGAACAACCACCACGG + Intergenic
975719511 4:77236322-77236344 GAGCCTCAGGAAGCTCACCAGGG + Intronic
975996438 4:80321459-80321481 AAGCCAAAGAGCACCCACCACGG - Intronic
984907832 4:184646666-184646688 AAGCCTCAGCACTCCCACCAAGG + Intronic
985856107 5:2428855-2428877 GAGATTAAGAAAACCCACCATGG - Intergenic
985866109 5:2515788-2515810 GAGCCGCAGAGCGCCCACCGAGG - Intergenic
987288164 5:16480688-16480710 GAGCCAAAGAACACGCACGAAGG + Intronic
993211814 5:84961831-84961853 GACTCTCAGGAGACCCACCATGG + Intergenic
993902460 5:93593877-93593899 GAGACTCAGAGGACCCACCTGGG + Exonic
1002909600 6:1479411-1479433 AAGCCCCAGAACAACCACTAGGG + Intergenic
1003425297 6:5994864-5994886 GCCACTCAGAACACCTACCAGGG - Intergenic
1003538254 6:6995099-6995121 GAGCCTCAGCGCATCCACAATGG + Intergenic
1005524900 6:26636906-26636928 GGACCTCAGAAAACCCACCCTGG - Exonic
1005973115 6:30776959-30776981 GAGCCTCGGCCAACCCACCATGG + Intergenic
1006359503 6:33579525-33579547 GAGCCTCAGAACACCCACCAAGG + Intronic
1006466573 6:34198235-34198257 GAACCTCAGAGAACGCACCAGGG + Intergenic
1013738803 6:113259434-113259456 GAGAGCCAGAAAACCCACCACGG - Intergenic
1015215986 6:130750187-130750209 GTGGCTCAGAAAACCCACTATGG - Intergenic
1016190726 6:141261325-141261347 GAGCCTGCAAACACCCAGCAGGG - Intergenic
1016880922 6:148911274-148911296 GAGCCTCAGAGCTCACACCCTGG + Intronic
1017084288 6:150699666-150699688 AAGCCTCAGAACACCCCGCGAGG + Intronic
1017618893 6:156274490-156274512 GGGCCTCAGCACCCCCACGATGG - Intergenic
1018385113 6:163296057-163296079 GAGTCTCCTAACACCCCCCAGGG - Intronic
1019064652 6:169287108-169287130 CAGCCCCAGAACACACACCGGGG - Intergenic
1020452551 7:8336451-8336473 GATCCTCAGATCTCTCACCAGGG + Intergenic
1021165902 7:17340154-17340176 GAACCTCAGCACACCCACGTGGG + Exonic
1024219577 7:47277406-47277428 GAGGCACAGAGCACTCACCATGG + Exonic
1026791685 7:73336762-73336784 CAGCCGCAGCACACCCAGCACGG - Intronic
1028777611 7:94697042-94697064 GAGCCCCATGACACCCACAATGG - Intergenic
1029413302 7:100428779-100428801 GGGCCTCTCAACACCCACCGCGG - Intronic
1034895338 7:154872718-154872740 GAGCCCCAGAACGAGCACCAGGG - Intronic
1035908218 8:3536837-3536859 GAGCCACAGAACACGGACCGTGG - Intronic
1035937807 8:3861860-3861882 GAGCCTAAGAAAACCCACAGTGG + Intronic
1036176214 8:6540921-6540943 GTGTCTCAGAACATCCACCTGGG + Intronic
1036600985 8:10259914-10259936 GAACAGCAGAACACCCACCAGGG - Intronic
1038125468 8:24668478-24668500 GATCCTCACAACACCCAAAAGGG - Intergenic
1040464081 8:47678576-47678598 GAGGCTCAGAGCACCCACTTTGG + Intronic
1045829740 8:106444657-106444679 GAGGGTAACAACACCCACCAGGG + Intronic
1045892048 8:107169044-107169066 GAACCTGAGAACACACACAAAGG + Intergenic
1048970091 8:139640531-139640553 TAGCATCAGAACACCTAGCATGG + Intronic
1052603199 9:30665665-30665687 CAGCTTCATAACCCCCACCACGG - Intergenic
1053103512 9:35390994-35391016 CCACCTAAGAACACCCACCATGG - Intronic
1053467794 9:38323635-38323657 AAGCCTCATAATAACCACCAAGG + Intergenic
1055010906 9:71564078-71564100 AAGCCTCAGAAAATCCAACAAGG + Intergenic
1056460764 9:86807761-86807783 GAGCCCCAGACCACCCACGCTGG - Intergenic
1056777535 9:89524497-89524519 GAGCCTCAGAACTCACACAAAGG - Intergenic
1057682091 9:97197864-97197886 GGACCTCAGAAAACCCACCCTGG - Intergenic
1060398980 9:123336692-123336714 AAGCCTCAGCACCCCCACCCTGG + Intergenic
1061134923 9:128728410-128728432 GAGGCACAGACGACCCACCAGGG + Intergenic
1062519544 9:136951990-136952012 GGGCCTCTGAACCCCCAGCATGG + Intronic
1062590737 9:137273369-137273391 AGGCCCCAGGACACCCACCATGG - Exonic
1186461367 X:9751005-9751027 GAGCCTCAGAGCATCCTCCTGGG - Intronic
1190285013 X:48956047-48956069 GGCCCTCAGCACCCCCACCAGGG - Intronic
1197681906 X:129394136-129394158 CAGCCTCAGAGCCCACACCAGGG + Intergenic
1198439929 X:136653236-136653258 GAGCCTCAGAACACTCACATGGG - Intronic
1199690765 X:150307642-150307664 GAACCTCACACCACCCACCAAGG + Intergenic
1201178431 Y:11323340-11323362 GAGCCTCCCAGCTCCCACCATGG + Intergenic