ID: 1006368140

View in Genome Browser
Species Human (GRCh38)
Location 6:33628054-33628076
Sequence AGCTTGGCCCACTGGGGCGG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 179
Summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 168}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1006368123_1006368140 12 Left 1006368123 6:33628019-33628041 CCTGCCCTACATTCCTGACCCCA 0: 1
1: 0
2: 0
3: 26
4: 322
Right 1006368140 6:33628054-33628076 AGCTTGGCCCACTGGGGCGGTGG 0: 1
1: 0
2: 0
3: 10
4: 168
1006368124_1006368140 8 Left 1006368124 6:33628023-33628045 CCCTACATTCCTGACCCCATATC 0: 1
1: 0
2: 3
3: 14
4: 171
Right 1006368140 6:33628054-33628076 AGCTTGGCCCACTGGGGCGGTGG 0: 1
1: 0
2: 0
3: 10
4: 168
1006368128_1006368140 -7 Left 1006368128 6:33628038-33628060 CCCATATCCCCTCCCTAGCTTGG 0: 1
1: 0
2: 0
3: 9
4: 139
Right 1006368140 6:33628054-33628076 AGCTTGGCCCACTGGGGCGGTGG 0: 1
1: 0
2: 0
3: 10
4: 168
1006368130_1006368140 -8 Left 1006368130 6:33628039-33628061 CCATATCCCCTCCCTAGCTTGGC 0: 1
1: 0
2: 0
3: 18
4: 246
Right 1006368140 6:33628054-33628076 AGCTTGGCCCACTGGGGCGGTGG 0: 1
1: 0
2: 0
3: 10
4: 168
1006368126_1006368140 -1 Left 1006368126 6:33628032-33628054 CCTGACCCCATATCCCCTCCCTA 0: 1
1: 0
2: 0
3: 24
4: 341
Right 1006368140 6:33628054-33628076 AGCTTGGCCCACTGGGGCGGTGG 0: 1
1: 0
2: 0
3: 10
4: 168
1006368127_1006368140 -6 Left 1006368127 6:33628037-33628059 CCCCATATCCCCTCCCTAGCTTG 0: 1
1: 0
2: 1
3: 15
4: 180
Right 1006368140 6:33628054-33628076 AGCTTGGCCCACTGGGGCGGTGG 0: 1
1: 0
2: 0
3: 10
4: 168
1006368122_1006368140 13 Left 1006368122 6:33628018-33628040 CCCTGCCCTACATTCCTGACCCC 0: 1
1: 0
2: 0
3: 21
4: 325
Right 1006368140 6:33628054-33628076 AGCTTGGCCCACTGGGGCGGTGG 0: 1
1: 0
2: 0
3: 10
4: 168
1006368125_1006368140 7 Left 1006368125 6:33628024-33628046 CCTACATTCCTGACCCCATATCC 0: 1
1: 0
2: 0
3: 23
4: 263
Right 1006368140 6:33628054-33628076 AGCTTGGCCCACTGGGGCGGTGG 0: 1
1: 0
2: 0
3: 10
4: 168

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1006368140 Original CRISPR AGCTTGGCCCACTGGGGCGG TGG Intronic
903125062 1:21242199-21242221 AGATTGCCTCACTGGGGCAGGGG - Intronic
904642746 1:31942728-31942750 AGCTTGCCCCACAGGGGCACTGG - Intronic
906719991 1:47997424-47997446 GGCTGGGGCCGCTGGGGCGGGGG + Intergenic
907709574 1:56866676-56866698 AGATTGGCCCACTGGGAAAGTGG - Intronic
908769225 1:67581250-67581272 AACTGGGCCAACTGGGGTGGGGG + Intergenic
911943696 1:104077932-104077954 AGCTTGAACCACTGAGTCGGAGG + Intergenic
915315455 1:155026247-155026269 AGCTAAGCCCCCTGGGGAGGGGG + Intronic
918056113 1:181023147-181023169 AGCCCCGCCCACTGGGGGGGGGG - Intergenic
919742639 1:200990105-200990127 GGCTGGGCCTGCTGGGGCGGAGG - Intronic
919809561 1:201399884-201399906 AGCGAGGCCTACTGGGACGGTGG - Intergenic
922779654 1:228241273-228241295 ACCTGTGCCCACTGGGGCTGCGG - Intronic
922912821 1:229231945-229231967 AGCTTGGCCCTCTGTGGGGCGGG + Intergenic
1063290008 10:4735443-4735465 GGCTTTGCCCCCTGGGGAGGAGG - Intergenic
1067008749 10:42690817-42690839 CGTTGGGCCCACTGGGGCTGCGG + Intergenic
1067849809 10:49747316-49747338 AGCTTGGCCCTCTGAGGCAGTGG - Intronic
1071990144 10:91093477-91093499 AGCTTGGGCCACTGCTGCAGAGG - Intergenic
1073363632 10:102919150-102919172 GTCTCGGCCCACGGGGGCGGCGG - Exonic
1075234078 10:120710811-120710833 AGCAGGGCCCACAGGGGCAGTGG - Intergenic
1076618997 10:131775098-131775120 AGCTCAGCCCACTGGGGCGTTGG - Intergenic
1076724296 10:132406312-132406334 AGCTTGGGCCGCTGGGGGGAAGG - Intronic
1076900430 10:133335166-133335188 AGCTTGGCCCGCGGGGGTGGGGG + Intronic
1077061119 11:618296-618318 AGCTTGGCCTCCCGGGGGGGAGG - Intronic
1077473753 11:2776806-2776828 AGCATGGCCCTCTGGGGGGTTGG + Intronic
1084510868 11:69602878-69602900 AGCTCGGCCTGCTGGGGAGGAGG - Intergenic
1085424641 11:76393306-76393328 AGATTGGGCCACTGGGTGGGTGG - Intronic
1086107107 11:83157792-83157814 AGCATGGGCCTCTGGGGGGGAGG + Intronic
1088115171 11:106304753-106304775 AGTTTGGCCCACTGTGGCCTGGG - Intergenic
1089004994 11:115083875-115083897 GGCTTGGCACAGTGGGGTGGGGG - Intergenic
1089498415 11:118919208-118919230 AGCTTGGCCCCACGGGGAGGAGG + Intronic
1089824850 11:121265826-121265848 AGCTGAGCCCACTGGTGGGGTGG + Intergenic
1092161141 12:6316150-6316172 AGCTTGGACAGCAGGGGCGGGGG - Intronic
1094214884 12:27930374-27930396 AGCTTGTTCCACTGGGACTGGGG + Intergenic
1094640924 12:32274859-32274881 AGCTTGGCCAACTGAGGCAAGGG - Intronic
1096094468 12:48925258-48925280 GGCTCGGCCCACGGGGGCTGAGG + Intronic
1096255575 12:50059983-50060005 AGCCTGGCCCACAGAGGAGGAGG + Intronic
1096476226 12:51910864-51910886 AGCCTGGGCCTCTGGGGCAGAGG + Intronic
1096494846 12:52033935-52033957 ATCCTGGCCCTCGGGGGCGGGGG - Intronic
1096528755 12:52230568-52230590 AGCAGGGGCCACTGGGGCAGAGG + Intergenic
1097694748 12:62765277-62765299 AGCTGGGCACAGTGGGGTGGAGG + Intronic
1103340115 12:120216625-120216647 AGCTCAGCCCACAGGGGTGGCGG + Intronic
1103906474 12:124330186-124330208 GGCCTGGCCCAGTGGGGCTGAGG - Intronic
1105939939 13:25138856-25138878 AGATTGGCCCAGTGTGGTGGTGG - Intergenic
1107972743 13:45659861-45659883 AGCATGGCCCACAGTGGTGGGGG + Intergenic
1111672726 13:91348900-91348922 AGCCCGGCCCAGAGGGGCGGGGG - Intergenic
1112658068 13:101474103-101474125 AGCTTGGCCCAGTGGGTTAGAGG + Intronic
1113464338 13:110503414-110503436 CACTGGACCCACTGGGGCGGTGG + Exonic
1113709655 13:112455032-112455054 AGCCAGGCCCACTGAGGCAGGGG + Intergenic
1117435743 14:55713835-55713857 AGGTTGGCCCATTGGGCCAGTGG - Intergenic
1117549191 14:56817317-56817339 AGCTCGGCGCACTGGGTCCGAGG - Intergenic
1119368011 14:74111962-74111984 AGCTTGAACCACGGAGGCGGAGG - Intronic
1122599695 14:102915132-102915154 AGCTGGGCCCACGGGTGCTGAGG - Intergenic
1128638367 15:69317613-69317635 AGCTTCACCCACTGGGACTGGGG - Intronic
1129493581 15:75954511-75954533 AGCTTGAACCACAGAGGCGGAGG - Intronic
1131056297 15:89377359-89377381 AGCTTGGCTGCCTGGGGAGGGGG + Intergenic
1132457913 16:34217-34239 TGCTGGGCCCACTGTGGGGGTGG + Intergenic
1132862267 16:2077554-2077576 AGCTGGGCTCTCTGGGGCGTTGG + Intronic
1134096328 16:11421218-11421240 AGCTCTGCCCACTGGGGCTGGGG - Intronic
1136079860 16:27844861-27844883 AGCTCAGCCCAGTGGGGTGGGGG - Intronic
1136540572 16:30925684-30925706 AGATGGGCCCACTGGGGCCCTGG - Intronic
1136579431 16:31142739-31142761 CGCCTGGCCCGCTGGGGCCGCGG - Exonic
1138111753 16:54329737-54329759 TGCATGGCCCACTGGGGCTTGGG + Intergenic
1138500108 16:57436164-57436186 AGCTTGGCCCATGTGGGCTGGGG - Intronic
1141663156 16:85452612-85452634 GCCTGGGCCCACTGGGGCAGGGG - Intergenic
1142117960 16:88369932-88369954 AGCTTTGACCACTTGGGCTGAGG + Intergenic
1142182532 16:88678269-88678291 AGCGGGGGCCACTGGGCCGGAGG - Exonic
1143181668 17:4987538-4987560 AGCTGCGCCCTCTGGCGCGGGGG + Intronic
1143727616 17:8860272-8860294 AGCTCCGCCTCCTGGGGCGGGGG + Intronic
1144110003 17:12021467-12021489 AGCGGGGCCCACTGCGGCGGCGG - Intronic
1147438727 17:40433775-40433797 AGCAGGGCCCACTGGGCAGGAGG + Intergenic
1147581939 17:41631942-41631964 AGATGGGCCCACTGAGGCAGAGG - Intergenic
1147690665 17:42312713-42312735 AGATTAGCCCCCTGGGGCGGTGG - Intergenic
1149562842 17:57620996-57621018 AGCTTGGCCCTCTGGGTCTATGG + Intronic
1151373245 17:73663861-73663883 AACTGGGCCCATTGGGGCAGGGG - Intergenic
1151413821 17:73948453-73948475 GGGTGGGCCCACTGGGGCAGTGG + Intergenic
1151537009 17:74744814-74744836 ATATGGGCCCGCTGGGGCGGAGG + Intronic
1151539527 17:74758052-74758074 GGCTGGGCCCAATGGGGCGTTGG + Intronic
1152628396 17:81398830-81398852 AGCTGGTCCCGCTGGGGCTGGGG + Intronic
1152687187 17:81700498-81700520 AGCAGGGGCCACTGGGGCGCAGG + Exonic
1153879167 18:9405327-9405349 AGCTTGGCCTGCTGAGGCAGGGG - Intergenic
1154348402 18:13563387-13563409 AGCTTGGGCCACTGAGAAGGTGG + Intronic
1155512243 18:26589716-26589738 AGGTTGACCCACTGGGGCTAGGG - Intronic
1160726210 19:618878-618900 GGGGTGGCACACTGGGGCGGTGG + Intronic
1161041533 19:2113157-2113179 TGCTTGGCCCACTGGGACCCGGG + Intronic
1161146837 19:2683932-2683954 AGCTCGGCCCCCTGGGGCTGAGG - Intronic
1162439271 19:10682637-10682659 AGCTTCTACCACTGGGGCAGGGG - Exonic
1162907780 19:13833753-13833775 CGATTGGCCCACTCGAGCGGAGG - Intergenic
1163153512 19:15428217-15428239 AGCTTGGCCTTCTTGGCCGGCGG + Intronic
1163692932 19:18746913-18746935 AGCTGGGACCAGTAGGGCGGGGG - Intronic
1165349539 19:35268612-35268634 GGCTTGGCCCAGTCCGGCGGCGG - Intergenic
1165944745 19:39435351-39435373 AGCTCACCTCACTGGGGCGGGGG - Intronic
1166392838 19:42419516-42419538 GGGTAGGCCCACTGGGGCCGTGG + Intronic
1166976076 19:46605730-46605752 AGCTGGCCTCACTGGGGCCGAGG + Intronic
1167310571 19:48735367-48735389 AGCTTAGCCTTCAGGGGCGGCGG - Exonic
1167394410 19:49218644-49218666 AGTTTGGCCCACTATGGAGGTGG + Intergenic
1168277007 19:55284202-55284224 AGCATGGCCCAGGGGGGCTGCGG - Exonic
926098975 2:10101765-10101787 AGCTTGGAGAACTGAGGCGGGGG - Intergenic
926296090 2:11569816-11569838 AGCGTGGCACACTGGAGAGGTGG + Intronic
926914360 2:17878555-17878577 AGCTGCGACCAATGGGGCGGCGG + Intronic
929596599 2:43180060-43180082 AGCCTGGCCTGCTGGGGAGGGGG - Intergenic
934569124 2:95357511-95357533 AGGCTGGACCCCTGGGGCGGTGG + Intronic
935400937 2:102659355-102659377 CGCTTGGGCCAGTGAGGCGGAGG + Intronic
935638304 2:105267358-105267380 AGCTTGGCCCAAGGGTGCGAGGG - Exonic
935893059 2:107701039-107701061 AGATTGGCCCAGTGTGGTGGTGG - Intergenic
936071709 2:109375620-109375642 GCCCTGGCCCACTGGGGAGGAGG - Intronic
937135061 2:119544826-119544848 AGCCAGGCCTACCGGGGCGGTGG + Intronic
943655665 2:190505866-190505888 GGCTAGCCCCACTGGGGTGGGGG + Exonic
946716897 2:222562231-222562253 GGCTTGGCCCACAGTGGCAGTGG - Intergenic
948645228 2:239400442-239400464 GGCTTCGCCCGCCGGGGCGGGGG - Exonic
948909054 2:240993911-240993933 ACCATGGCCCTCTGGGGCTGGGG - Intergenic
1169228554 20:3871504-3871526 AGTTTGCCCCACTGAGGCAGGGG + Exonic
1170780535 20:19421860-19421882 AGCCTGTGCCACTGGGGTGGAGG - Intronic
1171425588 20:25046700-25046722 AGCTGGGCCCACCGTGGCGAGGG + Intronic
1172869996 20:38129959-38129981 ACCTTGGCTGACTGGGGCTGGGG - Exonic
1174399736 20:50269622-50269644 GGCCTGGCCCACTGGGTGGGTGG - Intergenic
1174584038 20:51593550-51593572 AGATGGGCCCACTGGAGCAGAGG - Intergenic
1175040147 20:56041593-56041615 AGCTGGGCAAACTGGGGCAGGGG - Intergenic
1175862187 20:62156432-62156454 AGCTGAGCCCAATGGGGCCGAGG - Intronic
1175997116 20:62816924-62816946 AGCCGGGCCCACCTGGGCGGGGG - Intronic
1180189568 21:46155959-46155981 AGCCTGGACCCCTGGGGCTGTGG + Intergenic
1180708730 22:17825479-17825501 AGCTTGGGTCCCTAGGGCGGTGG - Intronic
1181385105 22:22538981-22539003 GGCTTGGCCAACTTGGGAGGCGG - Intergenic
1182782400 22:32878551-32878573 TGCTTGGCCCCCTGGGGTAGTGG - Intronic
1183188953 22:36309204-36309226 AGCTCGGCCCACTGTGGAGGTGG + Intronic
1183341534 22:37284425-37284447 AACTTTTCCCACTGGGGCAGAGG + Intronic
1183404580 22:37624124-37624146 AGCCTGGGCCACTTGGGCTGCGG + Intronic
1185055260 22:48575857-48575879 AGCCTGGCCCGCCGCGGCGGCGG + Intronic
1185305297 22:50112161-50112183 AGCGTGGTCCAGTGGGGAGGGGG - Intronic
1185335685 22:50270047-50270069 CGCTTGGCGCCCGGGGGCGGAGG + Intronic
951822187 3:26825687-26825709 AGCTAGGCCCAGTGGGGTTGGGG + Intergenic
952897203 3:38085543-38085565 AGCTTGGCTCTCTTGGGCAGGGG + Intronic
956870889 3:73416723-73416745 AGCTTCCCCCACTGGGGCTAGGG - Intronic
963114383 3:141713926-141713948 TACTTGGCCCACTGGGGATGTGG - Intergenic
966643568 3:182217337-182217359 ATCTTGACCCTCTGGGGAGGAGG + Intergenic
966981112 3:185136572-185136594 AGCTGGGCCCACAGTGGTGGCGG + Intronic
969681354 4:8645091-8645113 ATCCTGGCACACTGGAGCGGGGG + Intergenic
972435532 4:39030522-39030544 AGCATGGCCTTCTGGGGCAGTGG - Intronic
977780699 4:100977557-100977579 AGCCTGGCCCTCTGGTGTGGTGG - Intergenic
981002808 4:139843910-139843932 AGCTTGGCCCACAGGGCCCCTGG + Intronic
981050081 4:140301017-140301039 AGCTTGGCTCACTGAGGCAAAGG - Intronic
985531433 5:436071-436093 AGCTGGGCCCACCTGTGCGGGGG + Exonic
988348474 5:30070177-30070199 AGCATGGTCCAGTGGGGCGGGGG - Intergenic
991037104 5:62138633-62138655 AGCTTGGCCCTCTGGGGTCAGGG - Intergenic
992399868 5:76402660-76402682 GGCTCTGCACACTGGGGCGGGGG + Intergenic
992763186 5:79969901-79969923 GGCTGGGACCACTGGGGCTGGGG - Intergenic
995247652 5:109952673-109952695 GGCTTTGCCCACTGGGGAGAAGG + Intergenic
995829123 5:116334354-116334376 AGCTTAGGCCACAGGGGTGGGGG - Intronic
996443105 5:123512893-123512915 AGGTGGGCCAACTGGGCCGGCGG + Intronic
1003540049 6:7010724-7010746 AGCTTGGCCTACTGGGACATGGG - Intergenic
1006368140 6:33628054-33628076 AGCTTGGCCCACTGGGGCGGTGG + Intronic
1008289329 6:49694377-49694399 AGTCTGTCCCACTGGGGCAGTGG + Intronic
1011300402 6:85867018-85867040 AGTTTGACCCACAGGGGCTGGGG - Intergenic
1015285864 6:131485742-131485764 AGCTTGGACCACAGGGCCTGAGG + Intergenic
1017793674 6:157823179-157823201 GGCTCGGCCGACAGGGGCGGGGG + Intronic
1018686525 6:166308089-166308111 GGCTTGGGCCCCCGGGGCGGGGG + Exonic
1020495943 7:8853503-8853525 AGCCTGGGCGACAGGGGCGGGGG - Intergenic
1022955740 7:35378398-35378420 TCCTTGGCCCACTGTGGGGGTGG + Intergenic
1023207878 7:37770469-37770491 GGCTTGCCCCATTGGGGCAGTGG - Intronic
1029674827 7:102061347-102061369 AGCATTGCGCACTGGGGCTGGGG - Intronic
1029952693 7:104603834-104603856 TGCTGGGCACACTGGGGTGGGGG + Intronic
1030354276 7:108525808-108525830 AGCAAAGCCCACGGGGGCGGAGG + Intronic
1032011698 7:128351646-128351668 AGCTTGGCCCAGCAGCGCGGCGG + Exonic
1034758383 7:153646105-153646127 AGCTTGAACCACGGAGGCGGAGG - Intergenic
1047509636 8:125506311-125506333 GGCTTGGCCCCCTTGGGCGATGG - Intergenic
1049554052 8:143273538-143273560 AGCTTGGCCCACCATGGAGGGGG - Intronic
1049672934 8:143877790-143877812 AGCTTGGCACAGTGCAGCGGGGG + Intronic
1049781234 8:144429887-144429909 GGCTTGCCCCACTGGGGCCGGGG - Intronic
1049788578 8:144462777-144462799 GGCCGGGCCCACTGAGGCGGCGG - Intronic
1057832686 9:98419089-98419111 AGATTGGCCCGGGGGGGCGGTGG + Intronic
1061157759 9:128875324-128875346 ACCTTGGCTCACTGGCGTGGTGG + Intronic
1061212524 9:129202143-129202165 CGCTTGCCCCAAGGGGGCGGAGG - Intergenic
1061902930 9:133682075-133682097 AGCTGGGCCCACCAGGTCGGAGG - Intronic
1062382447 9:136293010-136293032 AGCTGGGCCCACGGGGCTGGTGG - Intronic
1062468523 9:136692033-136692055 AGCTGATCCCACTGGGGCAGAGG + Intergenic
1185431134 X:12832-12854 AGCTGGAACCACAGGGGCGGGGG - Intergenic
1185440401 X:225229-225251 AGCTGGAACCACAGGGGCGGGGG - Intergenic
1187067460 X:15854715-15854737 AGCTTGGCCGGCGGCGGCGGCGG + Exonic
1192033993 X:67544455-67544477 CGCTGGGCCGACGGGGGCGGGGG - Intronic
1195304146 X:103562625-103562647 AGCTTGGCCCATCTGGGCTGGGG - Intergenic
1200078578 X:153564438-153564460 AGCATGGCTCAGTGGGGCAGGGG - Intronic