ID: 1006366423

View in Genome Browser
Species Human (GRCh38)
Location 6:33618842-33618864
Sequence TGTTTTCTGCAGAGGGTGGG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1006366417_1006366423 -4 Left 1006366417 6:33618823-33618845 CCTCCTTGAGGAGCAATTGTGTT No data
Right 1006366423 6:33618842-33618864 TGTTTTCTGCAGAGGGTGGGAGG No data
1006366418_1006366423 -7 Left 1006366418 6:33618826-33618848 CCTTGAGGAGCAATTGTGTTTTC No data
Right 1006366423 6:33618842-33618864 TGTTTTCTGCAGAGGGTGGGAGG No data
1006366415_1006366423 14 Left 1006366415 6:33618805-33618827 CCAGTCTACAGCATGGATCCTCC No data
Right 1006366423 6:33618842-33618864 TGTTTTCTGCAGAGGGTGGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1006366423 Original CRISPR TGTTTTCTGCAGAGGGTGGG AGG Intergenic
No off target data available for this crispr