ID: 1006369174

View in Genome Browser
Species Human (GRCh38)
Location 6:33633734-33633756
Sequence TTTCGCTTCGCCGCGGGGGC GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1006369162_1006369174 28 Left 1006369162 6:33633683-33633705 CCTTGGCGGCGGCGGCGCGTCGT 0: 1
1: 0
2: 1
3: 10
4: 82
Right 1006369174 6:33633734-33633756 TTTCGCTTCGCCGCGGGGGCGGG No data
1006369161_1006369174 29 Left 1006369161 6:33633682-33633704 CCCTTGGCGGCGGCGGCGCGTCG 0: 1
1: 0
2: 0
3: 7
4: 92
Right 1006369174 6:33633734-33633756 TTTCGCTTCGCCGCGGGGGCGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1006369174 Original CRISPR TTTCGCTTCGCCGCGGGGGC GGG Intronic
No off target data available for this crispr