ID: 1006370895

View in Genome Browser
Species Human (GRCh38)
Location 6:33643055-33643077
Sequence GAAAAGACAAAGATGGAGCT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 737
Summary {0: 1, 1: 0, 2: 2, 3: 60, 4: 674}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1006370891_1006370895 4 Left 1006370891 6:33643028-33643050 CCTCTTCAGTTTTGACACTGGAG 0: 1
1: 0
2: 0
3: 15
4: 160
Right 1006370895 6:33643055-33643077 GAAAAGACAAAGATGGAGCTTGG 0: 1
1: 0
2: 2
3: 60
4: 674

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1006370895 Original CRISPR GAAAAGACAAAGATGGAGCT TGG Intronic
900251582 1:1673208-1673230 GAAAACACAAAAATGAGGCTGGG + Intronic
900261943 1:1735744-1735766 GAAAACACAAAAATGAGGCTGGG + Intronic
900682633 1:3925286-3925308 AAAGAGACAGTGATGGAGCTAGG - Intergenic
901075560 1:6552763-6552785 GAAAAGGAAAAGAGAGAGCTGGG - Intronic
901795231 1:11675958-11675980 GAACAGCCAAACATGGACCTGGG + Intronic
901936766 1:12632026-12632048 GAAAAGGCAAAGGAGGAGATGGG - Intergenic
902119765 1:14153428-14153450 AAAAAGACATAAATGAAGCTGGG - Intergenic
902601446 1:17542156-17542178 GAAAAGAAGAAGATTGAGCATGG + Intronic
902605603 1:17567525-17567547 AAAAATACAAAAAAGGAGCTGGG - Intronic
902927818 1:19708624-19708646 GAAATGACAAAGGTGAAGCTGGG - Intronic
903439868 1:23379609-23379631 AAAAAGTCAAAGATGGGGCCGGG + Intergenic
903532473 1:24042153-24042175 GAAAAGCAAAAGGCGGAGCTGGG - Intergenic
903691912 1:25180203-25180225 GAAAAGAGAAAGATGAAGATGGG + Intergenic
903767891 1:25746617-25746639 GAAAAGAGAAAGATGGCCCTGGG + Intronic
903810416 1:26032093-26032115 GAAAAGATGAGGATGGAGCATGG + Intronic
903830932 1:26174086-26174108 CAAAAGACAAAGCTGGAGACGGG + Intergenic
903943322 1:26946390-26946412 GAGAGGACACAGAAGGAGCTGGG - Exonic
903991687 1:27275633-27275655 ATAAAGAAAAAGATGGAGCGGGG + Intronic
905300817 1:36985223-36985245 GAAGAGACTGAGATGGGGCTGGG + Intronic
905654791 1:39679181-39679203 GAAAAGAAAGAGAAGAAGCTGGG - Exonic
905864053 1:41367103-41367125 GAACAGAAAAAGCTCGAGCTTGG - Intronic
906287389 1:44596264-44596286 AAAAAGACAGAGAAGGGGCTGGG + Intronic
907694011 1:56702376-56702398 GAAAAGATAAAAATGATGCTGGG - Intronic
907978135 1:59453623-59453645 GATAAGAGAAACATGGAGCAGGG - Intronic
908285281 1:62591195-62591217 GCAAAAACATGGATGGAGCTGGG + Intronic
908743584 1:67354161-67354183 GAAAAGCCAAAGCATGAGCTTGG + Intronic
909919839 1:81367514-81367536 GCAGGGACATAGATGGAGCTGGG - Intronic
910059702 1:83075132-83075154 GAAAAGACAATATTGGAGCAAGG - Intergenic
910092591 1:83482844-83482866 GAACAGAAAAAGAAAGAGCTGGG + Intergenic
910287617 1:85573043-85573065 GTAAAGATAATGATGGTGCTTGG + Intronic
910312335 1:85838413-85838435 GAAAAGACAAAGATGATTCTAGG + Intronic
910747268 1:90587754-90587776 GAAAATACAATGATGGGGCTGGG + Intergenic
910774059 1:90857212-90857234 GAAAAAAAAAAGAAGAAGCTGGG + Intergenic
911234890 1:95401850-95401872 GGGAAGACACAGATGGAGATGGG - Intergenic
911720598 1:101187119-101187141 GAAAAGAGTCAGATAGAGCTGGG - Intergenic
912054820 1:105581607-105581629 GAAAATACAAAAACGTAGCTGGG - Intergenic
912073834 1:105847773-105847795 GAAAAGAGGAAGATGGGGTTGGG - Intergenic
912411028 1:109480813-109480835 CTAAAGACAAATATGGAACTGGG - Exonic
912750070 1:112280155-112280177 GAAAAGAAAAAAATGGATGTGGG + Intergenic
912811095 1:112795182-112795204 GAAGAGACAAAAGTGGAGCAGGG + Intergenic
913100458 1:115559348-115559370 GAGAAGAAAGAGATGGAGATTGG - Intergenic
913512235 1:119572502-119572524 GAAAAGAAAAGGAGGGAACTAGG - Intergenic
913578422 1:120200555-120200577 GAAAATACAAAGAATTAGCTGGG + Intergenic
913629750 1:120697796-120697818 GAAAATACAAAGAATTAGCTGGG - Intergenic
914560345 1:148811995-148812017 GAAAATACAAAGAATTAGCTGGG + Intronic
914612488 1:149318220-149318242 GAAAATACAAAGAATTAGCTGGG - Intergenic
914894541 1:151657324-151657346 AAAAATACAAAAATGAAGCTGGG - Intronic
914967279 1:152271222-152271244 GAGAAGACAAAGGGGGAGCAAGG + Intergenic
914969089 1:152290891-152290913 GAGAAGACAAAGGGGGAGCAAGG - Intergenic
915431154 1:155868166-155868188 GGAGAGACAAAGATGGTCCTGGG + Exonic
915971117 1:160355973-160355995 GTAAATAGAAAGAAGGAGCTAGG - Intronic
916141455 1:161702837-161702859 TAAAACAAAAAGATGGAGATAGG + Intergenic
916376336 1:164157703-164157725 GAAAAGACACACATGGATCTGGG - Intergenic
916585334 1:166144947-166144969 GAAAAGACAGAGATGGGGTGAGG + Intronic
917220645 1:172725103-172725125 GACATGACACAGATGGTGCTAGG - Intergenic
917305463 1:173619530-173619552 AAAAGGACAAAGAAGGGGCTGGG + Intronic
917874918 1:179277619-179277641 GAAAATACAAATATAGGGCTGGG - Intergenic
918162786 1:181916931-181916953 GAAGAGACAAAAATGGAGCCAGG + Intergenic
919092430 1:192991629-192991651 AAAAATACAAAAATGTAGCTGGG + Intergenic
919365619 1:196657120-196657142 GAAAAGAAAAAAATTTAGCTAGG - Intronic
921185992 1:212669966-212669988 GAAAGGACAAAGATGGTGGCTGG - Intergenic
921358832 1:214311958-214311980 GAAAAGACAGAGATGACCCTCGG - Intronic
921555128 1:216589494-216589516 GAAAAGACAAGGATTAATCTTGG + Intronic
921650521 1:217672915-217672937 GAAGATACAAAGATGAAGATAGG - Intronic
921874485 1:220178833-220178855 TAAAAGACACAGAGTGAGCTGGG + Intronic
922365817 1:224862631-224862653 AAAAAGACATAGCTGGAGATAGG + Intergenic
923394612 1:233549062-233549084 AAAAAGAAAAAGCTGTAGCTAGG - Intergenic
923396333 1:233568735-233568757 TAAAAGACAAAGATGCAGCCAGG - Intergenic
923623020 1:235593295-235593317 GTAAATACAAAGTTGGGGCTGGG + Intronic
923709230 1:236372249-236372271 AAAAAGAAAAAAATGGGGCTGGG - Intronic
924222483 1:241892636-241892658 AAAAATACAAAAATGAAGCTGGG - Intronic
924359432 1:243221322-243221344 TAGAAAATAAAGATGGAGCTGGG - Intronic
1063140309 10:3250902-3250924 GAGCACACAGAGATGGAGCTGGG + Intergenic
1063829756 10:9938919-9938941 GAACATAAAAAAATGGAGCTGGG - Intergenic
1064423901 10:15213498-15213520 GAAAAGGCCCTGATGGAGCTTGG - Exonic
1064712908 10:18144552-18144574 GAACAGACAGATCTGGAGCTTGG - Intronic
1065042124 10:21707784-21707806 TAAAAGACAAAGTTGGAGAGAGG - Intronic
1066245717 10:33581657-33581679 GAAAAGAGAAAGTTTCAGCTGGG - Intergenic
1067660352 10:48232769-48232791 GAAGAGACAGAGCTGGAGCAAGG + Intronic
1068295092 10:55060448-55060470 GAAAACACAAACATGTAGTTTGG + Intronic
1068765440 10:60758173-60758195 GAAAATACAAAGATAAAGCTAGG + Intergenic
1068875822 10:61995726-61995748 GAAAAGCCAAGGTTGAAGCTAGG - Intronic
1069050055 10:63782844-63782866 GAAAAAAGAAAGATAAAGCTGGG + Intergenic
1069359266 10:67623499-67623521 GGAAAGAAAAACATGGTGCTTGG + Intronic
1069872497 10:71541606-71541628 GAAAACCCAAGGAGGGAGCTGGG - Intronic
1069914343 10:71778152-71778174 GAAGGGACAAGGATGGATCTAGG - Intronic
1070099583 10:73372603-73372625 CAAAAGACAAAGACTGGGCTGGG + Intergenic
1070716762 10:78728140-78728162 GAAAAGACTGAGATGCAGCGAGG - Intergenic
1071157541 10:82708280-82708302 GAAAAGAGAAAAATGGTCCTGGG - Intronic
1071533312 10:86405814-86405836 GAAAGGACAGAAATGGTGCTGGG + Intergenic
1071840622 10:89467118-89467140 GAAAAGCCTAAGAAGAAGCTAGG - Intronic
1072635189 10:97173482-97173504 AAAAAAAAAAGGATGGAGCTGGG - Intronic
1072757074 10:98028747-98028769 CAGCAGACAACGATGGAGCTGGG + Intronic
1073662067 10:105487385-105487407 GATAAGTCAAAGATGAAGTTTGG + Intergenic
1073670612 10:105583536-105583558 GAAAAGACACAGGTGGGGTTGGG + Intergenic
1075258787 10:120945418-120945440 GTAAAGGCCAAGAAGGAGCTAGG - Intergenic
1075387458 10:122066560-122066582 GAAAATACAAAAATTAAGCTGGG - Intronic
1075655157 10:124156416-124156438 GAGAAGAAAAAGCTGGAGCCAGG + Intergenic
1075883152 10:125872200-125872222 GAGAAGACAAAGATGCAACTGGG - Intronic
1077117557 11:892130-892152 GAAAAGAAAAAGACGCAGCGTGG + Intronic
1078266502 11:9759154-9759176 GAAGAGACAAAGATAGACTTGGG + Intergenic
1078336137 11:10464770-10464792 CCACAGACAAAGAGGGAGCTGGG - Intronic
1078381108 11:10841597-10841619 GAAAAGAGATAGATGGAGTAGGG - Intronic
1078814659 11:14807749-14807771 TAAAAGACAAAGATTAGGCTGGG + Intronic
1078909896 11:15721047-15721069 GAGAACACAAAAATAGAGCTGGG - Intergenic
1079034318 11:17009041-17009063 GAAAAAGCAAAGATGGAGTCTGG + Intronic
1079546709 11:21642164-21642186 CAAAAGGCAAAGAAGGAGCGAGG - Intergenic
1080721388 11:34852613-34852635 GCAGGGACATAGATGGAGCTGGG + Intergenic
1080831743 11:35900450-35900472 AAAAATAGAAAAATGGAGCTGGG + Intergenic
1081056289 11:38413997-38414019 GAAAAGATAAATTTGGAGATTGG - Intergenic
1081274307 11:41128314-41128336 GAAAAGGAAATGATTGAGCTTGG + Intronic
1081459389 11:43257808-43257830 AAAAAGACAAAAACGGAGCTGGG + Intergenic
1081811242 11:45915298-45915320 GAGAAGACAATGATGCGGCTAGG - Intronic
1082803911 11:57434686-57434708 GAAAATATCAAGGTGGAGCTTGG + Intergenic
1082882888 11:58055637-58055659 GAAAATACAAAAATGTAGCCAGG + Intronic
1083253647 11:61483459-61483481 GAAATGAAAAAGATGGGGCTGGG - Intronic
1084474945 11:69383542-69383564 GAGAAGAAAAAGCTGGAGCATGG + Intergenic
1085481296 11:76824998-76825020 GAAAAGAAAAATATTGAGCCAGG + Intergenic
1085659600 11:78351699-78351721 GAGAAGACAAGCAGGGAGCTAGG + Intronic
1085704157 11:78770987-78771009 GCAAAGACAATGATGGAGGTAGG - Exonic
1085857515 11:80192251-80192273 GAAAAGAGAAAGAAGGAGGGAGG + Intergenic
1086108277 11:83170231-83170253 GAAAAAACAGAGCTGGAGGTGGG - Intronic
1088053826 11:105551821-105551843 GAAAAGACAAATATTGGACTTGG + Intergenic
1088072967 11:105812469-105812491 AAAAAGACAAAGATGGTAGTAGG - Intronic
1088214812 11:107496091-107496113 AAAACGATAGAGATGGAGCTAGG + Intergenic
1088609512 11:111563835-111563857 GAAATGACAAAGGTGGGGTTTGG - Intergenic
1088713567 11:112529213-112529235 AAAATGAAAAAGATGGAGCCAGG + Intergenic
1088826989 11:113504225-113504247 GGAAAAAAAAAAATGGAGCTGGG + Intergenic
1089427121 11:118387490-118387512 GAAAACAAAAGGATGGATCTAGG + Intronic
1089627020 11:119757752-119757774 AAAGAGACACAGCTGGAGCTGGG - Intergenic
1089766952 11:120774955-120774977 GACGAGATAAAGATGGGGCTAGG + Intronic
1090024009 11:123152360-123152382 AAAAATACAAAAATGTAGCTGGG + Intronic
1090281686 11:125461706-125461728 GAACAGACAAAGGTGAAGGTTGG - Intronic
1090930551 11:131294631-131294653 GAAAAGATTAATCTGGAGCTTGG - Intergenic
1091148800 11:133306194-133306216 GAAAACAGAAACACGGAGCTGGG - Intronic
1091370997 11:135057718-135057740 GAAAAGACACAGAAGCTGCTGGG - Intergenic
1091490921 12:931959-931981 CTAAAGACAAAGATGGAGTTTGG + Intronic
1091520875 12:1240561-1240583 GAAAACACAAATAAGGAGCTTGG - Intronic
1092583089 12:9868581-9868603 GAAATCTCAAAGATGTAGCTTGG + Intronic
1093224396 12:16464302-16464324 GAGAAAAGAAAGATGAAGCTTGG - Intronic
1093474956 12:19544490-19544512 CATAAGACAAAGCTGGAGATAGG + Intronic
1093495139 12:19748004-19748026 GCAGGGACAAGGATGGAGCTGGG - Intergenic
1094388104 12:29917447-29917469 GAAAAGACTAAGAGGGAGGAGGG - Intergenic
1095196763 12:39328429-39328451 GAAAAGACACAGATGGACTCTGG - Intronic
1095212862 12:39513548-39513570 GAAAAGAAAAAGAGGGAGGGAGG + Intergenic
1095295693 12:40525342-40525364 GAAAAGAGAAAGATGGATATGGG - Intronic
1095465721 12:42486134-42486156 GCAAAGACCAGGATGGAGCGAGG - Intronic
1095721519 12:45406322-45406344 CAAAACACTAAGGTGGAGCTGGG - Intronic
1095955890 12:47805743-47805765 GCAAAGAGAAAGAAGGGGCTAGG + Intronic
1096258915 12:50078891-50078913 GAAAAGACAATGATGCAGGATGG - Intronic
1097372490 12:58801413-58801435 GAGAACACAAATATGGAGTTAGG - Intronic
1097727950 12:63095800-63095822 GAAAAGACAAAGTTCAGGCTGGG - Intergenic
1098058530 12:66534987-66535009 GGAAAGACAGAGAGGGGGCTAGG - Intronic
1098089102 12:66882065-66882087 GAGAAGAGAAAGATGGAGATGGG - Intergenic
1098838242 12:75446802-75446824 GGAAAAAAAAACATGGAGCTTGG + Intergenic
1099280497 12:80638496-80638518 CAAAAAACAAACATGGTGCTTGG + Intronic
1099468329 12:83015175-83015197 GAAAACCCCAACATGGAGCTTGG - Intronic
1099642363 12:85308035-85308057 GAGAAGAAAAAGAGGCAGCTGGG + Intergenic
1099982543 12:89623343-89623365 AAAAAAAAAAAGATGTAGCTTGG - Intronic
1100351622 12:93789095-93789117 GGAAAGAGAAAGATGGGGCAGGG - Intronic
1100803995 12:98262088-98262110 GAAAAGCTAAAGATGTGGCTTGG - Intergenic
1101123603 12:101608833-101608855 GAAATGTAAATGATGGAGCTGGG + Intronic
1101235418 12:102784042-102784064 GAAAAGTCAAAATTGGAACTAGG - Intergenic
1101826122 12:108221393-108221415 AAAAATACAAAAATTGAGCTGGG + Intronic
1102193907 12:111010546-111010568 GAAAATACAAAAATTTAGCTGGG + Intergenic
1102341797 12:112127177-112127199 GAAAAGACAAAGATAGAGGATGG - Intronic
1102372762 12:112396058-112396080 GAAAAGACACAGACTGGGCTGGG + Intergenic
1102886519 12:116526118-116526140 GAAAAGACAGAGAAGGAGAAAGG - Intergenic
1103770544 12:123319566-123319588 GAAAATACAAAAATTTAGCTGGG - Intronic
1104214366 12:126721752-126721774 GAAGAGACCAGGATGGAGCCAGG + Intergenic
1104330806 12:127842964-127842986 GAAAAGAAAAAGATGGATCAAGG - Intergenic
1104400645 12:128473215-128473237 GTAAGGACAAAGATGGAGGCTGG - Intronic
1104497218 12:129252202-129252224 TAAAACCAAAAGATGGAGCTGGG + Intronic
1104894456 12:132155000-132155022 GACAAGACAGAGAGGGAGCGGGG - Intergenic
1105973684 13:25454381-25454403 GAGCAGACAGAGATGGAGTTAGG + Intronic
1106884865 13:34173655-34173677 GAAGAGAGAAAGATGGAAGTTGG - Intergenic
1107136735 13:36953088-36953110 GAAAAGACAAGGAAGGCCCTGGG - Intronic
1107412927 13:40174153-40174175 AAAAGGGGAAAGATGGAGCTTGG - Intergenic
1108381640 13:49860317-49860339 TAAAAGAAATAGATGGGGCTTGG + Intergenic
1108626040 13:52229657-52229679 GAAGTGACAAGGATGGAGCCAGG + Intergenic
1108660023 13:52576822-52576844 GAAGTGACAAGGATGGAGCCAGG - Intergenic
1108846338 13:54681997-54682019 GAAAAGACAAACATGCAGAAAGG - Intergenic
1109080253 13:57890552-57890574 AAAAAAAGAAAGATGGAGCTGGG - Intergenic
1109241344 13:59893483-59893505 TAAAAGGGAAAGCTGGAGCTGGG + Intronic
1109364027 13:61332187-61332209 AAAAAGAGAAAGAATGAGCTAGG - Intergenic
1109705241 13:66081612-66081634 TAAAAAACAATGTTGGAGCTAGG - Intergenic
1109985552 13:69978937-69978959 GAAAAGAAAGAAATAGAGCTTGG + Intronic
1110610314 13:77480518-77480540 GAAGAGACAAGGATGCAGCAAGG - Intergenic
1110704874 13:78594050-78594072 GAGAAGGGAAAGATGGAGGTAGG + Intergenic
1112124997 13:96455378-96455400 GAAAAAAAAAAAATGTAGCTGGG - Intronic
1113412548 13:110102926-110102948 GAAAAGAGAAATATGGAGATAGG - Intergenic
1113837956 13:113341560-113341582 GATAAGAAAAAAATGTAGCTGGG - Intronic
1114056303 14:18969969-18969991 GAAAATACAAAGAATTAGCTGGG + Intronic
1114106248 14:19431757-19431779 GAAAATACAAAGAATTAGCTGGG - Intronic
1114161177 14:20169453-20169475 AAAAATACAAAAATGTAGCTGGG + Intergenic
1114237496 14:20835410-20835432 GAGAAGACAAAGAAGAGGCTTGG + Intergenic
1114578245 14:23732716-23732738 CAAAAGATCAAGATGGAACTGGG - Intergenic
1114864049 14:26565597-26565619 GACAAGAAAAAGATGGACCATGG + Intronic
1115577156 14:34722917-34722939 AAAAAGACTAAGAAGGAGCTTGG + Intergenic
1115773109 14:36687110-36687132 GAAAATACAAAAATTTAGCTGGG - Intronic
1116289459 14:43014605-43014627 GAAAAGACAGAGAATGAGATGGG - Intergenic
1116915364 14:50520067-50520089 CATAAGACAAAGCTGGGGCTGGG + Intronic
1116943690 14:50816043-50816065 TGCAAGACATAGATGGAGCTGGG + Intronic
1117130613 14:52682910-52682932 AAAAAGACACAGATTGGGCTGGG + Intronic
1117292896 14:54350886-54350908 GAAAATACAAAAATTTAGCTGGG - Intergenic
1117661110 14:58005882-58005904 GACAAGACAAAGTTGGAGGTTGG + Intronic
1117809426 14:59530785-59530807 GCAAAGACAAATATGGGGATAGG - Intronic
1118529077 14:66682188-66682210 GAAAAGAAAAAAATGGAGAGAGG - Intronic
1118707121 14:68490832-68490854 GCAGAGAGAAAGATGGACCTTGG + Intronic
1119564003 14:75613304-75613326 TGAAAGGCAATGATGGAGCTAGG + Intronic
1119751567 14:77082038-77082060 CAAAAGACAAAGATAGAAATGGG - Intergenic
1119941280 14:78644174-78644196 GAAAAAAGAAAGATGGATCCAGG + Intronic
1119983739 14:79112258-79112280 GAAAAGAAAAGGAGGGGGCTGGG - Intronic
1120007021 14:79370060-79370082 GAAAAGACAAACATGAAGTAAGG + Intronic
1120366677 14:83580364-83580386 TAAAAGTCAAAGGTGGGGCTGGG + Intergenic
1120769050 14:88358653-88358675 GACAAGTCAAATAAGGAGCTGGG + Intergenic
1121136452 14:91503284-91503306 GAAAAAAAAAAAATGTAGCTCGG - Intronic
1121304824 14:92899529-92899551 GGGAAGAGAAAGATGGAGCCGGG + Intergenic
1121463281 14:94098341-94098363 GTGAAGACAGAGATGGAGATGGG - Intronic
1121701937 14:95961348-95961370 GAAAAGAAAGAGATGGAAATTGG + Intergenic
1122014943 14:98787355-98787377 GAAAAAAAAAAGATGGAGAAGGG - Intergenic
1202846072 14_GL000009v2_random:177611-177633 GAAAAGACAGACATGGGGTTAGG - Intergenic
1123668628 15:22630273-22630295 AAAAAAAAAAAAATGGAGCTGGG - Intergenic
1124090692 15:26597317-26597339 TAAATGACAAAGAGGGAACTTGG + Intronic
1124463283 15:29912713-29912735 AAAAAAAAAAAGAGGGAGCTTGG + Intronic
1125039703 15:35170979-35171001 TAAAACACAATGGTGGAGCTTGG + Intergenic
1125090890 15:35791433-35791455 GAAACAACATAGATAGAGCTGGG + Intergenic
1125099222 15:35890953-35890975 AAAAACACAAAAATGTAGCTGGG + Intergenic
1125522807 15:40357659-40357681 AAAAAGAAAGAGAAGGAGCTGGG + Intergenic
1125708002 15:41758389-41758411 AAAAAGACAATGATGGGGGTTGG + Intronic
1126770947 15:52055244-52055266 CAAAAAACAAAAATGTAGCTGGG + Intronic
1126871153 15:52989500-52989522 GCAGAGACATGGATGGAGCTGGG - Intergenic
1128089252 15:64907883-64907905 TAAAATACAAAGAAGGGGCTGGG - Intronic
1128332935 15:66767948-66767970 AAAAAAAAAAAGATGCAGCTTGG - Intronic
1129160875 15:73747035-73747057 GAAAGGTCAAAGAGGGAGCAGGG - Intronic
1129373394 15:75111822-75111844 AAAAAGACAAAAAATGAGCTAGG + Intronic
1131082754 15:89550647-89550669 GCAGGGACACAGATGGAGCTAGG + Intergenic
1132121735 15:99181761-99181783 GCTAAGAAAAAGACGGAGCTGGG + Intronic
1132984579 16:2757996-2758018 AAAAAGACAAAAATAGAGCATGG - Intronic
1133122599 16:3619520-3619542 AAAAATACAAAAATGGAGCTAGG - Intronic
1133411078 16:5569291-5569313 AAAAAGACAAATTTGAAGCTTGG + Intergenic
1133461150 16:5987453-5987475 TAAAAGAAAATGATGGATCTAGG - Intergenic
1133632640 16:7636109-7636131 GAATAGAAAAAGAGGTAGCTTGG - Intronic
1133636913 16:7675637-7675659 GATAAGACATAGATGAAGCAGGG - Intronic
1133689824 16:8202559-8202581 GTGAAGACAAAGACGGAGATTGG - Intergenic
1135160209 16:20087665-20087687 CAACAGACAAAAATGCAGCTAGG - Intergenic
1135229232 16:20690095-20690117 GAAAAGAAAAAGAAGGTGGTGGG + Intronic
1135353230 16:21748006-21748028 GAAAAGAAAATGATGGTTCTAGG - Intronic
1135451717 16:22564129-22564151 GAAAAGAAAATGATGGTTCTAGG - Intergenic
1135488744 16:22888678-22888700 GAAAAGCCAGAGACGGAGCCAGG - Intronic
1135573805 16:23569392-23569414 GAAAATACAAATATTTAGCTGGG + Intronic
1135801785 16:25504041-25504063 GCAAAACCTAAGATGGAGCTGGG - Intergenic
1136010569 16:27360883-27360905 GAGAAGGCAGACATGGAGCTAGG - Intronic
1136278686 16:29194409-29194431 GAAAAGACCGCGATGGAGCCAGG - Intergenic
1137720863 16:50626586-50626608 GAAGAGACACAGATGTGGCTGGG + Intronic
1137751376 16:50863461-50863483 GAAAAGACAAAAATATAGATGGG - Intergenic
1139931467 16:70530292-70530314 GAATAGACAATAGTGGAGCTGGG - Intronic
1140330926 16:74056059-74056081 AAAAAGGCAAATATGAAGCTGGG + Intergenic
1140670883 16:77277804-77277826 GAAGAGACAAAGGGGGAACTGGG + Intronic
1141848044 16:86624364-86624386 ATAAAGAAAAAGATGCAGCTAGG - Intergenic
1141964837 16:87434828-87434850 GAAAAGACAAAAAATTAGCTGGG + Intronic
1141980767 16:87548710-87548732 GAAAATAGAAAGATGGAGGCCGG + Intergenic
1142083078 16:88160490-88160512 GAAAAGACCGCGATGGAGCCAGG - Intergenic
1142541264 17:661224-661246 GAAAAAAAAAAGTTGCAGCTGGG + Intronic
1142542522 17:671367-671389 GAAAAGAGAAAGAGGGAGGGAGG + Intronic
1143385553 17:6527992-6528014 CAAAAGCCAAAGATGGAGCAGGG - Intronic
1143487766 17:7263900-7263922 GAAAAGACAAGGAGTGGGCTGGG - Intronic
1143595289 17:7910362-7910384 GGAAATACAGAGATGGAGCCAGG - Intronic
1143918811 17:10314632-10314654 CAGAAGAAAAAGGTGGAGCTTGG + Intronic
1144102598 17:11955666-11955688 GAAAAGACATAGGTGGAGTCAGG + Intronic
1144117032 17:12105859-12105881 TAAAAGAGAAAGATGGACATGGG - Intronic
1144167929 17:12630582-12630604 GAAAAGACAGATTTGGTGCTGGG - Intergenic
1144762192 17:17713478-17713500 GAAAATACAAAAATTTAGCTGGG + Intronic
1145165252 17:20609085-20609107 GAAAAAAAAAAGATTGGGCTGGG - Intergenic
1145415715 17:22712136-22712158 GAAAAGGCAGAGTTGAAGCTGGG - Intergenic
1145715853 17:27020346-27020368 AAAAATACAAAAATGTAGCTGGG + Intergenic
1146472489 17:33135596-33135618 GAAGGGGCAAAGATGGAGCCAGG + Intronic
1146657377 17:34642695-34642717 TAAAAAACAAAAATGTAGCTGGG - Intergenic
1147355966 17:39896982-39897004 AAAAAGAAAATGATGGAGCCAGG - Intergenic
1147366035 17:39959907-39959929 GAAAAGAAAAAGACGCAGCTGGG + Intergenic
1147599658 17:41738068-41738090 GAGAAGACAGAGATGAAGTTAGG + Intergenic
1148061129 17:44837195-44837217 AAAAAAAAAAAGATGTAGCTGGG + Intergenic
1148155369 17:45421842-45421864 TAAAAGACAAAGAGTCAGCTTGG + Intronic
1148361387 17:47015302-47015324 TAAAAGACAAAAATGGGGCCTGG - Intronic
1148517570 17:48235093-48235115 GAGGAGACAAAGACTGAGCTGGG + Intronic
1148957703 17:51367140-51367162 GGAAAGAAAAAGATAGATCTTGG - Intergenic
1149075103 17:52587405-52587427 GAAAACACACACATGCAGCTGGG + Intergenic
1149368782 17:55971855-55971877 GAGAAGAGAGAGCTGGAGCTGGG - Intergenic
1149514235 17:57267984-57268006 GAAAAGATAATGATGAAGCTGGG - Intronic
1150342090 17:64376597-64376619 GTAAAGACAGAGATGGTGTTTGG - Intronic
1151023436 17:70647259-70647281 GAACAGACACAGATGGGGATTGG - Intergenic
1151472960 17:74329285-74329307 GAAAATACAAAAATTTAGCTGGG + Intronic
1151648774 17:75452502-75452524 GAAAAGAAAAAAAGGGAGCTGGG - Intronic
1151788651 17:76289640-76289662 TAAAAGACAAAGTGGGGGCTGGG + Intronic
1151986904 17:77549397-77549419 GAACAGACACACATGGAGGTTGG - Intergenic
1152037312 17:77881237-77881259 ACAAAGACAGAGCTGGAGCTGGG + Intergenic
1152120812 17:78417257-78417279 GAAGACACAAAGCTGGAGCCAGG + Intronic
1153087189 18:1301808-1301830 GGAAGAACAAAAATGGAGCTTGG + Intergenic
1153171826 18:2325498-2325520 GAAAACAAAAAAATGGAGCTGGG + Intergenic
1153931807 18:9885726-9885748 GTAAAGAGAATGTTGGAGCTGGG + Intronic
1154381213 18:13851756-13851778 AAAAATACAAAGAAGCAGCTAGG + Intergenic
1155400322 18:25431937-25431959 GAAAATATAAAGATGAACCTAGG + Intergenic
1155805008 18:30158485-30158507 GAAAAGACAAAAAAGGCCCTAGG + Intergenic
1156914832 18:42453612-42453634 GTGAAGACAGAAATGGAGCTGGG + Intergenic
1158473634 18:57760451-57760473 GCAAAGACGAAGGTGGAGATAGG - Intronic
1158717754 18:59895762-59895784 AAAAAGACAGACATTGAGCTAGG - Intergenic
1158756094 18:60327380-60327402 CAAAAGACAAAAAAGGAGGTAGG - Intergenic
1159242664 18:65762831-65762853 GAAAAAAAAAAGATGAAGTTGGG + Exonic
1159433826 18:68389660-68389682 GCAAAGACAAACATGAAGCTTGG + Intergenic
1161621296 19:5298715-5298737 AAAAAGGCAGACATGGAGCTGGG - Intronic
1162038295 19:7954138-7954160 AAAAATACAAAGATTTAGCTGGG - Intergenic
1162051602 19:8037285-8037307 GAAAAGAGAAAGAAGAAGCTGGG - Intronic
1162144709 19:8606560-8606582 AAAAATACAAAAATGTAGCTGGG - Intronic
1162206088 19:9057184-9057206 TAGAAGAGAGAGATGGAGCTGGG - Intergenic
1162350054 19:10143167-10143189 GGACAGTCATAGATGGAGCTTGG + Intronic
1162443072 19:10705208-10705230 GAAAAAATAAATATGGGGCTGGG - Intronic
1162662788 19:12183429-12183451 GAAATCACAAAAAAGGAGCTGGG - Intronic
1163578835 19:18126059-18126081 AAAAAAAAAAAGATGTAGCTGGG + Intronic
1163656487 19:18548739-18548761 TAAAAAACAAAGATGGACCCGGG - Intergenic
1164437536 19:28244368-28244390 GAAAAGCCTAAGATGAAGCAAGG - Intergenic
1164867773 19:31619176-31619198 GAAAATACAAACATTGGGCTGGG + Intergenic
1164931140 19:32177260-32177282 GAAAAGGCAATGAGGGAGCTGGG + Intergenic
1165019023 19:32907880-32907902 GAAAAGATAAAAATGGGGCCGGG - Intronic
1165173523 19:33909990-33910012 GAAAATACAAAGAATTAGCTGGG + Intergenic
1165439477 19:35816441-35816463 GAAAAGACAAAGAGGGAGGGAGG - Intergenic
1165535147 19:36438133-36438155 TAAAAGACAAAGGTGGGGCCGGG + Intergenic
1165604697 19:37091764-37091786 AAAAATACAAAAATTGAGCTGGG + Intronic
1165927028 19:39333146-39333168 GAAAAGACAAAGAATGAGGCAGG + Intronic
1165962269 19:39545002-39545024 GAAAATACAAAGGTAGTGCTTGG + Intergenic
1165986927 19:39777662-39777684 TAAAAGACATAGATGGGGCCAGG + Intronic
1166566748 19:43770198-43770220 GAGAAGACAGGGCTGGAGCTAGG - Intronic
1166705984 19:44908337-44908359 GCAGAGACGAAGAAGGAGCTAGG - Intronic
1167635724 19:50654273-50654295 GAAAAGAGAGAGATGGAGGGAGG - Intronic
1167736929 19:51300491-51300513 TAAAAGCCAAAGATGGTGCTAGG + Intergenic
1167908729 19:52684072-52684094 AAAAATACAAAAATTGAGCTGGG + Intronic
925103212 2:1267064-1267086 GTGAAGAGAAAGATGAAGCTGGG - Intronic
925202827 2:1982665-1982687 GGAGAGACAAAGCTGGGGCTGGG + Intronic
925562829 2:5216609-5216631 GAAAAGACAAAAAGGGAGACAGG - Intergenic
925600283 2:5601883-5601905 GATAAGACAAATAAGAAGCTTGG + Intergenic
925879652 2:8341779-8341801 GGAAAGACAAAGAAAAAGCTTGG - Intergenic
925898133 2:8488778-8488800 AAAGAGAGCAAGATGGAGCTGGG + Intergenic
926367337 2:12145374-12145396 GAAAGGACAAAGGTGGAATTTGG + Intergenic
928099499 2:28427796-28427818 AAAGAGACAAAGAAAGAGCTTGG + Intergenic
929009827 2:37430214-37430236 GAAAAAAAAAAGATGGATCAAGG - Intergenic
929250754 2:39752329-39752351 GAAAAAACGATGGTGGAGCTAGG + Intronic
929432661 2:41901584-41901606 GGAAAGAAAAAGATGGAGCCAGG - Intergenic
931089156 2:58867051-58867073 GAGAGGACAAAGAGCGAGCTGGG - Intergenic
931912807 2:66920255-66920277 GAAAAGACAAATTTTGAGTTTGG - Intergenic
932502093 2:72191976-72191998 GAAAATAGAAATATGGAGCCTGG + Intronic
932534069 2:72573077-72573099 GACAAGGCAAAGAAGGAGCATGG + Intronic
932766100 2:74471168-74471190 AAAAAAAAAAAGATGGAACTGGG + Intergenic
932790830 2:74653478-74653500 AAAAAAAAAAAGAAGGAGCTAGG + Intergenic
933079804 2:77971902-77971924 AAAAATACAAAAATGTAGCTGGG + Intergenic
933337860 2:80983276-80983298 AAAAAGACACAGATGGAACCTGG + Intergenic
933525687 2:83435652-83435674 GGAAAGAAAAAGCTGGAGCATGG - Intergenic
933660396 2:84922929-84922951 GAAAATACAAAGAATTAGCTGGG + Intergenic
933728719 2:85441035-85441057 GCAGAGACATGGATGGAGCTGGG + Intergenic
935014635 2:99168993-99169015 TTAAAGAGACAGATGGAGCTTGG - Intronic
935443429 2:103130949-103130971 GTAAAGACAAAGAGGGAGAGTGG + Intergenic
935755682 2:106274662-106274684 GCTATGACAAAGAAGGAGCTAGG - Intergenic
936450643 2:112631311-112631333 GAAAAGACAAACATACCGCTAGG - Intergenic
936505570 2:113102956-113102978 GACAAGGCACAGAAGGAGCTGGG + Intergenic
936704200 2:115052123-115052145 GAAAAGAAAAACAAGGAGTTTGG + Intronic
936876857 2:117200570-117200592 GAAAAGACACAGAGGGAAATAGG - Intergenic
937288747 2:120769222-120769244 GAAAGGACAAAGCTGTAGATGGG + Intronic
937459029 2:122069676-122069698 GAATGAAGAAAGATGGAGCTGGG - Intergenic
937482715 2:122278935-122278957 AAAAAGAGAAAGATGGGTCTAGG - Intergenic
938306335 2:130258590-130258612 AATAAGAGTAAGATGGAGCTGGG - Intergenic
938696266 2:133837912-133837934 GAAATGACAAGGAGGGAGATAGG + Intergenic
939120481 2:138110309-138110331 TGAAAGACAAGGCTGGAGCTAGG - Intergenic
939443398 2:142277596-142277618 GAGAAGAAAGAGATGGAGATGGG - Intergenic
940220956 2:151350834-151350856 GAAAATACAAAAATGAACCTGGG + Intergenic
940446613 2:153785110-153785132 GAAACAGCAAAGATGGAGCTTGG - Intergenic
940495661 2:154424778-154424800 GAAAAGACAAGTATGGTGGTAGG - Intronic
940718318 2:157254209-157254231 GAAAAGACCAAGAAGAGGCTGGG + Intergenic
941090203 2:161166623-161166645 GAAAAGACCAAGATGTAGTGGGG + Intronic
941781427 2:169449825-169449847 GAAAATACAAATATTCAGCTGGG + Intergenic
941984108 2:171492473-171492495 AAAAAAAAAAAGATGGAGCACGG + Intergenic
941994008 2:171584589-171584611 GTAAAGACAGAAATGGAGTTAGG - Intergenic
942879713 2:180844673-180844695 GAAAAGAGAAAGATGGTAGTTGG + Intergenic
942969132 2:181935950-181935972 GAAAAGAGAAAGAGGCAGTTGGG + Intergenic
943156493 2:184185949-184185971 GAAAAGTAAAAGAGGGGGCTGGG - Intergenic
943400421 2:187402960-187402982 GAAAAGAGAAAGAAAGAGATAGG + Intronic
943435080 2:187854966-187854988 GAAAAGGGAAAGCTGGAACTTGG + Intergenic
943748771 2:191489497-191489519 GAAAAGAGAGAGAAGAAGCTTGG - Intergenic
943899787 2:193418888-193418910 AAAAATACAAAAATGTAGCTAGG - Intergenic
943990429 2:194682870-194682892 GAAAAGGTAAAGATGGAGAAAGG + Intergenic
944789759 2:203113080-203113102 GAGAAGAGAAAGGTGGATCTGGG - Exonic
945313401 2:208342621-208342643 GCAAAAGCAATGATGGAGCTGGG - Exonic
945946821 2:216002766-216002788 GGAAAGACAAAGAAGGAGAATGG - Intronic
945991144 2:216396318-216396340 AAAAAAATAAAGATGTAGCTGGG + Intergenic
946033634 2:216724652-216724674 GAATAAATAAAGATGGGGCTGGG - Intergenic
946294580 2:218773694-218773716 GAAAATACAAAAAATGAGCTGGG - Intergenic
946296433 2:218787331-218787353 GAAAAGACAATGAGGGAGGTGGG + Intronic
947783027 2:232787255-232787277 GAGAAGATGAAGATGGAGGTTGG + Exonic
948821730 2:240553258-240553280 GAGAAGACAGAGAGGGAGCCTGG - Intronic
1169097698 20:2917674-2917696 GATTAGAAAAAGATAGAGCTGGG + Intronic
1169120804 20:3094516-3094538 GAAAAAAAAAAGATTGGGCTTGG + Intergenic
1169237344 20:3941777-3941799 GAAAATAAAAAGATGAAGCTGGG + Intronic
1169461876 20:5802588-5802610 GAAAAGACATGGATATAGCTTGG - Intronic
1169639307 20:7732199-7732221 GATAAGACACAGAGGGAGCGAGG + Intergenic
1169873508 20:10271933-10271955 CAAAATATAAAGATGGAGCGTGG + Intronic
1169946358 20:10993178-10993200 TAAAAGACATACTTGGAGCTGGG + Intergenic
1170444708 20:16414206-16414228 GAAAAGATGAAGATGGAACATGG + Intronic
1170614255 20:17936358-17936380 GAAAATACAACGTTGGAGTTGGG + Intergenic
1171165421 20:22966226-22966248 GGAAAGAGAAAGCTGGAGCTAGG - Intergenic
1171435844 20:25123781-25123803 GAAAAGAAAAATAGGGAGATTGG + Intergenic
1171449439 20:25225473-25225495 GAAAAGACAGAGAGGGAGAGGGG - Intronic
1172170809 20:32930835-32930857 GAGAAGACAGTGATGGAGCACGG - Intronic
1172254596 20:33506110-33506132 GAAAAGAAATAGAAGGGGCTGGG + Intronic
1172582202 20:36057287-36057309 AAAAATACAAAAATGAAGCTGGG + Intergenic
1173480258 20:43393026-43393048 GTACAGACAAAGATGGGGATGGG + Intergenic
1173551469 20:43935764-43935786 GAAAATACAAAAATTTAGCTGGG + Intronic
1174292933 20:49521773-49521795 GCCAAGAGAAAGATGGGGCTTGG + Intronic
1174350543 20:49964404-49964426 AAAAAGGCAAAGATGGGCCTGGG - Intergenic
1175008716 20:55712648-55712670 GAGAAGACAGAAATGGAGCAGGG + Intergenic
1175412130 20:58777337-58777359 TAAAAGACCAGGATGGAGCAGGG + Intergenic
1175672133 20:60912647-60912669 GAAAATACAAAAATTTAGCTAGG + Intergenic
1175850101 20:62085785-62085807 GAAAATACAAAGAATTAGCTGGG - Intergenic
1176992099 21:15509260-15509282 GATAAAACAGAAATGGAGCTAGG + Intergenic
1177306918 21:19330693-19330715 GAAAAGACAGAAATGGTGGTGGG - Intergenic
1178761010 21:35402991-35403013 GAGAAGACGAAGGTGGAGATGGG - Intronic
1178924576 21:36764101-36764123 CAAAAAACAAACATGCAGCTGGG + Intronic
1179061303 21:37982047-37982069 GAAACGACAAAGACGGGGTTGGG - Intronic
1179247923 21:39649473-39649495 GAAAAGCCAGAGCTGGAGGTAGG + Intronic
1179381366 21:40902463-40902485 GAAAACACAAAGACCAAGCTGGG - Intergenic
1179813468 21:43887143-43887165 GCAAAAACAGAGAAGGAGCTGGG - Intronic
1179941847 21:44645265-44645287 GAAGAGACAAAAATAAAGCTTGG + Intronic
1180644340 22:17326171-17326193 CAAAATACAAAAATGTAGCTGGG + Intergenic
1181330241 22:22085485-22085507 GAAAATATAAATATGGAGCCAGG - Intergenic
1181484485 22:23221928-23221950 GAAAAGACAAAAAATTAGCTGGG + Intronic
1181917405 22:26292211-26292233 GAAAAGAGAAAGAGGGAGAGAGG + Intronic
1182294542 22:29305373-29305395 GAGAAGACAGGGATGGAGCCGGG - Intergenic
1182558477 22:31141538-31141560 GAAGAGACTCAGATGGAGCCTGG - Intergenic
1182702504 22:32251932-32251954 GAAAATAGACAGATGTAGCTGGG + Intronic
1182846196 22:33433164-33433186 GGACAGCTAAAGATGGAGCTAGG + Intronic
1182969314 22:34557592-34557614 GAAAAGATGAAGGTGGAGATCGG - Intergenic
1183539223 22:38419859-38419881 AAACCGACAAAGATGTAGCTGGG - Intergenic
1184808415 22:46811781-46811803 GAAAAGCCAAAAATGCAGCTGGG + Intronic
1184984503 22:48120346-48120368 GGAAAGCAAAAGATGGAGCTGGG - Intergenic
1185407984 22:50666549-50666571 GAAAATACAAAAACGTAGCTGGG - Intergenic
949550307 3:5107088-5107110 AAAAAGTCAAAAAAGGAGCTGGG + Intergenic
949923461 3:9022441-9022463 GAGAAGAGAAATATTGAGCTGGG + Intronic
949954909 3:9259601-9259623 GAACAAACAAATATGTAGCTGGG - Intronic
950075226 3:10182262-10182284 AAAAAGAAAATGATGTAGCTGGG - Intronic
952874427 3:37931448-37931470 GAGAAGACACAGAGGGGGCTGGG - Intronic
953817045 3:46167043-46167065 GAACAGACAAATAACGAGCTTGG - Intronic
953817161 3:46168412-46168434 AAAAAGACAAAGAAGGGGCCTGG - Intronic
954739889 3:52740636-52740658 AAAAATACAAAAATGTAGCTGGG + Intronic
954965221 3:54604554-54604576 GAAGAAACAAAGATGATGCTAGG - Intronic
954965461 3:54606537-54606559 GAAGAGACAAGGATGATGCTAGG + Intronic
955245004 3:57217067-57217089 GAAAAGAACAAGATGTACCTGGG - Intronic
955788659 3:62565969-62565991 GAAAAAACAAAGATGAAGAGAGG - Intronic
956258683 3:67312546-67312568 GAAAAAAAAAAGATGGAATTTGG - Intergenic
957307663 3:78479181-78479203 GAATAGATAAAGATAGAGATTGG - Intergenic
957416250 3:79909297-79909319 AAAAAGACACAGATGTAGCTAGG + Intergenic
957571860 3:81957111-81957133 GCAACAACATAGATGGAGCTAGG - Intergenic
958088662 3:88847417-88847439 GCAAGGACATGGATGGAGCTGGG - Intergenic
958879107 3:99649380-99649402 GAAAAGAAAAAAATAGAGGTAGG + Intronic
959256701 3:104024370-104024392 GCAGGGACACAGATGGAGCTGGG + Intergenic
959479374 3:106853190-106853212 CAAAACACAAAAAAGGAGCTCGG + Intergenic
959785177 3:110288330-110288352 GAAATTAAAAAGATGGGGCTGGG - Intergenic
960204423 3:114877985-114878007 TAAAAGAGAAAGAGGGAGCCTGG - Intronic
960230226 3:115217414-115217436 CAAAATAAAAAGATGTAGCTCGG + Intergenic
960812313 3:121636677-121636699 GAGAAGACAAAGATGGAAGTAGG + Intronic
961638182 3:128347270-128347292 AAAAAGAAGAAGAGGGAGCTTGG + Intronic
962038212 3:131676677-131676699 GCAAGGACATGGATGGAGCTAGG - Intronic
962223605 3:133585653-133585675 AAAAATACAAAGATGTAGCGGGG - Intronic
963300663 3:143593661-143593683 GAAAAGAGAAAGAGGGAGAGGGG + Intronic
963633193 3:147759796-147759818 GAAAAGACAAATGGGGAGCAGGG - Intergenic
963801725 3:149682991-149683013 AAAAAGACAAAGATGGGGAAAGG + Intronic
964077309 3:152707256-152707278 GAAAGGATAAGCATGGAGCTAGG - Intergenic
964346258 3:155757450-155757472 AAAAATACAAAAATGTAGCTGGG + Intergenic
964704579 3:159604215-159604237 GAAAAGACAAAGATGGATGTTGG - Intronic
966378034 3:179317049-179317071 AAAAATACAAAGAAGTAGCTGGG - Intergenic
966983990 3:185163321-185163343 GAAAAGAACAAGATGGAGTTGGG - Intergenic
967050106 3:185775027-185775049 AAAAAAAAAAAGAGGGAGCTGGG + Intronic
967115753 3:186336204-186336226 GAAAGGACAGAAATGGAACTTGG - Intronic
967553722 3:190830800-190830822 GAAAAAAGAAACATGGAACTGGG - Intergenic
967569244 3:191009095-191009117 GAAAAGAGACATATGAAGCTAGG + Intergenic
967707563 3:192669424-192669446 GAAAATACAAAAATTTAGCTGGG + Intronic
968004808 3:195235215-195235237 GAAAATACACAGTTAGAGCTGGG - Intronic
968319375 3:197751343-197751365 GAAATGAGAAAGCTGGGGCTGGG + Intronic
968827583 4:2910892-2910914 GAAAACACAAAGGTGGAACAAGG - Intronic
969125257 4:4943040-4943062 GAAAAGACAAACACTGAGCGTGG - Intergenic
969933653 4:10659041-10659063 GAAAATACAAAAAATGAGCTGGG + Intronic
970568991 4:17361081-17361103 GTAAAGACAGAGGTGGAGATTGG - Intergenic
970731579 4:19110533-19110555 AAAAAGATAAAATTGGAGCTTGG - Intergenic
971248711 4:24953375-24953397 GAAAAGACAAAAATGAAGCAGGG - Intronic
971251752 4:24978577-24978599 GAAGAGACAAGGATGGGGGTAGG + Intronic
971939318 4:33193753-33193775 GAAAAGACAAAAATGTAGGCGGG - Intergenic
972017727 4:34267017-34267039 GAAAAGAAAAAAATATAGCTGGG - Intergenic
972064870 4:34928964-34928986 GAAATGAAAAAGATGGATATAGG + Intergenic
972932326 4:44088011-44088033 AAAAAGTGAAAGATGGAGCCTGG - Intergenic
973697185 4:53501576-53501598 GAAAAGACAGAGATGGGTCTGGG - Intronic
973878735 4:55247581-55247603 TAAAAGCCCAAGATGGAGCGAGG + Intergenic
973941116 4:55911468-55911490 AAAAAGACAAAAAGTGAGCTGGG + Intergenic
974335537 4:60539744-60539766 GAAGAGACAAAAATGGAAGTGGG - Intergenic
974958575 4:68673015-68673037 GAGAAGACAATGAGGAAGCTTGG - Intergenic
975323292 4:73032763-73032785 GAAGAGACAGAAATGGAGTTAGG + Intergenic
975603157 4:76125128-76125150 AAAAATACAAAGAAGTAGCTGGG + Intronic
975907090 4:79226403-79226425 AAAAAGAAAAAGATTTAGCTGGG - Intronic
975957023 4:79853358-79853380 GTAAAGAAAAAGTTGGAGGTAGG - Intergenic
976097624 4:81526513-81526535 GAAAAGAGAAAGATTCATCTAGG + Intronic
976171016 4:82304379-82304401 GAAAAGAGAAAAAAGGAACTAGG + Intergenic
976788000 4:88844634-88844656 GAAAAGACAAGCATAGAGTTGGG + Intronic
978553709 4:109955696-109955718 GAAAAAACAAATAGGGAGTTAGG + Intronic
979024745 4:115554962-115554984 GAAAGCACAAAGGTGGAGTTAGG - Intergenic
979291455 4:118983233-118983255 GAAAAGAAAAGGGTGGAGGTAGG - Intronic
979890826 4:126091715-126091737 GAAAAGACAAGGCTCAAGCTGGG - Intergenic
980188867 4:129497083-129497105 GCAAAGGAAAAGATGGAGCATGG - Intergenic
980499573 4:133630946-133630968 GAAAAGGCAAAGATGTAGACTGG + Intergenic
981148990 4:141359491-141359513 GAAAAGATAAGAATGGAGGTGGG - Intergenic
981508516 4:145529382-145529404 GAAAAGACAGAGAGGGAACTAGG + Intronic
982008271 4:151083420-151083442 AAAAATACAAAAATGTAGCTGGG + Intergenic
982044307 4:151427449-151427471 GCAAACATAAAGAAGGAGCTGGG - Intronic
982049027 4:151480830-151480852 GAAAAGAAAAAAATGGGGGTGGG - Intronic
982667721 4:158287044-158287066 GAAAAGAGAACTATGGAGGTAGG + Intergenic
982851938 4:160328557-160328579 GAAAAGACCAATAATGAGCTTGG - Intergenic
983025985 4:162739030-162739052 GAAAAGACAATGATAGAGATGGG + Intergenic
983263528 4:165483284-165483306 GCAACGACATGGATGGAGCTAGG - Intronic
984951393 4:185010457-185010479 GAAGGGACAAAGAAGGAGATGGG + Intergenic
986865629 5:11983106-11983128 GAAGAGACAAAGATGGCCCTAGG - Intergenic
987318766 5:16748595-16748617 GAAAAGAAAAAGAGGGAGAGAGG + Intronic
987745028 5:21959612-21959634 AAAAAGACAAAGAAGGGGCCGGG + Intronic
989497013 5:42121610-42121632 GAAAAGAGAATGATGGAGCGGGG + Intergenic
990102125 5:52203650-52203672 GAAAAGACAGATAAGGAACTAGG + Intergenic
990145451 5:52755167-52755189 GAAAAGACAAAGAGGTAAATAGG + Intergenic
991086703 5:62654314-62654336 AAAAAGACAAAAAAGTAGCTAGG - Intergenic
991410113 5:66337404-66337426 GAAAAGACAAAAAAAGAGGTGGG - Intergenic
991765234 5:69969742-69969764 AAAAAGACAAAGAAGGGGCCGGG + Intergenic
991782089 5:70148411-70148433 AAAAAGACAAAGAAGGGGCCGGG - Intergenic
991844468 5:70844813-70844835 AAAAAGACAAAGAAGGGGCCGGG + Intergenic
991874532 5:71148726-71148748 AAAAAGACAAAGAAGGGGCCGGG - Intergenic
992081020 5:73234294-73234316 GAAGGGAAAAAGATGGAGGTGGG - Intergenic
992205058 5:74423098-74423120 AAAAAGAAAAAGCTGGGGCTGGG + Intergenic
992379417 5:76222395-76222417 GAAATGACAAATATAGAGGTGGG + Intronic
992855003 5:80850550-80850572 GCAAAGACAGAGATTGTGCTGGG + Intronic
993488933 5:88522602-88522624 GAAAAGAAAAAAATTGGGCTGGG - Intergenic
994133557 5:96259691-96259713 GAGAAGAGAAAGAGGAAGCTAGG - Intergenic
994323077 5:98415528-98415550 GAACTGACAGAAATGGAGCTAGG - Intergenic
995470598 5:112498058-112498080 GAAAAGAGAGAGACGGAGGTAGG - Intergenic
996658402 5:125968921-125968943 GAAAACACAATGATAGAGCCAGG + Intergenic
997162406 5:131623014-131623036 AAAAAGTTAAAGAAGGAGCTGGG - Intronic
997199785 5:132002865-132002887 GAAAGGAAAAAGATGGTGATGGG + Intronic
997440001 5:133902493-133902515 GAAAAGAAAAAGAAGTTGCTAGG + Intergenic
998570694 5:143254005-143254027 GAAAGGACAGAGCTGGCGCTGGG + Intergenic
998715418 5:144878412-144878434 GAAAAGACAAATATTAAGATTGG - Intergenic
998906180 5:146907698-146907720 GAAAAGACAAAAACTTAGCTGGG - Intronic
1000041756 5:157489688-157489710 AAAAAGACAAAGAGGGGGCTGGG + Intronic
1000447682 5:161344302-161344324 GAAAATACAGAGATGGGGCTAGG + Intronic
1001330761 5:170760765-170760787 GAAAATGCACAGATGGACCTAGG - Intergenic
1001747392 5:174102203-174102225 GAAAAGAGGAAGATGGATGTCGG - Intronic
1001925534 5:175633475-175633497 AGACAGACAAACATGGAGCTTGG + Intergenic
1002060977 5:176625899-176625921 GAAAAGACAGAGAGGGCGATGGG - Intronic
1002365097 5:178703685-178703707 GAAAAGACAAATATTTGGCTGGG + Intergenic
1002468206 5:179418480-179418502 AAAAATACAAAGAAGTAGCTGGG + Intergenic
1002552923 5:180010518-180010540 AAAAATACAAAAATGTAGCTGGG - Intronic
1003142244 6:3481288-3481310 GAAGAGAAAAAGATGGGTCTAGG - Intergenic
1003504912 6:6733008-6733030 GAAAAGACAACTATGGAGACAGG + Intergenic
1004025610 6:11815341-11815363 GAAAATGCCAAGCTGGAGCTGGG + Intergenic
1004319981 6:14624840-14624862 AAAAAGACAAAGATGGAGGTGGG - Intergenic
1004777789 6:18868051-18868073 AAAAATACAAAAAAGGAGCTGGG + Intergenic
1004924000 6:20402092-20402114 GAAAAGAGAGAGAGGGGGCTCGG + Intronic
1005702732 6:28418825-28418847 AAAAAAAAAAAGATGCAGCTAGG + Intergenic
1006301650 6:33196560-33196582 GAAAGGACAAGGATGGGGATGGG - Exonic
1006370895 6:33643055-33643077 GAAAAGACAAAGATGGAGCTTGG + Intronic
1007663182 6:43498896-43498918 GAAAAAACAAAGATGGTGAAAGG - Intronic
1007831414 6:44641624-44641646 CAATAGACAAAGCTGGAGTTTGG - Intergenic
1008634800 6:53400028-53400050 GAAAAGAAAAAGCAGGAACTGGG - Intergenic
1008736097 6:54545877-54545899 GAAAAGACAAAGAGTGGGCCGGG - Intergenic
1008843982 6:55939445-55939467 GCAGGGACATAGATGGAGCTGGG + Intergenic
1008916472 6:56792906-56792928 AAAAATACAAAAATGTAGCTAGG + Intronic
1008938372 6:57017863-57017885 GAAATGACATATATAGAGCTAGG - Intronic
1008949053 6:57134198-57134220 GTAAAGTCAAAGCTGGACCTGGG + Intronic
1009008589 6:57816044-57816066 GAAAAGACAAAGGTGGTGTGGGG - Intergenic
1009421046 6:63465339-63465361 AAAAATACAAAGATTTAGCTGGG - Intergenic
1009594055 6:65711528-65711550 GTACAAACAAAAATGGAGCTGGG - Intergenic
1010427540 6:75743748-75743770 GGAAGGACACAGATGGACCTAGG + Intergenic
1011684273 6:89811852-89811874 GAAAATACAAAGGTGTAGCCAGG - Intronic
1011732734 6:90282449-90282471 GCAGGGACATAGATGGAGCTGGG - Intronic
1011951993 6:92978276-92978298 GAAAATACAAAGAGTTAGCTGGG + Intergenic
1011996017 6:93589450-93589472 GAGAAGACAAAGGTGGAAGTAGG - Intergenic
1012003154 6:93680096-93680118 GAAAAGAAAAACATGAAGCAAGG - Intergenic
1012232467 6:96776507-96776529 AAAAAGAGAAAGAGAGAGCTGGG - Intergenic
1012849502 6:104429868-104429890 GAAAAGAGAGAGATGGGGCCAGG + Intergenic
1013638807 6:112053677-112053699 GAAAAAATACAGATGGAGCAGGG - Intergenic
1013771881 6:113637168-113637190 GAAAAAACAAACATGAACCTTGG + Intergenic
1013941950 6:115675061-115675083 GAAAATACAAAGAATTAGCTGGG - Intergenic
1013969577 6:116000936-116000958 GAAATAAGAAATATGGAGCTTGG + Intronic
1014535442 6:122608276-122608298 GAAAAGACAAGGAGCAAGCTTGG - Intronic
1015012730 6:128371658-128371680 GAAAAGATAAAGATGGTGATTGG - Intronic
1015478549 6:133681266-133681288 AAAAAGACAAAAAATGAGCTGGG - Intergenic
1015917476 6:138232209-138232231 TAAAAGAAAAAGGTGGGGCTGGG + Intronic
1016043622 6:139458639-139458661 AAAAAGAAAAAGATTGGGCTGGG - Intergenic
1016634736 6:146275055-146275077 AAAAAGAAAAAGATGGCACTTGG + Intronic
1016780205 6:147949429-147949451 GAAAAGTCAAAGCTGGAGAGGGG + Intergenic
1016956535 6:149632450-149632472 GCAAAGACAGACACGGAGCTTGG + Intronic
1017159933 6:151355282-151355304 CAAAAAACAAAGATAGGGCTGGG - Intronic
1017159976 6:151355594-151355616 AAAAAAACAAAGATGGGGCCGGG - Intronic
1017424025 6:154302456-154302478 GAAAAGAAAAAGCTGGGACTTGG - Intronic
1017526946 6:155249414-155249436 GAAAACACAAGAATGGAGCCAGG - Intronic
1017608462 6:156158347-156158369 CTAGAGACAAAGATGGAGGTAGG + Intergenic
1018023346 6:159783992-159784014 CAAAAAACAAAAATGAAGCTTGG - Exonic
1018039813 6:159911823-159911845 GATATGAAGAAGATGGAGCTAGG - Exonic
1018551077 6:164999533-164999555 GAGAAGACAGAGATGGCTCTGGG + Intergenic
1019327590 7:445941-445963 GAAGAGGAAAAGATGGAGGTGGG + Intergenic
1019971393 7:4543800-4543822 GAAGAGACATGGATGGAGTTGGG - Intergenic
1019987432 7:4667976-4667998 TAAAAAACAAAAATGAAGCTCGG + Intergenic
1020075123 7:5252875-5252897 GAAAATACAAAAAGTGAGCTGGG - Intergenic
1020205615 7:6113062-6113084 AAAAATACAAAAATGTAGCTGGG - Intronic
1020775124 7:12443404-12443426 AAAATGACAAAAATGGAGATGGG - Intergenic
1020847550 7:13306423-13306445 GAAAATACAAAAATATAGCTGGG + Intergenic
1021422187 7:20458175-20458197 GAAAAAAAAAAGAAGTAGCTGGG - Intergenic
1021842499 7:24732280-24732302 GAAAAAACAAAGTTTGAACTGGG - Intronic
1022038181 7:26553936-26553958 GATGAGACAAAGGTGGGGCTGGG - Intergenic
1022157578 7:27675712-27675734 GAAAAGTCACAGTTGGGGCTGGG - Intergenic
1022528035 7:31051004-31051026 GTAAAGAGAAACATGGACCTAGG + Intergenic
1022671422 7:32459803-32459825 GAATATCCAAAGATGCAGCTGGG + Intergenic
1023691676 7:42795628-42795650 CAAAAAACAAAAATGAAGCTTGG + Intergenic
1023986389 7:45099595-45099617 GTGAAGACAACGATGGAGTTTGG + Intergenic
1024124755 7:46281937-46281959 AAAAAAAAAAAGATAGAGCTGGG + Intergenic
1024282376 7:47730117-47730139 GAAACCACAAAGTGGGAGCTGGG - Intronic
1025223169 7:57133569-57133591 AAAAAGAAAAAGGTGGAGCTGGG + Intronic
1025742070 7:64205913-64205935 AAAAAGAAAAAGGTGGGGCTGGG - Intronic
1026125891 7:67579181-67579203 AAAAATACAAAAATTGAGCTGGG + Intergenic
1026982911 7:74537112-74537134 AAAAATACAAACATGCAGCTGGG + Intronic
1027353402 7:77334270-77334292 GCAGGGACACAGATGGAGCTGGG + Intronic
1027912649 7:84271883-84271905 TCAAAGACAAAGATTGAACTAGG - Intronic
1028004892 7:85552697-85552719 GAAGAAACATGGATGGAGCTGGG + Intergenic
1028598391 7:92572556-92572578 GAAAATACAAAAAAGTAGCTGGG + Intronic
1029022174 7:97376313-97376335 GCAGGGACACAGATGGAGCTGGG + Intergenic
1029180585 7:98698621-98698643 GAAAAAAGAAAGATGAACCTTGG - Intergenic
1029342183 7:99954266-99954288 GAAAATACTAATATGGGGCTAGG - Intergenic
1031216163 7:118895024-118895046 GGAAAGAAAAAGATTGAGGTAGG + Intergenic
1031774247 7:125886764-125886786 GAAGAGAAAAAAATGGGGCTTGG + Intergenic
1034533586 7:151712776-151712798 GGAAAGACAGAGATGGAGGCTGG - Intronic
1034906350 7:154950819-154950841 GAAAAGACATGGAGGAAGCTGGG + Intronic
1035356839 7:158280823-158280845 GAAATGACAAAGATGGAAAGCGG + Intronic
1035608522 8:945538-945560 GAAGAGACAAAGATGGGGCAGGG - Intergenic
1035856036 8:2977396-2977418 GCAGAGACATGGATGGAGCTTGG - Intronic
1036034107 8:5000381-5000403 GAAAAGACAAAAAATTAGCTGGG + Intergenic
1036565964 8:9938306-9938328 GCAAGGTCAAAGATGGAGCATGG - Intergenic
1037087158 8:14866647-14866669 AAAAATACAAAGAATGAGCTGGG + Intronic
1037094002 8:14961191-14961213 AAAAAGAAAATGATGGAGCTGGG - Intronic
1037842448 8:22254909-22254931 GAAAAAACAGAGATGGTGATGGG + Intergenic
1038163693 8:25064338-25064360 GCACAGCCAAAGATGGAGTTTGG + Intergenic
1038164336 8:25070438-25070460 GCAACAACATAGATGGAGCTAGG + Intergenic
1038208604 8:25493488-25493510 TAAAAGACAAAGAACAAGCTTGG + Intronic
1038308732 8:26428626-26428648 GGAAAGAAAAAGATGGAGAAAGG - Intronic
1038410865 8:27358704-27358726 GAAAAGGCAAAGATGAAGCATGG - Intronic
1038731870 8:30135185-30135207 TAAAAGAAAATGATGGGGCTGGG - Intronic
1038906806 8:31913606-31913628 GAGAAGACAAAGATGCAAATAGG + Intronic
1039633212 8:39134858-39134880 AAAAAGATAAAGATGGGGCCTGG + Intronic
1039978156 8:42384436-42384458 GAAAAGAATCAGATGTAGCTGGG - Intergenic
1040486489 8:47877471-47877493 TAAAAGGCCAAGATGAAGCTTGG + Intronic
1040943637 8:52858172-52858194 AAAAATACAAAAATGTAGCTGGG - Intergenic
1041054579 8:53970650-53970672 GGAAAGACAAAGAAGGACTTAGG - Intronic
1041458197 8:58082822-58082844 AAAAAAACAAAAATGGAGATGGG - Intronic
1041545430 8:59037159-59037181 GAAAAAAAAAAAAAGGAGCTTGG - Intronic
1042421126 8:68590249-68590271 GAAAAGCAAAAGATGGAGGAAGG + Intronic
1042444791 8:68871347-68871369 CAGAAAACAAAGATGGAGGTAGG - Intergenic
1042587677 8:70359941-70359963 GAAATATCAAAGATGGAACTGGG - Intronic
1043043422 8:75291032-75291054 GAAAATACAAAGAGGCATCTTGG - Intergenic
1043192045 8:77237692-77237714 GAAAAGACAGAGAGGGAGGGAGG - Intergenic
1043439576 8:80265473-80265495 GAAAAGAAAAAGATGTGGCTGGG - Intergenic
1044092911 8:88024369-88024391 GAAAAGACAAAGACTACGCTGGG + Intergenic
1044602940 8:94024116-94024138 AAAAAGAAAAAAATGTAGCTAGG - Intergenic
1045334504 8:101186747-101186769 GAAAAGAATAAAATGGATCTCGG + Intronic
1045689767 8:104748223-104748245 AAAAAGACAAAGATTTGGCTGGG + Intronic
1045987950 8:108271629-108271651 GCAAAGAGAAAGTTGGAGTTAGG + Intronic
1046120133 8:109835859-109835881 GTAATGAGAAAGATGGAGATAGG - Intergenic
1046155489 8:110284331-110284353 GAAATTATAAAGATGGGGCTGGG - Intergenic
1046746538 8:117882239-117882261 AAAAAGACAAAAAAGTAGCTGGG - Intronic
1047011854 8:120681352-120681374 GGACAGACAGCGATGGAGCTGGG + Intronic
1047490190 8:125368331-125368353 GGAAAGTCAGAGATGGAACTAGG + Intergenic
1047758457 8:127936470-127936492 GAAAGGAGAAAGGTGGTGCTGGG + Intergenic
1048265981 8:132987063-132987085 AAAAAAAAAAAGATGGAGCATGG + Intronic
1048322651 8:133412398-133412420 GAAAGGGCATGGATGGAGCTGGG - Intergenic
1048333354 8:133485976-133485998 GAAAAGACAAAGGTGATGGTAGG - Intronic
1049552156 8:143265271-143265293 GAAAAGAAAAAAGAGGAGCTGGG + Intronic
1050532743 9:6605049-6605071 GAAAAGACAGAGAGAGAGATAGG + Intronic
1050553121 9:6765191-6765213 GATAAGACATGGGTGGAGCTTGG - Intronic
1050849696 9:10268104-10268126 AAAAAAAAAAAGATGGAGATGGG - Intronic
1051346430 9:16154997-16155019 GTAAAGACAAAGATGGGAGTCGG - Intergenic
1051401248 9:16685434-16685456 GAAAAGACAACCATTGAGTTAGG - Intronic
1052104217 9:24492409-24492431 CAAAATCCAAAGATGGAGCGAGG + Intergenic
1052133374 9:24879403-24879425 GAAAAGAGAAAAATGAAGCAGGG - Intergenic
1052301641 9:26958841-26958863 GAAAAGAAAAAGATGGTGGATGG + Intronic
1052879958 9:33595685-33595707 GAAAATGCACAGATGCAGCTTGG + Intergenic
1053496015 9:38548535-38548557 GAAAATGCACAGATGCAGCTTGG - Intronic
1055721028 9:79175050-79175072 GTAAAGACAAAGGCAGAGCTTGG - Intergenic
1055797037 9:79985894-79985916 AAAGAGAGAAAGATGGAGTTAGG + Intergenic
1055959929 9:81810633-81810655 GTAAATAAATAGATGGAGCTGGG + Intergenic
1056586124 9:87928346-87928368 GAAAATGCACAGATGCAGCTTGG - Intergenic
1056610758 9:88124597-88124619 GAAAATGCACAGATGCAGCTTGG + Intergenic
1057673770 9:97120448-97120470 AAAAAAAAAAAGATGGAGATTGG + Intergenic
1057675944 9:97136053-97136075 GAAAATGCACAGATGCAGCTTGG - Intergenic
1057809944 9:98250140-98250162 GAGAAGGCAATGCTGGAGCTTGG + Intronic
1058427776 9:104890418-104890440 GAAAATACAAAAAAGTAGCTGGG + Intronic
1058968318 9:110057351-110057373 AAAAAAACAGAGAAGGAGCTGGG - Intronic
1059333679 9:113554464-113554486 AAAAATACAAAAATGTAGCTGGG - Intronic
1060564924 9:124582262-124582284 GCAAGGACACAGATGAAGCTGGG + Intronic
1061122231 9:128650696-128650718 AAAAATACAAAAATGGGGCTGGG - Intronic
1061317491 9:129805433-129805455 AAAAAAAAAAAGATGGAGCCTGG + Intronic
1061739097 9:132686454-132686476 GAAAACACAAAGGAGGAGGTTGG - Intronic
1061976827 9:134072656-134072678 GAAAAATCAAAAATGTAGCTGGG + Intergenic
1062243868 9:135553347-135553369 GAAAAGACGCAGAGGGAGCTGGG - Intergenic
1062348550 9:136127304-136127326 GAAAAGACACAGAGGGACCCAGG - Intergenic
1062723124 9:138054800-138054822 GAAAACACCAAGATTTAGCTAGG - Intronic
1185590414 X:1272784-1272806 AAAAAGAAAAAGAAGAAGCTAGG - Intronic
1186203920 X:7181788-7181810 AAAAAGACAATGATCAAGCTGGG + Intergenic
1186333956 X:8566163-8566185 GAAATGACCAACATGGAGTTGGG - Intronic
1186416199 X:9384940-9384962 GAAAAGAAAAAGAAAGAGCCTGG + Intergenic
1186604481 X:11076311-11076333 GAGAATACAAAGAGGTAGCTAGG + Intergenic
1188215522 X:27471763-27471785 AAAAAGACAAAGATAGGTCTCGG + Intergenic
1188216677 X:27487440-27487462 AAAAAGACAAAAATGTAGCAGGG - Intergenic
1188227468 X:27618359-27618381 GAAAAGAAAAAAATGGGGATTGG + Intronic
1188356394 X:29196987-29197009 TAAAAGAAAAAGATGAAGTTGGG - Intronic
1189249237 X:39587266-39587288 GAAAAGATGAAGGTGGAGATGGG - Intergenic
1189899927 X:45696024-45696046 GAAAAGCAAAGGATGGAGGTGGG + Intergenic
1190154836 X:47981737-47981759 AAAAATACAAAAATGTAGCTGGG + Intronic
1190271307 X:48865950-48865972 CAAAATACAAAGATGGGGCCGGG + Intergenic
1191705812 X:64093590-64093612 GAAGAGACAAAAGAGGAGCTTGG + Intergenic
1192475775 X:71441173-71441195 GAAAATATACAGATGGGGCTTGG - Intronic
1195016268 X:100784782-100784804 GAAAAGTCAAAGTGGGAACTGGG + Intergenic
1195619497 X:106938856-106938878 GAAATTGCAAAGATGGAGATGGG + Intronic
1196794490 X:119491214-119491236 AAAAATACAAAAATGTAGCTGGG - Intergenic
1197268165 X:124397931-124397953 GAAAAGTCACAGTTGGGGCTGGG + Intronic
1197414555 X:126159068-126159090 GAAAAGACAGAGAAAGAGCGGGG - Intergenic
1197835154 X:130686385-130686407 CAGAAGGCAAAGATGGAGCGAGG - Intronic
1198281591 X:135148209-135148231 GAAGAGACACAGATGGAAATAGG + Intergenic
1198289368 X:135224313-135224335 GAAGAGACACAGATGGAAATAGG - Intergenic
1198424641 X:136504534-136504556 GACAAGACAAAGATGAGGCGAGG - Intronic
1198551634 X:137751534-137751556 GGAAAGGCAAAGATGGAGCAGGG - Intergenic
1199851827 X:151729309-151729331 TTATAGACAAAGATGGGGCTGGG - Intergenic
1201070618 Y:10144586-10144608 GCACAGCCAGAGATGGAGCTTGG - Intergenic