ID: 1006361016

View in Genome Browser
Species Human (GRCh38)
Location 6:33586994-33587016
Sequence TGCAGTGTGCACTCACTCAG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 147
Summary {0: 1, 1: 0, 2: 1, 3: 9, 4: 136}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1006361016 Original CRISPR TGCAGTGTGCACTCACTCAG GGG (reversed) Intergenic
905261413 1:36721872-36721894 TGCAGTAGGCACTCTCTAAGTGG - Intergenic
908718990 1:67102809-67102831 TGCAGGGTTGACTCATTCAGGGG - Intronic
908780406 1:67685397-67685419 TGCTTTCTGCACTCACTCACAGG - Exonic
909049903 1:70754300-70754322 TGCAGTGTGCATGCTCTCATGGG + Intergenic
913577631 1:120193255-120193277 TGGAGTTTGCCCTCAATCAGAGG + Intergenic
913630541 1:120705085-120705107 TGGAGTTTGCCCTCAATCAGAGG - Intergenic
914559542 1:148804686-148804708 TGGAGTTTGCCCTCAATCAGAGG + Intergenic
914613291 1:149325537-149325559 TGGAGTTTGCCCTCAATCAGAGG - Intergenic
916888328 1:169092063-169092085 TGGAGTGAGCACTGACTCAAGGG - Intergenic
923243707 1:232110704-232110726 TGCAGTCCTCACTGACTCAGTGG + Intergenic
1063153494 10:3357196-3357218 TCCAATATGCAATCACTCAGTGG + Intergenic
1063727934 10:8659797-8659819 TGCTGTGTGGACCTACTCAGAGG - Intergenic
1065287739 10:24201979-24202001 TGCAGCCTGCACTCCCTCGGGGG - Intronic
1072624724 10:97103918-97103940 TGCAGTCTGCACTCCCGCCGTGG - Intronic
1074012137 10:109492957-109492979 TGGAGTCTGCACTAACTCAAGGG + Intergenic
1074831776 10:117254582-117254604 CGCAGTTTGCACTGACACAGAGG + Intronic
1076529290 10:131133842-131133864 TGCAGGGTGCACACAGCCAGTGG - Intronic
1079972620 11:27055317-27055339 TGAAGTGTTCACACTCTCAGAGG + Intronic
1080971924 11:37287958-37287980 TGCATTGAGCACCTACTCAGGGG - Intergenic
1082784752 11:57310819-57310841 TGCAGTGGGCACTCAATCGATGG + Intronic
1083283929 11:61645588-61645610 TGCTCTGTGCACTCCCTCTGTGG + Intergenic
1085045800 11:73352741-73352763 TTCTGTGTGCACTCACACAGGGG + Intronic
1091326172 11:134689870-134689892 GGCACTGTGCACTCATTAAGAGG + Intergenic
1091912616 12:4244176-4244198 TGCCCTGTGCACTCGCTAAGTGG - Intergenic
1100741801 12:97602092-97602114 TGCCTTGTGCACTCACACTGAGG - Intergenic
1103184312 12:118943200-118943222 TGCTGTGTGCTCTCACACACAGG + Intergenic
1104875135 12:132028626-132028648 TGTAATGTTCACTCACTCATGGG - Intronic
1105604843 13:21918534-21918556 TTCTGTGTGATCTCACTCAGTGG + Intergenic
1105635558 13:22212271-22212293 TACAGTGTGCACTCACCTAAAGG - Intergenic
1106123654 13:26882579-26882601 TGCAGTCCGCCCTCCCTCAGAGG + Intergenic
1108685311 13:52814553-52814575 GGCAGTGTGGACCCACACAGCGG + Intergenic
1111168098 13:84489980-84490002 TGCAGTACTCAATCACTCAGAGG - Intergenic
1112576224 13:100639089-100639111 AGCAGTCTGCACATACTCAGTGG + Intronic
1115088247 14:29543037-29543059 TGCAGTCTGCAATCACTAGGTGG - Intergenic
1120244470 14:81990498-81990520 TGCATTGTGCAGGAACTCAGAGG - Intergenic
1121087571 14:91158125-91158147 TGCAGTGTGCAGTGACCCTGGGG + Intronic
1123581142 15:21715815-21715837 TGCAGTGAGCTCTGCCTCAGTGG + Intergenic
1123617791 15:22158438-22158460 TGCAGTGAGCTCTGCCTCAGTGG + Intergenic
1123968308 15:25480722-25480744 AGCACTGTGCAGTCACTCTGAGG + Intergenic
1125036854 15:35135265-35135287 TGCAGTTTCAGCTCACTCAGTGG - Intergenic
1125314685 15:38418516-38418538 TACTGTGGGCACTCACTGAGTGG - Intergenic
1125716220 15:41821434-41821456 TGCGGTGTGCACTCATTCAAGGG - Intronic
1126184210 15:45815111-45815133 TGCAGAGTGCAATCACTCCCTGG + Intergenic
1126612807 15:50546924-50546946 CGTAGTGTCCACTAACTCAGTGG - Intergenic
1129296662 15:74603694-74603716 TGCAGTGTGGACTCCACCAGAGG - Intronic
1140692038 16:77493845-77493867 TGCAGACTGCACTCTCTCTGTGG - Intergenic
1145285470 17:21503069-21503091 AGCAGTGTTCAGTCTCTCAGAGG - Intergenic
1146525128 17:33560728-33560750 AGCAGTCTGCCCTCACCCAGAGG - Intronic
1146652721 17:34616434-34616456 TGCTGTGGCCACTCCCTCAGTGG - Intronic
1146661638 17:34668779-34668801 TACAGTGGGCACTCAGTCAATGG - Intergenic
1151179135 17:72313093-72313115 GGGAGTGTGCACGGACTCAGTGG - Intergenic
1157322589 18:46646021-46646043 TGCAGTGTGAACTCTCTCTGGGG + Intronic
1158405546 18:57156461-57156483 TGAAGTGTGCACTCACTGTAAGG - Intergenic
1159276859 18:66232960-66232982 TGCAGGCTTAACTCACTCAGAGG - Intergenic
1159769856 18:72537066-72537088 ATCACTGTGCGCTCACTCAGAGG + Exonic
1164124524 19:22299933-22299955 TGCAGTGTGCTCTGCCTCAATGG + Intronic
1164824536 19:31274749-31274771 AGCAGGGAGCACTTACTCAGAGG - Intergenic
1164877269 19:31700335-31700357 TGCAGGTTGCACTCACTCTTGGG - Intergenic
1165783732 19:38448568-38448590 TGCACTCTGCAGTCCCTCAGGGG + Intronic
1167571008 19:50289091-50289113 TGCACTGTGAGCTCACTCACTGG - Intronic
1167707860 19:51092290-51092312 TGCAGTGGGCACTCACAGATGGG - Intergenic
925123180 2:1435339-1435361 TGCAGTGTGCATTCAGTTAGTGG - Intronic
925180952 2:1816735-1816757 GTCACTGTGCGCTCACTCAGTGG - Intronic
925350531 2:3198069-3198091 TGCAGTGGGCACTCACTCTGTGG - Intronic
926130046 2:10297317-10297339 TGCACTGTCCACTCACCGAGCGG - Intergenic
929542687 2:42834357-42834379 CCCAGTGTCCACTCACCCAGAGG - Intergenic
930033769 2:47073247-47073269 AGGAGTGTGTTCTCACTCAGTGG - Intronic
930353298 2:50285181-50285203 TGCAGTTTGAAAGCACTCAGTGG - Intronic
935631447 2:105215867-105215889 TGTAGACTGCACTCACTGAGCGG - Intergenic
936433767 2:112485595-112485617 TGCAGTGTGCAGTCAGGGAGAGG + Intronic
939515529 2:143162897-143162919 GGCAGTGTGCACTCACGAACAGG + Intronic
939889121 2:147714946-147714968 TGCAGAGTGCAAACACACAGAGG + Intergenic
944539283 2:200741148-200741170 TGCAGTGCGCACTCTCCCTGTGG + Intergenic
948330434 2:237160420-237160442 TGCTGTCTGCATGCACTCAGGGG + Intergenic
948846099 2:240683478-240683500 AGCAGGGGGCACTCACTCAAGGG - Intergenic
948847757 2:240691251-240691273 AGCAGAGGGCACTCACTCAAGGG + Intergenic
1170132874 20:13041846-13041868 TGAAGTCTGCACTCTCTAAGTGG - Intronic
1170445506 20:16423456-16423478 TGGTGTGTACACTCAATCAGGGG + Intronic
1172580241 20:36041708-36041730 TGCAGGGTTCACTCCCTCACTGG - Intergenic
1173068230 20:39735594-39735616 GGCAGTTTGCACTGACTCATGGG - Intergenic
1173558378 20:43983981-43984003 TACAGTGTACACAGACTCAGAGG - Intronic
1173789954 20:45822090-45822112 GGCAGTGAGCACTCACACACAGG + Intergenic
1174116544 20:48230315-48230337 TGCAGTTTGCAGACACACAGTGG - Intergenic
1175791916 20:61745247-61745269 TGCAGACTGGTCTCACTCAGAGG - Intronic
1175806665 20:61833099-61833121 TACTGTGTTCACTCACTCATGGG - Intronic
1175873237 20:62218120-62218142 TGCAGCGTGCACACACACACAGG - Intronic
1179158569 21:38873463-38873485 TGCCTTGTGGACTCACACAGAGG - Intergenic
1180913874 22:19471937-19471959 TGCACTGTGCTCTCACAGAGGGG - Intronic
1181722778 22:24788628-24788650 TGCAGCCTGCACTTACTGAGTGG - Intergenic
1182609930 22:31538999-31539021 TGGAGTTTCCACTCACTGAGAGG - Intronic
1184141488 22:42580294-42580316 TGCCGTGTGCTCTCACATAGAGG + Intergenic
1184233571 22:43171332-43171354 TGCAGTGGGCACTCAGTGAATGG - Intronic
1184997346 22:48218002-48218024 TGCTGTTTGCACTCACTCGAAGG + Intergenic
950010668 3:9721483-9721505 TGCAGTGAGAACCCACTTAGAGG + Intronic
950266295 3:11575585-11575607 CACAGTGTGCACTTACCCAGCGG + Intronic
952569876 3:34701625-34701647 TGCACTGTGCAATCTGTCAGTGG + Intergenic
953061151 3:39429562-39429584 TGCAGTTTGCACTAACACAGGGG - Intergenic
953371782 3:42394661-42394683 TCCAGTGAGCACTCATTCTGGGG - Intergenic
961983186 3:131103674-131103696 TGCAGGGTTCCCTCAGTCAGAGG + Intronic
962062208 3:131941409-131941431 TGCAGTGTTCCCTAACTCTGTGG - Intronic
962431053 3:135320251-135320273 TGCAGTCTGGACTCTTTCAGTGG + Intergenic
962825064 3:139093956-139093978 TGCAGTGTGCAGTTACTCTCAGG + Intronic
964527660 3:157632155-157632177 GGCAGTGTGCAGTCACACAGGGG + Intronic
965968873 3:174529419-174529441 TGCAGTGTGCAAGCTGTCAGTGG + Intronic
969090433 4:4690030-4690052 GGAAGGGTCCACTCACTCAGTGG - Intergenic
970762992 4:19514199-19514221 TTCAGTGTGCCATTACTCAGAGG + Intergenic
974028777 4:56757319-56757341 TGCAGTGTGCTCTGACTCACAGG + Intergenic
976512131 4:85923215-85923237 TGCATAGTGCACACACACAGAGG - Intronic
977452444 4:97215996-97216018 TGCTGTGTTTACTCAGTCAGAGG - Intronic
978167551 4:105626941-105626963 TGCTTTTTGCACTCACTCAGAGG + Intronic
981470609 4:145130338-145130360 TGCTGTGAGCACTCAGTGAGTGG + Intronic
982133986 4:152256595-152256617 TGCAGTGTCCATTCACTGACAGG - Intergenic
983327716 4:166279496-166279518 TGCAGTGTGGGCTGGCTCAGAGG + Intergenic
996547798 5:124698909-124698931 TGCAGTGTGACCTCACTGGGTGG - Intronic
1000163009 5:158618633-158618655 TGAAGTGTGCAGTCATTTAGAGG + Intergenic
1003343647 6:5245374-5245396 TGCAGTGTTCACTCAGCCAACGG + Intronic
1006361016 6:33586994-33587016 TGCAGTGTGCACTCACTCAGGGG - Intergenic
1010097267 6:72061501-72061523 TCCGCTTTGCACTCACTCAGCGG + Intronic
1012315099 6:97775431-97775453 TGCAGTGTACCCTCACCAAGGGG + Intergenic
1012339219 6:98098226-98098248 TTCAGTGTGCTTTGACTCAGTGG + Intergenic
1013073398 6:106749719-106749741 TCCAGGATGAACTCACTCAGAGG + Intergenic
1018056592 6:160057245-160057267 TGCAGGGTGCACTCAACAAGTGG - Intronic
1018993458 6:168692394-168692416 TTCAGTGTCTACTCACGCAGAGG + Intergenic
1024611344 7:51066767-51066789 TGCAGTCTGCACTCAAGCAGAGG + Intronic
1027364823 7:77446438-77446460 TGCAGTTTTCACTCATTTAGTGG - Intergenic
1035290442 7:157834670-157834692 TGCAGAGTGCACGCTCGCAGAGG + Intronic
1035707160 8:1685165-1685187 GGCAGTTGGCACTCACACAGCGG + Intronic
1041220692 8:55648391-55648413 TTCTGTGTGAACTCAGTCAGTGG - Intergenic
1041383395 8:57275640-57275662 TGCAGTCTGCAGTCTCTCAAAGG + Intergenic
1041857832 8:62478413-62478435 TGCATTGTGCAGTAACTCTGTGG + Intronic
1042204459 8:66314314-66314336 TGCATTGTGCAGACACTTAGAGG - Intergenic
1044523902 8:93230052-93230074 GGCTGTGTCCCCTCACTCAGTGG - Intergenic
1044523909 8:93230079-93230101 GGCTGTGTCCCCTCACTCAGTGG - Intergenic
1049252871 8:141598537-141598559 TGCAGCTCCCACTCACTCAGTGG + Intergenic
1049499189 8:142952450-142952472 GGCTGTGAGCACACACTCAGGGG + Intergenic
1052363932 9:27589937-27589959 TGCAGGGTGCCCTCAGGCAGAGG - Intergenic
1052977964 9:34425668-34425690 TGCACTGCCCACTCACTCATAGG - Intronic
1056499948 9:87198805-87198827 TTCAGTGTGGACTCCATCAGAGG + Intergenic
1058596525 9:106621455-106621477 TGCATTGTGCACTCACATAAAGG - Intergenic
1060590861 9:124815889-124815911 TGCAGGGTACACTCACTCCTGGG + Intergenic
1061886096 9:133591774-133591796 AGGAGTGAGGACTCACTCAGAGG - Intergenic
1185795677 X:2962423-2962445 TCCAGTGTGTCCTCACTCACTGG - Intronic
1192539238 X:71954366-71954388 TGCACTGTGCACTGCCTCTGTGG + Intergenic
1194261229 X:91698903-91698925 GGCTGTGTGCACTAACTCTGGGG + Intergenic
1197524812 X:127548016-127548038 TGCAGGGTGCAATCTCCCAGTGG - Intergenic
1200579877 Y:4937704-4937726 GGCTGTGTGCACTAACTCTGGGG + Intergenic
1200614999 Y:5368704-5368726 TGCAGGGTGCAAGCAGTCAGTGG - Intronic