ID: 1006374579

View in Genome Browser
Species Human (GRCh38)
Location 6:33664890-33664912
Sequence GGCACCTCTGCACCAACACG TGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 163
Summary {0: 1, 1: 0, 2: 0, 3: 12, 4: 150}

Found 11 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1006374565_1006374579 28 Left 1006374565 6:33664839-33664861 CCCGAGTCCTTTCCCTCCCACCC 0: 1
1: 1
2: 6
3: 60
4: 625
Right 1006374579 6:33664890-33664912 GGCACCTCTGCACCAACACGTGG 0: 1
1: 0
2: 0
3: 12
4: 150
1006374564_1006374579 29 Left 1006374564 6:33664838-33664860 CCCCGAGTCCTTTCCCTCCCACC 0: 1
1: 0
2: 3
3: 28
4: 481
Right 1006374579 6:33664890-33664912 GGCACCTCTGCACCAACACGTGG 0: 1
1: 0
2: 0
3: 12
4: 150
1006374571_1006374579 12 Left 1006374571 6:33664855-33664877 CCCACCCACCTGCAGGAACTCGT 0: 1
1: 0
2: 1
3: 7
4: 112
Right 1006374579 6:33664890-33664912 GGCACCTCTGCACCAACACGTGG 0: 1
1: 0
2: 0
3: 12
4: 150
1006374566_1006374579 27 Left 1006374566 6:33664840-33664862 CCGAGTCCTTTCCCTCCCACCCA 0: 1
1: 0
2: 3
3: 67
4: 724
Right 1006374579 6:33664890-33664912 GGCACCTCTGCACCAACACGTGG 0: 1
1: 0
2: 0
3: 12
4: 150
1006374574_1006374579 7 Left 1006374574 6:33664860-33664882 CCACCTGCAGGAACTCGTACGTC 0: 1
1: 0
2: 0
3: 3
4: 37
Right 1006374579 6:33664890-33664912 GGCACCTCTGCACCAACACGTGG 0: 1
1: 0
2: 0
3: 12
4: 150
1006374572_1006374579 11 Left 1006374572 6:33664856-33664878 CCACCCACCTGCAGGAACTCGTA 0: 1
1: 0
2: 1
3: 9
4: 102
Right 1006374579 6:33664890-33664912 GGCACCTCTGCACCAACACGTGG 0: 1
1: 0
2: 0
3: 12
4: 150
1006374575_1006374579 4 Left 1006374575 6:33664863-33664885 CCTGCAGGAACTCGTACGTCCGG 0: 1
1: 0
2: 0
3: 0
4: 12
Right 1006374579 6:33664890-33664912 GGCACCTCTGCACCAACACGTGG 0: 1
1: 0
2: 0
3: 12
4: 150
1006374570_1006374579 15 Left 1006374570 6:33664852-33664874 CCTCCCACCCACCTGCAGGAACT 0: 1
1: 0
2: 3
3: 50
4: 574
Right 1006374579 6:33664890-33664912 GGCACCTCTGCACCAACACGTGG 0: 1
1: 0
2: 0
3: 12
4: 150
1006374573_1006374579 8 Left 1006374573 6:33664859-33664881 CCCACCTGCAGGAACTCGTACGT 0: 1
1: 0
2: 0
3: 3
4: 38
Right 1006374579 6:33664890-33664912 GGCACCTCTGCACCAACACGTGG 0: 1
1: 0
2: 0
3: 12
4: 150
1006374567_1006374579 21 Left 1006374567 6:33664846-33664868 CCTTTCCCTCCCACCCACCTGCA 0: 1
1: 0
2: 15
3: 146
4: 1284
Right 1006374579 6:33664890-33664912 GGCACCTCTGCACCAACACGTGG 0: 1
1: 0
2: 0
3: 12
4: 150
1006374569_1006374579 16 Left 1006374569 6:33664851-33664873 CCCTCCCACCCACCTGCAGGAAC 0: 1
1: 0
2: 5
3: 56
4: 473
Right 1006374579 6:33664890-33664912 GGCACCTCTGCACCAACACGTGG 0: 1
1: 0
2: 0
3: 12
4: 150

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1006374579 Original CRISPR GGCACCTCTGCACCAACACG TGG Exonic
900649278 1:3723086-3723108 GGCACCTCTGCACCTAACAGGGG + Intronic
902361509 1:15944777-15944799 GGCACATCCGCATCCACACGGGG - Exonic
902666482 1:17942782-17942804 GAGACCTCTGGACCAACATGGGG + Intergenic
910379205 1:86608396-86608418 GGCACCTCTGGACCCACCCAGGG - Intergenic
912412921 1:109490368-109490390 GGCACCTCAGCACACACATGTGG + Exonic
912601198 1:110934734-110934756 GGCACCTCTGGACCTACGCAGGG + Intergenic
917003292 1:170385046-170385068 GGCACCTCTGGACCCACCTGAGG - Intergenic
917226344 1:172788082-172788104 GGCACCTCTGGACCTACCTGGGG - Intergenic
918195307 1:182215637-182215659 GGCACCTCTCCAGAAACACTTGG - Intergenic
920531729 1:206707127-206707149 GGCACATCTGGACCTAGACGGGG + Intronic
921634675 1:217477794-217477816 GGCACCTCTGGACCTACCTGGGG + Intronic
923207587 1:231773875-231773897 GTCACCTCAGCACAAAAACGTGG - Intronic
923289197 1:232527773-232527795 TGCACCTCTGCACCCCCACCTGG - Intronic
924490745 1:244535362-244535384 GGTACCTCTGGACCCACATGGGG - Intronic
1063123880 10:3123708-3123730 GGCCCCTCAGCACCGCCACGTGG - Intronic
1064306738 10:14174166-14174188 GGCGCCTCTGCACCGCCACCCGG + Intronic
1065183134 10:23146467-23146489 CTCACCTCTGCACCAGCACTGGG + Intergenic
1066420725 10:35262216-35262238 GGCACCTCTGCACTCCCACCTGG + Intronic
1071018132 10:81021766-81021788 GGCACCTCTGGACCCACCTGGGG + Intergenic
1071896660 10:90075605-90075627 GGCATCTCTGGACCAACCTGTGG - Intergenic
1072453997 10:95560838-95560860 GGCACCTCTGCAGCAGCCAGAGG - Intronic
1072894689 10:99356796-99356818 GGCACCTAAGCACCTACATGTGG + Intronic
1073146174 10:101283341-101283363 GGCACATATGCATCCACACGTGG + Intergenic
1076552869 10:131295431-131295453 GCCACATCTTCACCACCACGTGG + Intronic
1082122680 11:48396303-48396325 GGCACCTCTGGACCCACCCAGGG - Intergenic
1083255199 11:61491251-61491273 GCCACCTGGACACCAACACGGGG + Intergenic
1083416390 11:62528535-62528557 GGCACCTCCACACCCACACTGGG + Exonic
1083416425 11:62528736-62528758 GGCACCTCCACACCCACACTGGG + Exonic
1084475774 11:69387968-69387990 GACACCTCTGCCACAACATGTGG - Intergenic
1084784408 11:71433891-71433913 GGCACCAGTGCACGAACACTAGG + Intronic
1089564040 11:119361460-119361482 GGCAACTCTGGAGCAACACTGGG + Intronic
1089773595 11:120820577-120820599 GGCAGCTGTGCACCCACATGTGG + Intronic
1090417194 11:126548623-126548645 GGCACCTCTGCACCTTCATGAGG + Intronic
1094093955 12:26682631-26682653 GGCATTTATGCACCAACACATGG - Exonic
1094728835 12:33151556-33151578 GGGGCCTCTTCACCAACAGGTGG + Intergenic
1098705662 12:73685533-73685555 GGCACCTCTGTACCCACCCAGGG + Intergenic
1100875784 12:98960022-98960044 GGCACCTCTGGACCCACCCAGGG + Intronic
1102192253 12:110997482-110997504 TGTACCTCAGCATCAACACGAGG - Intergenic
1102302851 12:111783454-111783476 GGCACCTCTGTACTAACCAGAGG + Intronic
1109522675 13:63533684-63533706 GGCACTTCTGGACCAACTCAGGG - Intergenic
1116351654 14:43871234-43871256 GGCACCTCTGAACCTACGCGGGG - Intergenic
1117606278 14:57431778-57431800 GGCACCTCTGGACCTACCTGGGG + Intergenic
1119117089 14:72033882-72033904 TTCACCTCTTCACCAACACTTGG + Intronic
1120747302 14:88164034-88164056 GTGACCTCTGCCCCAACACTTGG + Intergenic
1122789378 14:104177893-104177915 TGCACCTCTGCACCCACCTGTGG - Exonic
1125567088 15:40685056-40685078 GGCATCTCTGGACCCACCCGAGG - Intergenic
1126503824 15:49379994-49380016 GGCACCTCTGGACCCACCCAGGG - Intronic
1129117157 15:73370778-73370800 GGGACCTCTCCACCAACACAAGG + Intergenic
1133706927 16:8363667-8363689 GGTACCTGAGCACCAACACGAGG - Intergenic
1134207893 16:12252691-12252713 GGCACCTCGGCACCGCAACGGGG - Intronic
1140406511 16:74714650-74714672 GGCACCTCTGCAATGACACCTGG + Intronic
1143329108 17:6120915-6120937 GGCTTCTCTGCATCAAGACGGGG - Exonic
1146666986 17:34711823-34711845 GGTACCTCTCCCCCAACACCGGG + Intergenic
1147378226 17:40035658-40035680 TGCACCTCTGCACAAAGACAAGG + Intronic
1147746459 17:42697745-42697767 GGCACCTCTGAAACAAGACGTGG - Exonic
1148105519 17:45116692-45116714 GCCACCTCTGCACCATCCTGGGG - Exonic
1151669880 17:75566184-75566206 GCCACATCTGGACCAGCACGGGG - Intronic
1151849813 17:76683645-76683667 GGAACCTCTGCCCCCAGACGGGG + Intronic
1157144784 18:45150807-45150829 GGTACCTCTGCAACAGCACTTGG - Intergenic
1157744048 18:50119202-50119224 GGCCCCTCTGCAGCATCACCCGG - Intronic
1160343014 18:78105823-78105845 GGCACCTGTGCCCCAAGCCGTGG + Intergenic
1161453764 19:4360339-4360361 CCCACCCCTGCACCAAGACGAGG + Intergenic
1165964327 19:39562839-39562861 GGCACCTCTGGACCCACCCAAGG - Intergenic
1168094891 19:54108868-54108890 GCCTCCTCTGCACCAGCACCTGG + Intronic
1168175604 19:54625449-54625471 GGCGCCTCTGCACCATCTCTGGG + Intronic
924976189 2:177884-177906 AGCACCTGTGCACCCACAGGTGG - Intergenic
925062719 2:905420-905442 GGCACCTCTGCACCTGCTGGTGG + Intergenic
925359723 2:3268817-3268839 GGGGCATCTTCACCAACACGAGG + Intronic
926425060 2:12732573-12732595 GCCACCTCTGCACCAAGTCTTGG - Intronic
929509052 2:42552578-42552600 GGCACCACTGCACTACCACCTGG + Intronic
931471727 2:62545142-62545164 CCCACCTCTTCACCACCACGAGG + Intergenic
933339399 2:81003676-81003698 GGCACCTCTGGACCCACCCATGG - Intergenic
933476421 2:82797665-82797687 GGCACCTTGGCACCAACAATAGG + Intergenic
936486251 2:112928361-112928383 GGCACCTCAGCACACTCACGAGG + Intergenic
937657775 2:124396365-124396387 AGCTCCTCTGCACCAATACCAGG - Intronic
937900506 2:127015988-127016010 GGCTCCTCTGCGCCAACAAAGGG + Intergenic
939443129 2:142275532-142275554 GGCACTTCTGGACCCACCCGGGG - Intergenic
940238355 2:151535436-151535458 AGCACCTCTGCACAAACACAGGG - Intronic
941678681 2:168371636-168371658 GGCACCTCTGGACCTACCTGGGG + Intergenic
943923364 2:193738881-193738903 GGCACCTCTGCACCCAAATGAGG + Intergenic
946192406 2:218014410-218014432 GGCCCCTCAGCACCCACACCAGG + Intergenic
948177472 2:235955289-235955311 GGGACCTCTCCATCAGCACGTGG + Intronic
1174062020 20:47839565-47839587 AGCATCTCTGCACCAACCAGTGG + Intergenic
1174069488 20:47889666-47889688 AGCATCTCTGCACCAACCAGTGG - Intergenic
1175871581 20:62211817-62211839 GGCACCCCAGAACCAGCACGAGG + Intergenic
1176220563 20:63967600-63967622 AGCACCGCTGTCCCAACACGAGG + Intronic
1180611749 22:17102760-17102782 GGCACCACTGCACCCACTCTGGG + Intronic
1180701784 22:17785185-17785207 GGCATCTGTGCATCTACACGGGG + Intergenic
1183199456 22:36375734-36375756 GCCACCACTGCACCTACACCTGG - Intronic
1183509821 22:38228142-38228164 TGCACGTCTGCCCCATCACGCGG - Intronic
950906035 3:16539063-16539085 GGCATCTGTTCACCAACATGGGG + Intergenic
951162438 3:19441095-19441117 GGCACCTCAGCAGCAGCAGGTGG + Intronic
951423191 3:22511299-22511321 GGCACCTCTGGACCTACCTGGGG + Intergenic
951435387 3:22656991-22657013 GGCACCTCTGGACCTGCACAGGG - Intergenic
951940533 3:28073431-28073453 GGCATCGCTGCACCCACACTTGG + Intergenic
952912636 3:38203939-38203961 GGCATCTCTGCACCCACCCAGGG - Intronic
953538367 3:43793159-43793181 GGCAGCTCTCCACCACCAAGGGG + Intergenic
954212158 3:49104000-49104022 GGCATCTCTGCTCCAAGAAGTGG + Intronic
954291934 3:49654411-49654433 GGCCCATCTGCACCAGCACTGGG - Exonic
958976911 3:100679062-100679084 GGCACCTCTGGACCGACCTGGGG - Intronic
962193660 3:133337094-133337116 GGCACCTCTGGACCCACCTGGGG + Intronic
964239564 3:154575167-154575189 GGCACCTCTGGACCAACCTGGGG + Intergenic
964758924 3:160115138-160115160 GGCATCTCTGCACCTACCCTGGG + Intergenic
966348635 3:179005390-179005412 GGCACCTCTGGACCCACCTGGGG + Intergenic
969859906 4:10027579-10027601 GGCACCACCGCACCACCAAGAGG - Intronic
970413345 4:15832831-15832853 GGCACCTCTGGACCAACCCAGGG - Intronic
980556517 4:134413101-134413123 GGCACTTCTGGATCGACACGTGG + Intergenic
986287333 5:6369675-6369697 GACACCGCTGAACCACCACGAGG - Intergenic
991139153 5:63218808-63218830 GTCACCTCTGCCCCAAAAAGTGG - Intergenic
991399377 5:66237230-66237252 GGCGCCCCTACACCAACACAAGG - Intergenic
994192909 5:96888262-96888284 GGCACCTCTGCACTTAGACATGG + Intronic
995777909 5:115745523-115745545 GGCACCTCTGGACCCACCTGGGG - Intergenic
998596947 5:143541267-143541289 GGAACATCTCCACCAACACTTGG - Intergenic
1002106205 5:176880532-176880554 GGCAAATGTGCACCAACACTGGG - Exonic
1006374579 6:33664890-33664912 GGCACCTCTGCACCAACACGTGG + Exonic
1006447410 6:34087562-34087584 GGCTCCTCTGCAGCATCACCAGG - Intronic
1006462866 6:34173635-34173657 GGCACCTCTGGACCCACTTGGGG - Intergenic
1011187099 6:84689446-84689468 GGCACCCCTACACCCACACTAGG - Intronic
1015678874 6:135781582-135781604 CCCACCCCTGCACCAACACTGGG + Intergenic
1018711044 6:166498426-166498448 GGGACCTCTGAACCAACCTGGGG + Intronic
1019364100 7:622668-622690 GGCACATATGCACCAACAGTAGG + Intronic
1021203438 7:17752509-17752531 GGCACCTCTGGACCCACATAGGG - Intergenic
1023213383 7:37832534-37832556 TGCACCTCTGCCCCAAGACAAGG + Intronic
1023931872 7:44711174-44711196 GACACCTTTGCACAAACATGCGG - Intergenic
1029283918 7:99453371-99453393 GGCACGGCTGCACCTACACCTGG - Intronic
1029418016 7:100455865-100455887 GCCACCTCTGCACCTTCATGTGG + Intergenic
1033145253 7:138865657-138865679 GGCTGCTCTGCACCCACAGGAGG + Intronic
1033358979 7:140624421-140624443 GGCCCCTCAACACCAACACAGGG + Intronic
1040095771 8:43440853-43440875 GGCAACTCTGGACCCACATGGGG + Intergenic
1042485047 8:69338965-69338987 GACACCTCTGCACCAGCAGCTGG + Intergenic
1042854948 8:73256982-73257004 GACACCTCGGCATCAGCACGTGG + Exonic
1045387499 8:101685962-101685984 GGCAACTCTGCCCCCACACATGG + Intergenic
1045590022 8:103582828-103582850 GGCACCTCTGGACCCACCTGGGG + Intronic
1049649836 8:143760801-143760823 TGCTCCTCTGCTCCAACCCGGGG - Intergenic
1051704391 9:19860975-19860997 GGCACCTCTGGACCCACCCAGGG + Intergenic
1052476902 9:28971686-28971708 GGCACCTCTGGACTAACCAGGGG + Intergenic
1054870636 9:70044522-70044544 GGAGCCTTTGCACCAACTCGGGG - Intronic
1060856407 9:126917118-126917140 GTCACCACTGCACCAACTAGTGG - Intronic
1061536998 9:131256564-131256586 GGCTTCTCTGCACCCCCACGGGG - Intergenic
1061865527 9:133490176-133490198 GTGGCCTCTGCACCGACACGTGG - Intergenic
1061915515 9:133751124-133751146 GGCACCTCTGGACCCACCTGAGG - Intergenic
1062127235 9:134870310-134870332 CGGACCTCTGCACCCACACTAGG - Intergenic
1203778946 EBV:89993-90015 GGCACATCTGCTTCAACAGGAGG + Intergenic
1188379057 X:29468965-29468987 GGCACCTCTTCACAAAAACTTGG + Intronic
1188815250 X:34705239-34705261 GGCACTTCTGGACCCACCCGAGG - Intergenic
1189254443 X:39627042-39627064 GGCATTTCTTCACCAACCCGTGG - Intergenic
1191650329 X:63529945-63529967 GGCACCTCTGGACCTACCCAAGG + Intergenic
1192812630 X:74560497-74560519 GGCACTTCTGGACCCACCCGGGG + Intergenic
1193088466 X:77468591-77468613 AGCACCTCTGGACCAACCCAGGG + Intergenic
1193289261 X:79752835-79752857 GGCACCTCTGAACCTGCATGAGG - Intergenic
1193670356 X:84376789-84376811 GGCACCTCTGGACCCACCTGGGG + Intronic
1194112708 X:89854600-89854622 GGCACCTCTGGACCCACTCCAGG + Intergenic
1194438035 X:93893892-93893914 AGCACCTCTGGACCAACGTGTGG - Intergenic
1194787558 X:98105913-98105935 GGCACCTCTGGACCCACCTGGGG - Intergenic
1194791865 X:98160349-98160371 GGCACCTCTGGACCCACCTGGGG + Intergenic
1195132179 X:101863996-101864018 GGCACCTCTGGACCCACCCAAGG + Intergenic
1196538894 X:116882275-116882297 GGCACTTCTACACCAACCCAGGG - Intergenic
1196600858 X:117600419-117600441 GGCAACTCTGGACCAACCTGGGG - Intergenic
1197470064 X:126856157-126856179 AGCACCTCTGCACCCACACAGGG + Intergenic
1198312685 X:135436898-135436920 CGCACCGCTGCACCTCCACGCGG - Intergenic
1200465362 Y:3509411-3509433 GGCACCTCTGGACCCACTCGAGG + Intergenic
1200794239 Y:7325995-7326017 GGCACTTCTCCAGCACCACGGGG + Intergenic
1200835183 Y:7725685-7725707 GGCACCTCTGGGCCAGCACGAGG + Intergenic