ID: 1006373032

View in Genome Browser
Species Human (GRCh38)
Location 6:33657079-33657101
Sequence AGCCACATGCTGTTGCTTTG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 201
Summary {0: 1, 1: 0, 2: 0, 3: 11, 4: 189}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1006373029_1006373032 7 Left 1006373029 6:33657049-33657071 CCACATAATCAGAACCGCAAGCG 0: 1
1: 0
2: 0
3: 5
4: 23
Right 1006373032 6:33657079-33657101 AGCCACATGCTGTTGCTTTGTGG 0: 1
1: 0
2: 0
3: 11
4: 189
1006373028_1006373032 18 Left 1006373028 6:33657038-33657060 CCTATGCAGAGCCACATAATCAG 0: 1
1: 0
2: 0
3: 17
4: 219
Right 1006373032 6:33657079-33657101 AGCCACATGCTGTTGCTTTGTGG 0: 1
1: 0
2: 0
3: 11
4: 189
1006373031_1006373032 -7 Left 1006373031 6:33657063-33657085 CCGCAAGCGGTCACACAGCCACA 0: 1
1: 0
2: 1
3: 7
4: 135
Right 1006373032 6:33657079-33657101 AGCCACATGCTGTTGCTTTGTGG 0: 1
1: 0
2: 0
3: 11
4: 189

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1006373032 Original CRISPR AGCCACATGCTGTTGCTTTG TGG Intronic
901139716 1:7020790-7020812 AGCCACTTCCTGTGGCATTGGGG - Intronic
902912817 1:19613195-19613217 TCCCACTTGCAGTTGCTTTGGGG + Intronic
903121445 1:21219164-21219186 AGTCCCCTGCTGTGGCTTTGGGG + Intronic
904622671 1:31784700-31784722 AGGCAGATGCTTTGGCTTTGGGG + Intergenic
904919732 1:33997593-33997615 TGACCCATGCTGTTGCTTTTAGG + Intronic
906013498 1:42552062-42552084 AGCCAAATTCTGTTCTTTTGGGG + Intronic
906825184 1:48971801-48971823 AGCCACATGCACTTTTTTTGAGG - Intronic
907327464 1:53649355-53649377 AGCCACCTCCTGTTGCTATTGGG + Intronic
909781381 1:79551525-79551547 TGCCCCATGCTTTTGCTGTGAGG - Intergenic
910602929 1:89050755-89050777 AGGCACATGCAGATGCTTGGTGG - Intergenic
910637790 1:89428495-89428517 AGGCACATGCAGATGCTTGGTGG + Intergenic
911983269 1:104592835-104592857 TGCCACCTGGTCTTGCTTTGTGG + Intergenic
916561035 1:165934252-165934274 AACCACATGCTGGGGCTTTGGGG + Intergenic
918839497 1:189515545-189515567 ATGTACATTCTGTTGCTTTGGGG - Intergenic
920589057 1:207198612-207198634 AGGTATATTCTGTTGCTTTGGGG - Intergenic
1062779786 10:191988-192010 AACCCCATGCTGTTGTTTTGAGG - Intronic
1062952142 10:1512492-1512514 GACCTCATTCTGTTGCTTTGAGG - Intronic
1063299724 10:4840638-4840660 AGCCACATGAAGCTGCTGTGGGG + Intronic
1064524850 10:16243883-16243905 CCCCCAATGCTGTTGCTTTGGGG + Intergenic
1064574116 10:16727124-16727146 GGCCACATCCTGTTCCCTTGTGG - Intronic
1066640258 10:37548378-37548400 AGCAACACGTTCTTGCTTTGTGG + Intergenic
1066756121 10:38714639-38714661 AGCTAAATGCTGTTTCTCTGGGG + Intergenic
1067844629 10:49710043-49710065 GGTGACATGCTGCTGCTTTGAGG - Exonic
1068900551 10:62264943-62264965 AGCCACCTGCTGGTTCTTTAAGG - Intronic
1069091384 10:64203341-64203363 TGACAGATGCTGTTGGTTTGTGG + Intergenic
1070213155 10:74347606-74347628 AGCCACGTGGTCTTGCTTAGAGG + Intronic
1070488275 10:76951626-76951648 AGCTACATGAGGATGCTTTGAGG - Intronic
1070763691 10:79044282-79044304 AGGCACATGCTGTTCCCCTGGGG - Intergenic
1070961998 10:80505734-80505756 AGCCACACGGTGGTGCTGTGAGG - Intronic
1070998872 10:80811944-80811966 AGCCACGTGCTGTTCTTTTTTGG - Intergenic
1071351983 10:84755706-84755728 AGTCACAGGCTGTAGCTTTAGGG - Intergenic
1077532864 11:3105440-3105462 AGCCCAGTGCTGTAGCTTTGGGG + Intronic
1079109374 11:17595855-17595877 GGCCATATTCTGTTGGTTTGAGG + Intronic
1081587144 11:44394367-44394389 ATGCACATTCTGTTGATTTGGGG + Intergenic
1082766450 11:57171974-57171996 TAGCAGATGCTGTTGCTTTGAGG - Intergenic
1084710427 11:70840630-70840652 AGCCACATACTGTAGCTCAGTGG + Intronic
1085526597 11:77167614-77167636 AGCACCATGCTGTTGCTAAGGGG - Intronic
1086830887 11:91561971-91561993 AGCCACATGAAGGTTCTTTGTGG - Intergenic
1089258175 11:117205015-117205037 AGCAGCATGCAGTGGCTTTGGGG + Exonic
1090666890 11:128920290-128920312 CGCCTCCTGCTGCTGCTTTGAGG + Exonic
1091424362 12:374046-374068 ATGCATATTCTGTTGCTTTGGGG + Intronic
1093118858 12:15243952-15243974 AGCCTCATGCTGTAGTTTTATGG + Intronic
1094268534 12:28585857-28585879 AGCCACCTGAAGATGCTTTGGGG + Intergenic
1096276448 12:50212666-50212688 AACCAAATGCTAATGCTTTGGGG + Intronic
1097338425 12:58410323-58410345 AGCCACAGGAGGTTGCTCTGTGG - Intergenic
1097560038 12:61191716-61191738 AGCCACATGCTTTTTCTCTATGG + Intergenic
1098115925 12:67176481-67176503 AGGTATATGCTGTTGATTTGGGG - Intergenic
1100574913 12:95882085-95882107 AGCCACATGATTATGCTTTAAGG - Intronic
1103051382 12:117782887-117782909 ACCCACAGGATGTTGCTATGTGG - Intronic
1107331905 13:39310571-39310593 ACCCACATTATGTTACTTTGTGG - Intergenic
1108719346 13:53115048-53115070 ATACTCATGCTGTTGCTTTGTGG + Intergenic
1109457196 13:62608943-62608965 ATGCACATTCTGTTGATTTGGGG + Intergenic
1112747101 13:102538725-102538747 ATGCAGATGCTGTTGGTTTGAGG + Intergenic
1117740588 14:58815352-58815374 AGCCACATGCGGTTGCTGATGGG - Intergenic
1118354640 14:65002847-65002869 AGGCAGATCCTGTTCCTTTGTGG + Intronic
1119145586 14:72310778-72310800 AGACACAGGCTGCTGCTTTAAGG + Intronic
1119181496 14:72608336-72608358 ACCCACAGGCTGTTGCTTTAAGG + Intergenic
1119909679 14:78338196-78338218 TGTCAGATGGTGTTGCTTTGAGG - Intronic
1120172328 14:81258423-81258445 TGCCAAATGCTGTTTTTTTGTGG - Intergenic
1120529741 14:85617753-85617775 TGCTACATGCTGTTATTTTGTGG + Intronic
1120666981 14:87317705-87317727 ATCCAGATGCTGTTGCTTGCTGG + Intergenic
1122408427 14:101513798-101513820 ATCCAAATACTGTTCCTTTGTGG + Intergenic
1123440378 15:20286698-20286720 AGCTAAATGCTGTTTCTCTGGGG + Intergenic
1127226029 15:56930226-56930248 AGGCATATGTTGTTGTTTTGAGG + Intronic
1127367008 15:58300501-58300523 TGCCACATACTGCTGCTGTGTGG - Intronic
1127687430 15:61362584-61362606 AGCCATATTTTGTTGATTTGGGG + Intergenic
1129601508 15:77001473-77001495 AGCAAACTGCTGTGGCTTTGAGG + Intronic
1129969307 15:79763421-79763443 AGCCACAGGCTCCTGCTTTAGGG + Intergenic
1130021117 15:80232698-80232720 AACTACCTGCTGGTGCTTTGGGG - Intergenic
1133182190 16:4065456-4065478 GGCAACATGGTGTTGCTGTGAGG - Intronic
1133658543 16:7891301-7891323 AGCACCATGCTTTTACTTTGGGG + Intergenic
1134312105 16:13084305-13084327 AGGGAGCTGCTGTTGCTTTGTGG + Intronic
1136726561 16:32362229-32362251 AGCTAAATGCTGTTTCTCTGGGG - Intergenic
1136844793 16:33567738-33567760 AGCTAAATGCTGTTTCTCTGGGG - Intergenic
1137612517 16:49828530-49828552 AGGCCCCTGCTGTTGCTTTTAGG - Intronic
1140899746 16:79356786-79356808 GGCCACATGCTGTTGCTCTTGGG + Intergenic
1141170487 16:81687578-81687600 AGCCACTTGCTGGTGACTTGTGG + Intronic
1141855620 16:86679491-86679513 AGTCACATTCTGCTGCTCTGGGG + Intergenic
1142232399 16:88905947-88905969 AGCCTCCTGCTGTGGCTGTGGGG - Intronic
1202999873 16_KI270728v1_random:155529-155551 AGCTAAATGCTGTTTCTCTGGGG + Intergenic
1203131471 16_KI270728v1_random:1691929-1691951 AGCTAAATGCTGTTTCTCTGGGG + Intergenic
1203154961 16_KI270728v1_random:1868036-1868058 AGCTAAATGCTGTTTCTCTGGGG - Intergenic
1144437874 17:15257598-15257620 AACCGGATGCTGTGGCTTTGGGG + Intronic
1144676021 17:17162212-17162234 GGACACATGCACTTGCTTTGGGG - Intronic
1150597547 17:66619649-66619671 TGCCAAAAGCTGTGGCTTTGTGG - Intronic
1151271355 17:72998707-72998729 TGACACATGCAGCTGCTTTGGGG + Intronic
1152382174 17:79947707-79947729 AGACACCTTCTGGTGCTTTGTGG - Exonic
1153094598 18:1385994-1386016 GGCTACATTCTGTTGTTTTGGGG - Intergenic
1156548703 18:37991703-37991725 AGGCAAATCCTGCTGCTTTGAGG - Intergenic
1159532048 18:69667039-69667061 AGCCCCATGCTGATGCTCTATGG - Intronic
1161971365 19:7582694-7582716 AGCCCCAGGGTGTGGCTTTGGGG - Intergenic
1167104195 19:47420657-47420679 AGCCCCCTGCTCTTGTTTTGGGG - Intergenic
925155999 2:1649315-1649337 ACCCACATGCTGATGCAGTGGGG - Exonic
925410292 2:3635821-3635843 AGCCACACTCTGCTGCTCTGAGG - Intronic
928203906 2:29270650-29270672 ACCCAGATGCTGATGATTTGAGG + Intronic
928501265 2:31898677-31898699 AGGCATATTCTGTTGATTTGGGG + Intronic
930090901 2:47530605-47530627 AGCCTCATGCAGTTGTTGTGAGG - Intronic
930664759 2:54090915-54090937 ATCTACATGTTGGTGCTTTGAGG + Intronic
930676430 2:54205555-54205577 AGTCACATCCTGTTGCTGTGAGG + Intronic
932399185 2:71467776-71467798 AGCCATACCCTGTAGCTTTGTGG + Intronic
933020693 2:77187181-77187203 AGCCCCATCCTTTTGCCTTGAGG + Intronic
933728869 2:85442237-85442259 AGGCAAATGCTGCGGCTTTGGGG - Intergenic
934319423 2:91958879-91958901 AGCTAAATGCTGTTTCTCTGGGG + Intergenic
934845808 2:97660747-97660769 AGCCACATCCTGGTGTTTGGAGG - Intronic
935418726 2:102844845-102844867 TGCCTCATGCTGTTGCTGTGAGG - Intergenic
936152243 2:110028140-110028162 GTGCACATGCTGTGGCTTTGTGG - Intergenic
936192434 2:110343272-110343294 GTGCACATGCTGTGGCTTTGTGG + Intergenic
937155259 2:119714540-119714562 AGCCAGATTCTGCTGCTTTGGGG - Intergenic
937299924 2:120832847-120832869 AGCCACCTGCTGCTGCCCTGTGG - Intronic
940620119 2:156101914-156101936 GGCCTCATGCTGTTTTTTTGGGG - Intergenic
941239054 2:163014556-163014578 ATGTACATGCTGTTGATTTGGGG + Intergenic
943555425 2:189397097-189397119 ATCCAAATACTGTTACTTTGGGG - Intergenic
945065736 2:205946402-205946424 AGCCACATCCTGTAACTTAGGGG - Intergenic
945444341 2:209918027-209918049 GGCCACATACTGTGACTTTGAGG - Intronic
947456475 2:230258973-230258995 AGTCACCTGCAATTGCTTTGAGG + Intronic
948061875 2:235048149-235048171 AGCCACAGGCTCTGGCTTTGGGG - Intronic
948646829 2:239410541-239410563 GGCCACCTGCCGTTTCTTTGTGG - Intergenic
1169350071 20:4861538-4861560 AGCCACGTGATTTTGCTCTGAGG + Intronic
1170055893 20:12202030-12202052 AGACACATGCTGGTGGTTGGGGG + Intergenic
1170119597 20:12897067-12897089 AGCCAAATGCCCTTGCTTTCTGG - Intergenic
1171074135 20:22104859-22104881 AGCCACATTGTGTTATTTTGTGG + Intergenic
1174131818 20:48350232-48350254 AGCCCCGTGATGTTGCTGTGTGG + Intergenic
1174304399 20:49604906-49604928 AGTCACATGCTTATGCTGTGTGG - Intergenic
1176066984 20:63203034-63203056 AGCCACCTGCTGGGGCTGTGGGG + Exonic
1176641946 21:9313400-9313422 AGGTACATTCTGTTGATTTGGGG - Intergenic
1178470728 21:32890395-32890417 AGCCACATGGTCTTCCATTGTGG - Intergenic
1178712830 21:34934610-34934632 ATTCACATGCTGGTGCTTTAGGG + Intronic
1180307611 22:11142525-11142547 AGCTAAATGCTGTTTCTCTGGGG + Intergenic
1180390881 22:12280738-12280760 AACCCCTTGCTGTTGCTTTAGGG - Intergenic
1180408861 22:12584019-12584041 AACCCCTTGCTGTTGCTTTAGGG + Intergenic
1180546131 22:16504748-16504770 AGCTAAATGCTGTTTCTCTGGGG + Intergenic
1181494737 22:23281538-23281560 AGCCATGTGCTGGTGCTGTGTGG + Intronic
1182150769 22:28025676-28025698 AGCAACAGGGTCTTGCTTTGTGG - Intronic
1182213049 22:28692641-28692663 AGCTAAATGCTGTTTCTCTGGGG - Intronic
1183227329 22:36559358-36559380 TGCCCCATGCTGCTACTTTGAGG + Intergenic
1185217025 22:49607242-49607264 CTCCCCACGCTGTTGCTTTGGGG - Intronic
949202664 3:1397860-1397882 AACCCCATGCTGTTACTTAGAGG + Intronic
949490709 3:4586296-4586318 AGCCTCATGGTGTTGCTGTATGG - Intronic
949624963 3:5855031-5855053 AGCCACATGCTGTTTATAAGAGG - Intergenic
951311165 3:21127555-21127577 ATCCATATTCTGTTGATTTGGGG - Intergenic
953194388 3:40718565-40718587 ACCCATATGCTAGTGCTTTGAGG + Intergenic
961789964 3:129368548-129368570 AGCCAATTTCTGTTTCTTTGAGG + Intergenic
964154526 3:153568728-153568750 AACAACATACTTTTGCTTTGGGG - Intergenic
965672112 3:171157817-171157839 ATCCTGATGCTGTTTCTTTGGGG - Intronic
966971217 3:185047169-185047191 GGCCACATGATGTTGCTTCTTGG + Intronic
967827232 3:193887021-193887043 TGTCACATGCTGTTGTTGTGAGG + Intergenic
1202744947 3_GL000221v1_random:91618-91640 AGGTACATTCTGTTGATTTGGGG + Intergenic
969179044 4:5423422-5423444 AGCCTCAGGAGGTTGCTTTGAGG + Intronic
970332389 4:15001043-15001065 ATCCACCTTCTATTGCTTTGGGG + Intergenic
970453453 4:16196361-16196383 AGCCAATTTCTGTGGCTTTGGGG + Intronic
971774757 4:30948334-30948356 ATCCACATGCTCTTAATTTGTGG - Intronic
973612293 4:52647643-52647665 AGACACATGCTGGTGGTGTGTGG - Intronic
984336664 4:178401185-178401207 AGCCACATTCTGATGCACTGGGG - Intergenic
986202732 5:5592657-5592679 AGTCACAGACTGTGGCTTTGTGG + Intergenic
986314111 5:6574704-6574726 AAGCACATGATGTTGCTATGTGG - Intergenic
986324494 5:6661957-6661979 ACCCTCAGGCTGTAGCTTTGTGG - Intronic
987093988 5:14532342-14532364 AGCCACATGCTTTTGCATGCAGG + Intergenic
989077586 5:37580549-37580571 AGCAACATGCTATTCCTTTGAGG - Intronic
991227520 5:64290482-64290504 AGTCACCTACTGTTACTTTGTGG + Intronic
992413030 5:76526037-76526059 ATCCACAAGCTCTTGTTTTGGGG - Intronic
997415983 5:133729066-133729088 AGCCACATGCTGAAGCTGAGAGG + Intergenic
1002069378 5:176670276-176670298 CGCCACCGGCTTTTGCTTTGGGG + Intergenic
1004251126 6:14023930-14023952 CGCCACATGCTCTTTTTTTGAGG + Intergenic
1005199832 6:23331724-23331746 AGCTACATTCAGTTGCTTTTAGG - Intergenic
1005800123 6:29412458-29412480 ATGCACATTCTGTTGTTTTGGGG - Intronic
1006373032 6:33657079-33657101 AGCCACATGCTGTTGCTTTGTGG + Intronic
1008409321 6:51154822-51154844 AGCAAGGTGCTATTGCTTTGTGG + Intergenic
1009525979 6:64746995-64747017 TTCCCCAAGCTGTTGCTTTGAGG - Intronic
1009677050 6:66839043-66839065 AACCACATTGTTTTGCTTTGGGG - Intergenic
1011182921 6:84641733-84641755 AGACAGATGGTTTTGCTTTGGGG + Intergenic
1013447066 6:110240667-110240689 AGCCAATTGCTGATACTTTGTGG - Intronic
1014631015 6:123789949-123789971 TGCCCCATGCTGGTGCTGTGGGG - Intergenic
1015879076 6:137852624-137852646 GGCCACATGCTTTTCCCTTGGGG + Intergenic
1017243797 6:152199934-152199956 AGCCAAATACTGTTGCCATGGGG - Intronic
1019309402 7:352949-352971 ACCCACAAGCTGGTGCCTTGGGG - Intergenic
1023037695 7:36147638-36147660 AGCCTCATGCTGGTTCTTTCTGG - Intergenic
1024339571 7:48243481-48243503 AGCCACATGCTTGGGCTTTCTGG - Intronic
1026594611 7:71723947-71723969 ATCCACAGGGTGTTGCTCTGGGG - Intergenic
1036932519 8:12969870-12969892 AGACACATGGTCTTGCTATGTGG + Intronic
1037203914 8:16291273-16291295 ACACACATGGTCTTGCTTTGGGG - Intronic
1037777445 8:21844976-21844998 TGACACATGCTGGGGCTTTGGGG - Intergenic
1042130118 8:65579714-65579736 AAACACAGGCTGTGGCTTTGGGG - Intergenic
1046896298 8:119477334-119477356 ATGCATATGCTGTTGATTTGGGG + Intergenic
1049352425 8:142171365-142171387 AGCCACATGCAGTCCCTTTCTGG + Intergenic
1052442562 9:28516447-28516469 AGCCACAGCCTGTTGGTTTTAGG + Intronic
1052553516 9:29984162-29984184 AGCTACTTCCTGTTGATTTGGGG + Intergenic
1052702422 9:31953270-31953292 TGCTATATGCTTTTGCTTTGTGG - Intergenic
1054783135 9:69184636-69184658 TGCCACCTGGGGTTGCTTTGAGG + Intronic
1055814751 9:80191639-80191661 AGCCACATTCTGATGTCTTGGGG - Intergenic
1057291112 9:93808045-93808067 AGCCACCTTCTGTGGCTGTGGGG - Intergenic
1058751879 9:108047371-108047393 AGCCACATGTTGCTGCAGTGCGG - Intergenic
1060037875 9:120273530-120273552 ATCCACATTCTGTTGATTTGGGG + Intergenic
1061120584 9:128639962-128639984 AGCCTCATACAGTTGTTTTGAGG + Intronic
1203688433 Un_GL000214v1:18656-18678 AGGTACATTCTGTTGATTTGGGG - Intergenic
1203647842 Un_KI270751v1:85397-85419 AGGTACATTCTGTTGATTTGGGG + Intergenic
1190935557 X:54996284-54996306 AGGAATATGTTGTTGCTTTGTGG - Intronic
1191823877 X:65342332-65342354 ATCTACATTCTGTTGTTTTGGGG - Intergenic
1194542741 X:95194568-95194590 ATGCACATTCTGTTGTTTTGGGG + Intergenic
1199468592 X:148168341-148168363 ATCCAAATTCTGTTGATTTGGGG - Intergenic
1200097105 X:153669549-153669571 TGCCACTTGTTGGTGCTTTGGGG + Intergenic
1201186951 Y:11413992-11414014 AGCTAAATGCTGTTTCTCTGGGG + Intergenic