ID: 1006367074

View in Genome Browser
Species Human (GRCh38)
Location 6:33621975-33621997
Sequence GCCCCCGGGACCACCTGCAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 130
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 123}

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1006367074_1006367084 -2 Left 1006367074 6:33621975-33621997 CCTTTGCAGGTGGTCCCGGGGGC 0: 1
1: 0
2: 0
3: 6
4: 123
Right 1006367084 6:33621996-33622018 GCGGGCAGGTGGGTGGCTGGAGG No data
1006367074_1006367086 8 Left 1006367074 6:33621975-33621997 CCTTTGCAGGTGGTCCCGGGGGC 0: 1
1: 0
2: 0
3: 6
4: 123
Right 1006367086 6:33622006-33622028 GGGTGGCTGGAGGCTGAGTTGGG 0: 1
1: 0
2: 5
3: 88
4: 731
1006367074_1006367090 21 Left 1006367074 6:33621975-33621997 CCTTTGCAGGTGGTCCCGGGGGC 0: 1
1: 0
2: 0
3: 6
4: 123
Right 1006367090 6:33622019-33622041 CTGAGTTGGGGAAGGGCAGCCGG 0: 1
1: 0
2: 1
3: 52
4: 537
1006367074_1006367085 7 Left 1006367074 6:33621975-33621997 CCTTTGCAGGTGGTCCCGGGGGC 0: 1
1: 0
2: 0
3: 6
4: 123
Right 1006367085 6:33622005-33622027 TGGGTGGCTGGAGGCTGAGTTGG 0: 1
1: 2
2: 7
3: 65
4: 673
1006367074_1006367083 -5 Left 1006367074 6:33621975-33621997 CCTTTGCAGGTGGTCCCGGGGGC 0: 1
1: 0
2: 0
3: 6
4: 123
Right 1006367083 6:33621993-33622015 GGGGCGGGCAGGTGGGTGGCTGG No data
1006367074_1006367087 9 Left 1006367074 6:33621975-33621997 CCTTTGCAGGTGGTCCCGGGGGC 0: 1
1: 0
2: 0
3: 6
4: 123
Right 1006367087 6:33622007-33622029 GGTGGCTGGAGGCTGAGTTGGGG No data
1006367074_1006367091 22 Left 1006367074 6:33621975-33621997 CCTTTGCAGGTGGTCCCGGGGGC 0: 1
1: 0
2: 0
3: 6
4: 123
Right 1006367091 6:33622020-33622042 TGAGTTGGGGAAGGGCAGCCGGG No data
1006367074_1006367088 13 Left 1006367074 6:33621975-33621997 CCTTTGCAGGTGGTCCCGGGGGC 0: 1
1: 0
2: 0
3: 6
4: 123
Right 1006367088 6:33622011-33622033 GCTGGAGGCTGAGTTGGGGAAGG 0: 1
1: 0
2: 12
3: 111
4: 867
1006367074_1006367089 14 Left 1006367074 6:33621975-33621997 CCTTTGCAGGTGGTCCCGGGGGC 0: 1
1: 0
2: 0
3: 6
4: 123
Right 1006367089 6:33622012-33622034 CTGGAGGCTGAGTTGGGGAAGGG No data
1006367074_1006367081 -9 Left 1006367074 6:33621975-33621997 CCTTTGCAGGTGGTCCCGGGGGC 0: 1
1: 0
2: 0
3: 6
4: 123
Right 1006367081 6:33621989-33622011 CCCGGGGGCGGGCAGGTGGGTGG 0: 1
1: 1
2: 12
3: 98
4: 926

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1006367074 Original CRISPR GCCCCCGGGACCACCTGCAA AGG (reversed) Intronic
901438190 1:9262320-9262342 GCCCCAGGGCCCACCTGCGAAGG - Exonic
903177851 1:21591209-21591231 CCCCCCGGGAGCACTTCCAAAGG - Intergenic
903822212 1:26111493-26111515 GCCCCGGGGACCGTCTGCAGCGG - Intronic
905893367 1:41530616-41530638 CCTCCCGCCACCACCTGCAATGG + Intronic
907550969 1:55304500-55304522 GCCCCAAGGACCAGCAGCAAAGG - Intergenic
912956150 1:114155123-114155145 GCCCCAGGCACCAGCTGCTAGGG - Intergenic
918393595 1:184091779-184091801 TCACCCAGGAACACCTGCAATGG + Intergenic
921190456 1:212703765-212703787 GCCCGCAGGACCACCTTCTAAGG - Intergenic
1063370170 10:5516070-5516092 GCCCCTGGGAGCAGCTGCTAAGG - Intergenic
1070357985 10:75659043-75659065 GCCCCTGGGACCAGCTGAGAAGG + Intronic
1070779217 10:79127749-79127771 GCCCCCAGCAGCTCCTGCAAAGG - Intronic
1074426503 10:113356096-113356118 GCCCCTGGCACCACCTCCATTGG - Intergenic
1075010602 10:118866458-118866480 GCCCCGGAGACCAGCTGCAAAGG - Intergenic
1076159971 10:128236195-128236217 CCACCTGGAACCACCTGCAAGGG + Intergenic
1090608424 11:128449032-128449054 TCTCCCAGGACCAACTGCAAGGG + Intergenic
1092118088 12:6023774-6023796 GGCTCGGGGTCCACCTGCAAAGG + Exonic
1092238401 12:6823459-6823481 GCCCCCTGGACAGGCTGCAAGGG - Exonic
1095943468 12:47740665-47740687 GCCCCCGGGCCCAGCTGCTCAGG - Exonic
1098275167 12:68805311-68805333 TCCCCCGGGACCCCCTCCACAGG - Intergenic
1101773764 12:107775499-107775521 GCCTCCGAGACCACCTGCCCCGG + Exonic
1103566675 12:121819639-121819661 GGCCCCGGGGGCACCTGCAGTGG + Exonic
1104955738 12:132465067-132465089 GCCTCTGGGAGCACCTGCAGGGG - Intergenic
1106792331 13:33168380-33168402 GCCCACCGGACCACCTGCCTGGG + Intronic
1110550556 13:76806954-76806976 GCCCCCAGGCACAACTGCAAAGG - Intergenic
1111547326 13:89757810-89757832 GCTCCCTGTACCACCTGCATTGG - Intergenic
1113909266 13:113834504-113834526 GCCCCCGGAACCACCGTGAAGGG + Intronic
1118981358 14:70719281-70719303 GGCCTCTGGAACACCTGCAAAGG + Intergenic
1120390997 14:83908608-83908630 GTCCCCGGCAGCACCTGCCAGGG - Intergenic
1121424922 14:93843533-93843555 GACCCTGGGACCACCTGCCTTGG + Intergenic
1124118147 15:26866961-26866983 GCCCCCGGCTCGGCCTGCAAGGG - Exonic
1124118450 15:26868064-26868086 GCCCCCGCGCCCACCTGCCCTGG + Intronic
1129234749 15:74217425-74217447 GCCCCAGAGCCCACCTGCAGGGG - Intergenic
1130223766 15:82043518-82043540 GCCCCCGGGGCCATGTGCAAGGG + Exonic
1132895741 16:2228601-2228623 GCCCCCGGAACCGGCTGCACAGG - Intronic
1132954214 16:2582600-2582622 GATCCCGGGGCCACCTGCAGGGG + Intronic
1132960131 16:2617563-2617585 GATCCCGGGGCCACCTGCAGGGG - Intergenic
1133023473 16:2977017-2977039 GCCCCCAGGGCCTCCTGCACTGG - Exonic
1133347654 16:5081214-5081236 GCCCCTGGGGCCACCTGGCAGGG - Intronic
1134508862 16:14830148-14830170 GCCACCGTGCCCAGCTGCAATGG - Intronic
1134696564 16:16228982-16229004 GCCACCGTGCCCAGCTGCAATGG - Intergenic
1135117906 16:19739136-19739158 ACCCCCAGTTCCACCTGCAAGGG - Intronic
1142156271 16:88534115-88534137 GCCCCCGGGACCCCCTGGGCCGG + Exonic
1142197582 16:88745895-88745917 GACCCCGGCACGGCCTGCAAAGG + Intronic
1143471425 17:7178244-7178266 ACCCCCGGGTCCACCTCCGAGGG + Intronic
1146401823 17:32505509-32505531 ACGCCCGGGTCCACATGCAAGGG + Intronic
1147244712 17:39112297-39112319 TCACCTGGGACCACCTGCCACGG + Intronic
1148549727 17:48543375-48543397 GCCCCCGGCACCACCTCCGGCGG + Exonic
1151657382 17:75502307-75502329 GCCCCCTGGCCCACCTGCCCCGG - Exonic
1152497071 17:80680789-80680811 GCACGCAGGACCACTTGCAAAGG - Intronic
1152758204 17:82095937-82095959 GCCCCCCGCACCCCCTGCATGGG + Intronic
1161325580 19:3662122-3662144 GCCCCGGGGACCACCAGGAGGGG - Intronic
1162386407 19:10362656-10362678 TCCCCCTGGACCACCTTCCAGGG - Exonic
1164580708 19:29433299-29433321 GCCCCCCGACCCATCTGCAAGGG + Intergenic
1165477552 19:36039943-36039965 CTCCCGGGGACCACCTGCCAAGG - Exonic
1168239580 19:55082366-55082388 GCCCTCGGGCCCCCCTGCAGCGG + Intronic
1168642692 19:58040536-58040558 GGCCCCGGGCTCACCTGCGATGG - Exonic
925046629 2:777623-777645 GCTCCTGGGACCACCTACCAGGG - Intergenic
928199839 2:29240803-29240825 TCCCCAGGGACCAGCTGCCAGGG + Intronic
930110592 2:47675566-47675588 GCCCCCAGGCCCAGCTGCCAAGG + Intergenic
932460579 2:71879502-71879524 GTCCCTGGGACCACCTGCCCAGG - Intergenic
933456206 2:82522970-82522992 GCCCCCGCGCCCGGCTGCAAAGG + Intergenic
935210145 2:100932644-100932666 GGCCATGGTACCACCTGCAAGGG + Intronic
944666708 2:201965021-201965043 GCCCCTGGGACAACCTGAGAGGG + Intergenic
948559905 2:238845913-238845935 GCCCCGGGGACGCCCTGGAAGGG - Intergenic
948586989 2:239025825-239025847 GCCCCCGGGACGACCTGGCCTGG - Intergenic
1169153309 20:3307520-3307542 GCCCCTGTGAACCCCTGCAAAGG - Intronic
1169464023 20:5821967-5821989 AACCCTGGGACCACATGCAAGGG + Intronic
1172015455 20:31870327-31870349 GCCCCCGGGATCATGGGCAATGG - Exonic
1173554374 20:43955139-43955161 GCCTCAGGCAACACCTGCAATGG - Intronic
1175546519 20:59781490-59781512 GCCCCCAGGACAACCTGACAAGG - Intronic
1175894622 20:62330662-62330684 GCCCCCTGGACAACCTGCCCTGG + Intronic
1176121645 20:63456781-63456803 CCCCCCAGGACCCCCTGCAGTGG - Intronic
1176284745 21:5013382-5013404 GCCACCTGGACCCCCAGCAAAGG - Intergenic
1179515514 21:41903758-41903780 GCCCCCAGGCTCACCTGCCACGG - Intronic
1179872436 21:44250093-44250115 GCCACCTGGACCCCCAGCAAAGG + Intronic
1180099215 21:45576610-45576632 CCCCCCGGAACCACCTGGGAAGG + Intergenic
1180569520 22:16702190-16702212 GGCTCGGGGTCCACCTGCAAAGG + Intergenic
1181236800 22:21451897-21451919 TCCCCAGGGACCACCCGGAATGG + Intergenic
1183741458 22:39670783-39670805 TCCCCCTGCACCACCTGCAGAGG + Exonic
1183942209 22:41302165-41302187 GCCCCCGAGACCCCCTGCGCGGG - Intronic
1183956351 22:41382483-41382505 TCCCCCGGGGCCACCTGCATCGG + Intronic
1184112662 22:42404340-42404362 GGACCCGGGAGCACCTGCAGTGG - Intronic
1184244355 22:43228400-43228422 GCCCCAGTGACCACATGGAAAGG - Intronic
1185055943 22:48578344-48578366 GCCCCCGGAGGCACCTGCACTGG - Intronic
1185103568 22:48854664-48854686 AACCCAGGGACCACCAGCAATGG + Intergenic
949507843 3:4743564-4743586 TCCCCTGGGACCACCTCAAAGGG - Intronic
950126850 3:10514865-10514887 CCCCCTGGGGCCACCTGCAGGGG - Intronic
963044347 3:141091777-141091799 GCCCCTGGTACCACCTGTAGTGG - Intronic
965187357 3:165482466-165482488 GGCCCAGGGACCACTTGCTAAGG + Intergenic
968747970 4:2370733-2370755 GGCCATGGGACCACCTGCAGTGG + Intronic
971343551 4:25792017-25792039 GCCCCCGAGTCCCCCTGGAAAGG - Intronic
971894865 4:32579461-32579483 GACCCAGAGACCAGCTGCAAAGG - Intergenic
982032248 4:151312562-151312584 GGCCCAGGGACCACCAGCAGTGG + Intronic
985556030 5:558450-558472 GCCCCGGGGTCCAGCAGCAACGG - Intergenic
988484545 5:31657827-31657849 GCTCCCGGCAACACCCGCAAAGG + Intronic
996765545 5:127031176-127031198 GCCCTCCGGGCCACCTGCAGCGG + Intergenic
999206184 5:149849786-149849808 GCCCCCTGCACCCTCTGCAAGGG - Exonic
999430457 5:151521292-151521314 CCCCGCGGCACCACCTGCAGAGG - Exonic
1000007223 5:157198175-157198197 GCCCCCAGGACCACCCACACAGG + Intronic
1005433767 6:25786517-25786539 GCCCAAGGGACCACCTAGAAGGG + Intronic
1006367074 6:33621975-33621997 GCCCCCGGGACCACCTGCAAAGG - Intronic
1007632889 6:43282718-43282740 GCCACGGAGAACACCTGCAAGGG - Exonic
1017717803 6:157224430-157224452 GCCACCGGAGCCACCTGCACCGG - Intergenic
1019637162 7:2082121-2082143 GCTCCCGGGAACACCTGCGCAGG + Intronic
1024283653 7:47738998-47739020 GCCCACAGGATGACCTGCAAAGG - Intronic
1027210533 7:76143372-76143394 TCCCCCGGGGCCAGGTGCAATGG + Intergenic
1029184864 7:98731340-98731362 GCTCCCGGGACCAGCTGGAGGGG + Intergenic
1029278826 7:99424039-99424061 GCTCCCGGGACCAGCGGCCAGGG + Intronic
1034128914 7:148698587-148698609 GCCCCCGGGGCCGCCGGCAGCGG + Intronic
1048012138 8:130466436-130466458 GACCCCAGGAGCACCCGCAATGG + Intergenic
1048860598 8:138722074-138722096 GGCCCAGGGACCCCCTGGAAAGG - Exonic
1049338159 8:142097416-142097438 GGCCCTGGGACATCCTGCAATGG + Intergenic
1053557694 9:39154830-39154852 GCCTCGGGGAGCACCTGCAGGGG + Intronic
1053821808 9:41975118-41975140 GCCTCGGGGAGCACCTGCAGGGG + Intronic
1054139420 9:61464121-61464143 GCCTCGGGGAGCACCTGCAGGGG - Intergenic
1054608763 9:67212290-67212312 GCCTCGGGGAGCACCTGCAGGGG - Intergenic
1057234161 9:93345749-93345771 GCCCCCGGGGCCTCCTGCAGAGG - Intronic
1057295053 9:93829947-93829969 GCCCCCGGGCCCTGCTGCACTGG + Intergenic
1058541170 9:106014028-106014050 GTCCCGGTGACCACCGGCAAAGG - Intergenic
1060662825 9:125414363-125414385 GGCCACGGGGCCACCTGCGAGGG - Intergenic
1061253587 9:129440729-129440751 GGGCCCGGGCCCACGTGCAAGGG - Intergenic
1061425069 9:130493568-130493590 GCCCCTGGGGGCACCTGCAGAGG - Intronic
1061810945 9:133162519-133162541 GGTCCCAGGAACACCTGCAAAGG + Exonic
1062607807 9:137355846-137355868 GCTCCCAGGACCCCCTGCAAGGG - Intronic
1186606602 X:11099221-11099243 CCACCTGGGACCACCTGAAATGG - Intergenic
1190301466 X:49059779-49059801 GTCCCAGGGACCAGCTGCAGCGG - Intronic
1199093197 X:143714215-143714237 GCCCTCGCAACCTCCTGCAAGGG - Intronic
1199978530 X:152908299-152908321 GCCCCTGGCACCACTTTCAAAGG + Intergenic
1199979629 X:152913794-152913816 GTACCCGGCACCACCTGAAAAGG - Intergenic
1201630850 Y:16070790-16070812 CCACCTGTGACCACCTGCAATGG + Intergenic