ID: 1006367058

View in Genome Browser
Species Human (GRCh38)
Location 6:33621934-33621956
Sequence TCCCGCGCACGCCTTTGGAG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 31
Summary {0: 1, 1: 0, 2: 0, 3: 2, 4: 28}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1006367045_1006367058 28 Left 1006367045 6:33621883-33621905 CCCTACTGGAGTTGGCAGGAGGA 0: 1
1: 0
2: 0
3: 17
4: 182
Right 1006367058 6:33621934-33621956 TCCCGCGCACGCCTTTGGAGGGG 0: 1
1: 0
2: 0
3: 2
4: 28
1006367050_1006367058 1 Left 1006367050 6:33621910-33621932 CCCTCGGCGGCGCAGCCTCTACC 0: 1
1: 0
2: 1
3: 3
4: 60
Right 1006367058 6:33621934-33621956 TCCCGCGCACGCCTTTGGAGGGG 0: 1
1: 0
2: 0
3: 2
4: 28
1006367049_1006367058 4 Left 1006367049 6:33621907-33621929 CCTCCCTCGGCGGCGCAGCCTCT 0: 1
1: 0
2: 2
3: 13
4: 185
Right 1006367058 6:33621934-33621956 TCCCGCGCACGCCTTTGGAGGGG 0: 1
1: 0
2: 0
3: 2
4: 28
1006367046_1006367058 27 Left 1006367046 6:33621884-33621906 CCTACTGGAGTTGGCAGGAGGAG 0: 1
1: 0
2: 2
3: 27
4: 224
Right 1006367058 6:33621934-33621956 TCCCGCGCACGCCTTTGGAGGGG 0: 1
1: 0
2: 0
3: 2
4: 28
1006367051_1006367058 0 Left 1006367051 6:33621911-33621933 CCTCGGCGGCGCAGCCTCTACCC 0: 1
1: 0
2: 0
3: 19
4: 133
Right 1006367058 6:33621934-33621956 TCCCGCGCACGCCTTTGGAGGGG 0: 1
1: 0
2: 0
3: 2
4: 28

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1006367058 Original CRISPR TCCCGCGCACGCCTTTGGAG GGG Intronic
900644464 1:3702707-3702729 TCCCGCGCACTCCTTGGGTCAGG + Intronic
924859410 1:247905578-247905600 TCACGCGCACCCCCTTAGAGTGG - Intergenic
1070826795 10:79394932-79394954 TGCAGGGCCCGCCTTTGGAGTGG - Intronic
1074675475 10:115844304-115844326 TCCCTCACTCGCCATTGGAGAGG + Intronic
1077110018 11:858214-858236 CCCCACCCACCCCTTTGGAGAGG - Intronic
1119333675 14:73814658-73814680 TCCTGCTCATGCCTTTGGAGCGG + Intergenic
1119474576 14:74919808-74919830 TCCCGCTCAGGCCTTTGGGTGGG + Intronic
1122941641 14:104984180-104984202 TCTCACGCAGGCCTTTGGGGTGG + Intergenic
1139426441 16:66883074-66883096 TCCCGCCTCAGCCTTTGGAGTGG + Intronic
1140068028 16:71626557-71626579 TCCCGCGTCCGGCTTTGGCGCGG - Exonic
1142222187 16:88860990-88861012 GCCCGCGCACGACTGTGGTGGGG + Exonic
1143119479 17:4598024-4598046 TCCTGCCCACGCCTTTGTAAAGG - Intronic
1162256944 19:9498414-9498436 TCCTGCGGACTCCTGTGGAGTGG + Intronic
931762451 2:65430662-65430684 CCCCGCGCGCGTCTTTGCAGGGG - Intronic
932419566 2:71593573-71593595 TCCTGCCCACCCCTTTGGTGTGG + Intronic
933886031 2:86720124-86720146 TCCCTCGCACGCCTTCCGTGTGG + Intronic
933924149 2:87076582-87076604 TCCCTCGCACGCCTTCCGTGTGG - Intergenic
1179712075 21:43269109-43269131 CCCCGGGCACGCCTCTGGTGGGG + Intergenic
950846343 3:16019458-16019480 TCCCAGGTATGCCTTTGGAGTGG - Intergenic
981614486 4:146633008-146633030 TCCCGCGCACCACTTGGGGGAGG - Intergenic
982259988 4:153486770-153486792 ACCCACCCACGCCTGTGGAGTGG + Intronic
988323977 5:29737998-29738020 TCCCATGCATGCCTTTGCAGAGG - Intergenic
1006367058 6:33621934-33621956 TCCCGCGCACGCCTTTGGAGGGG + Intronic
1006472109 6:34235319-34235341 TCCCGGGGCCGCCCTTGGAGGGG - Intergenic
1035353588 7:158264043-158264065 TCCAGTGCAGGACTTTGGAGCGG + Intronic
1039549262 8:38431054-38431076 TCCCGCCCACAGCCTTGGAGAGG + Intronic
1049408056 8:142460443-142460465 CCCCGCCCAGGCCTTGGGAGAGG - Intronic
1049992148 9:1000306-1000328 TCCCTCCCACCCCTTGGGAGAGG - Intergenic
1055451301 9:76433530-76433552 TCCTGTGCTGGCCTTTGGAGAGG + Intronic
1059343976 9:113615946-113615968 TCTGGCTCATGCCTTTGGAGAGG + Intergenic
1187008075 X:15251291-15251313 TCCCGGGCCTGCCTTTGGAGAGG - Intronic