ID: 1006375040

View in Genome Browser
Species Human (GRCh38)
Location 6:33667367-33667389
Sequence CTGTGCCAGGCACTGTTTTG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1115
Summary {0: 1, 1: 0, 2: 32, 3: 207, 4: 875}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1006375036_1006375040 -8 Left 1006375036 6:33667352-33667374 CCTCAGGCACATGTGCTGTGCCA 0: 1
1: 0
2: 0
3: 22
4: 229
Right 1006375040 6:33667367-33667389 CTGTGCCAGGCACTGTTTTGGGG 0: 1
1: 0
2: 32
3: 207
4: 875
1006375033_1006375040 12 Left 1006375033 6:33667332-33667354 CCTTCCTCAGCAAGCGATTTCCT 0: 1
1: 0
2: 0
3: 21
4: 139
Right 1006375040 6:33667367-33667389 CTGTGCCAGGCACTGTTTTGGGG 0: 1
1: 0
2: 32
3: 207
4: 875
1006375034_1006375040 8 Left 1006375034 6:33667336-33667358 CCTCAGCAAGCGATTTCCTCAGG 0: 1
1: 0
2: 0
3: 5
4: 99
Right 1006375040 6:33667367-33667389 CTGTGCCAGGCACTGTTTTGGGG 0: 1
1: 0
2: 32
3: 207
4: 875

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1006375040 Original CRISPR CTGTGCCAGGCACTGTTTTG GGG Intronic
900351676 1:2238024-2238046 CTGTGCCAGGCGCTGGGCTGTGG + Intronic
900608123 1:3532836-3532858 CTGTGCCAGGCCCTGGGTTCTGG + Intronic
901177821 1:7317472-7317494 CTGTGGCAAGCACTGTTCTATGG - Intronic
901233402 1:7653788-7653810 ATGTGCCAGGCATTGTTCTGAGG + Intronic
901331122 1:8409430-8409452 CTGTGAGCAGCACTGTTTTGGGG + Intronic
901357676 1:8665378-8665400 CTGTGCCAGGCAGTGAGTTAAGG - Intronic
901438040 1:9261523-9261545 CTGTGCCAGGCAATGTGCAGGGG - Intronic
901739220 1:11331188-11331210 CTGTGCCAGGCTCTGTGTCGAGG + Intergenic
901909061 1:12439688-12439710 ATTTGCCAGGCACTGTTCTAAGG - Intronic
901909825 1:12447432-12447454 ATGTGCCAGCCACTGTCTTTGGG - Intronic
902115774 1:14119885-14119907 ATGTGCCAGGCACTGTTCTAAGG + Intergenic
902541433 1:17158355-17158377 ATGTGCCAGGCTCTGTGCTGGGG + Intergenic
902599045 1:17528674-17528696 CTGTGCCAGACACTGCATTCTGG + Intergenic
902634491 1:17726201-17726223 CTGTAACAAGCACTGTCTTGGGG - Intergenic
902733698 1:18386197-18386219 ATGTGCCAGGCACTGTTCTAAGG - Intergenic
902800973 1:18829927-18829949 TTGGGCCAGGCACAGTATTGAGG + Intergenic
902837962 1:19058809-19058831 CTGTGCCAGGCACGGGGATGTGG - Intergenic
903061407 1:20671274-20671296 ATGTGCCAGGCACTGCTGTAAGG + Intronic
903188396 1:21642344-21642366 CTGTGCCAGGCCCTGGTTTCAGG + Intronic
903315741 1:22504381-22504403 GTGTGCCAGGCAGTGTGCTGAGG + Intronic
903492788 1:23742676-23742698 ATGTGCCAGACACTGTTTGTGGG + Intergenic
903547579 1:24136269-24136291 ATGTGCCAGGCACTATGCTGAGG + Intronic
903582912 1:24385551-24385573 TTGTGCCATGCACTGTTCTGAGG + Intronic
903640761 1:24858446-24858468 ATGTGCCAAGCACTGTTCTAAGG - Intergenic
903770323 1:25759642-25759664 CTGTGCCAGGTAATGCTTTGAGG - Intronic
903804944 1:25998593-25998615 CTCTGCCAGGGAGTCTTTTGAGG - Intergenic
903834406 1:26193602-26193624 GCGTGCCAGGCACTGTGCTGGGG - Intronic
903989548 1:27256812-27256834 ATGTGCCAGGCATTGTGCTGAGG - Intronic
904330467 1:29755077-29755099 GTGTACCAGGCACTGTGCTGTGG - Intergenic
904416209 1:30362518-30362540 GTGTGCCAGGCACTGTGCTAAGG + Intergenic
904461762 1:30684934-30684956 CTCTGCCAGGGGCTGTTGTGGGG + Intergenic
904796928 1:33063193-33063215 GTGTGCCAAGCACTGCTTTAAGG + Intronic
904822455 1:33255101-33255123 CTGTGCCAGGCACTGTGCTTGGG + Intergenic
904947656 1:34211332-34211354 GTGTCCCAGGCACTGTCTTAGGG + Intronic
905118036 1:35659544-35659566 CTCTGCCTGGCAATGGTTTGGGG + Intergenic
905286078 1:36881222-36881244 CTGTGCCAGGTTCTGTTCTTGGG + Intronic
905318944 1:37101967-37101989 CTATGCCAGGCACTGAGTTAGGG - Intergenic
905373306 1:37499241-37499263 GTGTGCCAGACACTGTTTAGTGG - Intronic
905380515 1:37558435-37558457 CTCTGCCAGAAACTCTTTTGTGG + Intronic
905489604 1:38333320-38333342 CTCTGCCAGGCACTATTCTAGGG - Intergenic
905535286 1:38716436-38716458 ATGTGCCAGACATTGTTTTAAGG + Intergenic
905549161 1:38822414-38822436 CTGTGACATGCACTGATTTCAGG + Intergenic
905805847 1:40877069-40877091 CTATCCCAGGCACTGTTTTAAGG + Intergenic
906660634 1:47578940-47578962 CTCTGCCTGGCTCTGGTTTGGGG - Intergenic
906699250 1:47845877-47845899 ATGTGCCAGGCATTGTTCTAGGG - Intronic
906719444 1:47994910-47994932 CTGTACCTGGCACTGCTCTGAGG - Intronic
906881255 1:49593778-49593800 ATGTGCCAGGCACTCTTTGAAGG - Intronic
907083880 1:51650961-51650983 GTGTACCAGACACTGTTCTGAGG + Intronic
907354398 1:53860610-53860632 CTGTGCCAGGCCCTGTGCAGGGG - Intronic
907380380 1:54082465-54082487 CTGTGCTAGGCACTATGCTGGGG + Intronic
907395211 1:54184987-54185009 CTGTGCCAGGCACCATGTTGAGG + Intronic
907423336 1:54362394-54362416 CTTTGCCAGGCCCTTTCTTGGGG - Intronic
907576106 1:55527226-55527248 CTGTGCTAGGCACTGTGCAGAGG - Intergenic
907707317 1:56844081-56844103 CTGTGCCAGGCAGTGTGCTGGGG + Intergenic
907823286 1:57991387-57991409 CTTAGCCAGGCATTGTTCTGGGG + Intronic
907944940 1:59127320-59127342 CAGTGCCAGGCACTGTGCTATGG + Intergenic
908034415 1:60036510-60036532 ATGTACCAGGCACTGATTTTTGG + Intronic
908494167 1:64678150-64678172 TTCTGGCAGGGACTGTTTTGGGG + Exonic
908776811 1:67648645-67648667 CTGTGCCACGCCCTGTGCTGGGG + Intergenic
908784375 1:67720596-67720618 CTGTGCCAGGCACTGTGTTAAGG + Intronic
908857002 1:68441916-68441938 ATGTGCCAGGCACTGTATCAGGG + Intronic
909045811 1:70707960-70707982 GTGTTCCAGGTACTGTTTTAAGG + Intergenic
910364666 1:86451858-86451880 ATGTGCCAGGCACTTTTCTAAGG - Intronic
910433374 1:87180359-87180381 TTGTGAAAGTCACTGTTTTGGGG + Intergenic
910486138 1:87716504-87716526 GTGTGCCAGGCATTGTTCTACGG + Intergenic
910511100 1:88005824-88005846 CTGTGTCAGGCACCCTTCTGAGG - Intergenic
910587671 1:88897151-88897173 ATGTGCCAGGTACTATTTTAAGG + Intergenic
910601351 1:89035746-89035768 ATGTGTCAGGCACTGATTTGAGG - Intergenic
910648243 1:89536520-89536542 ATGTGTCAGGCACTGTTTACAGG + Intronic
910765865 1:90781681-90781703 CTTTGCCAGGCCCTGTTTCTTGG - Intergenic
910903858 1:92152322-92152344 ATGTGCTAGGCACTGTTCTAAGG - Intergenic
911056672 1:93714405-93714427 ATGTGCCAGGCAGTGTTCTAGGG - Intronic
911226688 1:95314904-95314926 ATGTGCCAGGCACACTTTTGGGG + Intergenic
911881497 1:103244746-103244768 CTGTACCAGGCACTGCATTAGGG + Intergenic
912017385 1:105059099-105059121 CTGTGGCATACACTGTTTAGGGG + Intergenic
912080113 1:105925850-105925872 ATGTGCCAGGCACTATATAGGGG - Intergenic
912323527 1:108736889-108736911 ATGTGCCAGGCACTGTTCTAAGG + Intronic
912953301 1:114135443-114135465 CTGTGCCAGGCATGGGGTTGAGG - Intronic
913207649 1:116555930-116555952 CTGTGCCAGGCACTGTTGCAAGG + Intronic
913375726 1:118149803-118149825 ATTTGTCAGGCACTGTTTTATGG - Intronic
914332712 1:146687177-146687199 ATGTGCTAGGCACAGTGTTGGGG + Intergenic
914452033 1:147800944-147800966 ATGTGCCAGGCACTGTTCTTAGG - Intergenic
914913063 1:151802110-151802132 CTAGGCCAGGCACTGTGCTGAGG + Exonic
915928541 1:160042678-160042700 ATGTGCCAGGCACTGTGCAGGGG + Intronic
916002862 1:160633433-160633455 CTGTGACAGGCAGTGCTATGTGG + Intronic
916194965 1:162213989-162214011 CTGTGCCAGGCACTATAATGGGG + Intronic
916317261 1:163463446-163463468 ATGTGCCAGGCACTGTTTGCAGG - Intergenic
916582329 1:166120148-166120170 CTGTGCCAGGTGCTGTGCTGGGG + Intronic
916722283 1:167493476-167493498 CTGTGCCAGGCCCTGTGCTGAGG + Intronic
916743202 1:167663862-167663884 ATGTGCCAGGCACTGTGCTGGGG + Intronic
916768274 1:167882951-167882973 ATGTGCCAGGCACTGTTCTCAGG - Intronic
917297641 1:173538456-173538478 CTGTTCCAAGCCCTGTTTTAGGG + Intronic
917343066 1:174000402-174000424 CTGAGCCAGGCACTCCTCTGAGG + Intronic
917625016 1:176836894-176836916 ATGTGCCAGGCATTGTTATGGGG - Intronic
917737574 1:177934523-177934545 TTGTGCCGGGCACTGTTTTAAGG + Intronic
918319234 1:183349102-183349124 CTGTCCTAGGCACTGGTTTCTGG + Intronic
918323614 1:183388810-183388832 GTGTGCCAGGCATTGTTCTAGGG - Intronic
918378324 1:183931183-183931205 CTGGGCCAGGCACTGAATGGAGG + Intronic
918438948 1:184546469-184546491 CTGTGCCAGACCCTGTGTTAGGG + Intronic
918547053 1:185696865-185696887 TTGAGCCAGGCACTCTTGTGAGG - Intergenic
918594664 1:186279173-186279195 CTGGTCCAGGGACTATTTTGGGG - Intergenic
919078446 1:192840319-192840341 CTGTGTCAGGCACTGGGTTAAGG - Intergenic
919530706 1:198715770-198715792 ATGTGCCAAGCACTGTTTCAAGG - Intronic
919592476 1:199521745-199521767 AAATGCTAGGCACTGTTTTGGGG - Intergenic
919810038 1:201403232-201403254 CTCTGCCAGGCATAGTATTGAGG - Intergenic
919817397 1:201450112-201450134 CTGTGCCAGGGCCAGTTTTCAGG + Intergenic
919982238 1:202649424-202649446 ATGTGCCAGGTACTATTTTAAGG + Intronic
920723600 1:208413020-208413042 ATGTGCCAGCCACTGTGTTTGGG - Intergenic
920756029 1:208733869-208733891 CTGTTCCAGACACTTTTTAGGGG + Intergenic
920849564 1:209619378-209619400 AAGTGCCAGGCACTGTGCTGGGG - Intronic
920975317 1:210780458-210780480 TTTTGCCAGGCACTGTTCTAGGG + Intronic
921204038 1:212832918-212832940 TTGTGCCAGACACTGTTCTAGGG + Intronic
921324125 1:213973703-213973725 TTGTGCTAGGCACAGTGTTGAGG + Intergenic
921345887 1:214184874-214184896 CTGCGTCAGGCACTGTTCTGGGG - Intergenic
921722634 1:218490596-218490618 CTGGGACAGGCACTTTTTTCAGG - Intergenic
921917967 1:220633974-220633996 GTGTGCCAGGAACTGTTCTAAGG + Intronic
922033938 1:221830264-221830286 CTGTGCCAGGCACTGGATCTAGG + Intergenic
922068696 1:222169804-222169826 CTGTCACAGGGACTGTTTTCTGG - Intergenic
922498161 1:226076898-226076920 ATGTACCAGACACTGTTGTGGGG + Intergenic
922657264 1:227396599-227396621 CTGTGCCCGGCCCAGTTCTGTGG + Intergenic
923081566 1:230661608-230661630 ATGTGCCAGGGACTGTCTTAGGG - Intronic
923085821 1:230703108-230703130 CCTTGCCAGGCACTGTGTTCTGG + Exonic
923122985 1:231010855-231010877 TTGTGCCAGGCACCATTTTAAGG + Intergenic
923497879 1:234540743-234540765 GAGTGCCAGGCACTGTGCTGGGG - Intergenic
923512173 1:234662046-234662068 CTGTGCCAGGGATTGTGTTAGGG + Intergenic
923695683 1:236248134-236248156 ATGTGCCAAGCACTGTTCTAGGG - Intronic
924185191 1:241481318-241481340 CTGTGGCAGGCACTGTGCTAGGG - Intergenic
924195796 1:241605547-241605569 ATGTGCCAGGCACTGTGCAGTGG + Intronic
924300612 1:242633833-242633855 CTCTGTCAGGCACTGTGCTGAGG + Intergenic
924588878 1:245384331-245384353 ATATGCCAGGCACTGTGCTGAGG + Intronic
1063345564 10:5309190-5309212 CTATGCCAACCATTGTTTTGAGG - Intergenic
1063369148 10:5509529-5509551 ATGTGCCAGGCGCTGTGCTGAGG + Intergenic
1064265532 10:13822470-13822492 GTGTGTCAGGGACTGTATTGGGG - Intronic
1064716336 10:18180615-18180637 CTGTGCCAGACATTGATGTGTGG - Intronic
1064797885 10:19034084-19034106 CTGTGCCAGGCACTGGTCTCAGG - Intergenic
1065065765 10:21962241-21962263 ATGTGCCTGGCACTGTTTTAGGG - Intronic
1065141934 10:22726489-22726511 ATGTGCCAGACCCTGTTTTAAGG + Intergenic
1065584242 10:27201974-27201996 ACATGCCAGACACTGTTTTGGGG + Intronic
1065671768 10:28127258-28127280 CTGTGCAAGGCACCGTTCTAAGG + Intronic
1065705796 10:28470558-28470580 CTGTGCCAGGCTGTGTTCTAAGG - Intergenic
1065863887 10:29896447-29896469 ATGTGCTAGGCACTGTGTTGAGG + Intergenic
1066250605 10:33629332-33629354 GTGTGCCAGGCACTATTCTAAGG + Intergenic
1066443467 10:35460527-35460549 ATGTGCCAGGCACTGTATCCAGG - Intronic
1067286704 10:44912359-44912381 CAGAGCCAGGATCTGTTTTGGGG + Intronic
1067685093 10:48461945-48461967 CTGTGCCAGGCACTGTATCAGGG - Intronic
1067792710 10:49299930-49299952 CTGTGGCGGGCTTTGTTTTGGGG - Intronic
1067826539 10:49578189-49578211 CTGTGCCAGGCCCAGCTTGGTGG - Intergenic
1067905160 10:50282954-50282976 ATTTGCCAGGCACTTTTTTTAGG + Intergenic
1067967369 10:50928032-50928054 CTCTGCCACACACTGTTCTGTGG + Intergenic
1067981704 10:51094026-51094048 CTGTGCCAAGCACCATTCTGGGG - Intronic
1068008808 10:51422045-51422067 CTGTGCCAGGCACCCTTGAGTGG + Intronic
1068825788 10:61437355-61437377 CACTGCCAGGCACTGCTTTACGG - Intronic
1069708898 10:70476748-70476770 ACGTGCCAGGCACTGTGCTGTGG + Intergenic
1070778551 10:79124447-79124469 CTGTGACAGGCAGTTTGTTGTGG - Intronic
1070898202 10:80004098-80004120 CTGTGCCAGGCCTCATTTTGTGG - Intergenic
1071337008 10:84608702-84608724 CTGTGCTAAACACTGTTCTGAGG - Intergenic
1071685631 10:87752434-87752456 CTGTGCCAGGCACTATGCTGAGG + Exonic
1071692094 10:87831606-87831628 CTGTACCAGTCACAATTTTGAGG + Intronic
1071780223 10:88836307-88836329 ATGTGCCAGGCACTATGTTATGG - Intronic
1071794747 10:88991933-88991955 CTATGCCTGGCACTTTGTTGGGG - Intronic
1071840299 10:89463794-89463816 ATGTGTCAGGCACCGTTTTAGGG + Intronic
1071886566 10:89957706-89957728 GTTTGCCAGCCCCTGTTTTGTGG + Intergenic
1072003975 10:91224397-91224419 GTGTGTCAGGCACTGTGCTGGGG + Intronic
1072330720 10:94348480-94348502 ATGTGCCAGGCACTTTTTTTAGG - Intronic
1072421425 10:95292791-95292813 CTATGCCAAGCACTGTGCTGGGG - Intergenic
1072668078 10:97408994-97409016 CTGTGCCAGGCACTGGGCTAAGG - Intronic
1072962806 10:99944616-99944638 ATGTGCCAGGCACTGTGCTAAGG - Intronic
1073810447 10:107146956-107146978 ATGTGCCAGGCACTATTTGAGGG - Intronic
1074121332 10:110496402-110496424 GTGGGCCAGGCTTTGTTTTGGGG - Intergenic
1074272570 10:111969530-111969552 CTGTGTTAGGCACTGAATTGAGG - Intergenic
1074445572 10:113518635-113518657 CTGAGCCAGGCCCTGTGCTGAGG + Intergenic
1074510423 10:114106966-114106988 TTGTGCCTGGCACTGTGTTAGGG + Intergenic
1074703220 10:116110271-116110293 CTGTGCCAGGCACTGGGCTATGG + Intronic
1074987849 10:118673166-118673188 CTGTGCCAGGCCATGTGTTATGG + Intergenic
1075407901 10:122206751-122206773 GTGTGCAAGGCACTGTTCTCTGG + Intronic
1075532528 10:123241867-123241889 GCGTGCCAGGCACTGTTCTGGGG + Intergenic
1075539775 10:123302397-123302419 TTGTGCCAGGCACTGTGCTAAGG - Intergenic
1075725021 10:124606663-124606685 CTGGGCCATGCACTTTTTTGGGG + Intronic
1075917340 10:126180117-126180139 ATGTCCCAGGCACTGTATTAAGG + Intronic
1076348357 10:129796373-129796395 ATGGGCCAGGCACTGTTCTGGGG + Intergenic
1076535386 10:131173804-131173826 CTGTGCCAGGTTCTGTGTAGAGG - Intronic
1076551215 10:131279171-131279193 GTGTGCCAGGCACTGTATCGGGG - Intronic
1076783587 10:132738061-132738083 CTGTTCGAGGAACTGTTTTTTGG + Intronic
1077418082 11:2435127-2435149 ATGTGCCAGGCACTGTGTCAGGG + Intergenic
1077653697 11:3998128-3998150 TTGTGCCAGGCACTATTCTAAGG + Intronic
1077726061 11:4676145-4676167 CTGTCTCAGGCACTGCTTTTAGG + Intergenic
1077800092 11:5528343-5528365 CTGTGGGAGGCACTTTTCTGAGG + Intronic
1078059426 11:8033656-8033678 CCGTGCCAGGCCCTGGGTTGGGG - Intronic
1078535595 11:12170890-12170912 CTGTGCCAAGCCCTGTGCTGGGG - Intronic
1078659344 11:13274509-13274531 GTATGCCAGGCACTGTGTTAAGG + Intergenic
1078937486 11:15964615-15964637 ATGTGCCAAGCACTGTGTTGGGG + Intergenic
1079390214 11:20015686-20015708 GTGTGCCAGGCATTGTGCTGGGG - Intronic
1079470050 11:20769537-20769559 CTGTGCCAGGCTCTGTACTGTGG - Intronic
1079621576 11:22562023-22562045 CTGTGCCAGGTACTGTGCTAAGG + Intergenic
1079670881 11:23169482-23169504 TTGGGCCAGGCACTGTTCTGAGG + Intergenic
1079743322 11:24092593-24092615 ATGTGCCTGGCACTGTTCTGTGG - Intergenic
1079941616 11:26687599-26687621 GCGTGCCAGGCACTGTTCTTGGG - Intronic
1079968736 11:27009706-27009728 CTGTGCCAAGCAAATTTTTGAGG + Intergenic
1080014919 11:27494192-27494214 CTATGCCAGGCACCTTTTTAAGG + Intergenic
1080025484 11:27609615-27609637 CTGTGCCAGGCATTGTGCTCAGG + Intergenic
1080081934 11:28231098-28231120 CAATTCCAGACACTGTTTTGGGG + Intronic
1080249090 11:30213116-30213138 CACTGCCATGCACTGATTTGTGG + Intergenic
1080971577 11:37283412-37283434 GTGTGCCTGGAACTGTTTTTCGG + Intergenic
1081343122 11:41951651-41951673 ATGTGCCAGGCTCTGTTCTAAGG + Intergenic
1081651408 11:44826543-44826565 GTGTGCCAGGCACTGCTCTCAGG + Intronic
1081721724 11:45294416-45294438 ATGTGCCAGGCACTGCTCTAGGG - Intergenic
1081855216 11:46298845-46298867 ATGTGCCAGGGACTGTTATAAGG + Intronic
1081860266 11:46329424-46329446 CTGTGCCAGGCATTGGACTGAGG + Intergenic
1081861134 11:46333881-46333903 CTGTGCCAGGCACAGGCTTGTGG + Intronic
1082004245 11:47410890-47410912 CTGTGCCAGGCACTGGGCTGAGG + Intronic
1082079103 11:47998064-47998086 CTGTGCTAGGAGCTGTTTTTGGG - Intronic
1083373919 11:62204619-62204641 TTGTGCCAAGCACTGTTCTCAGG + Intergenic
1083669098 11:64290702-64290724 GTGTGCCAGGCTCTGTTTTGAGG + Intergenic
1083713110 11:64560662-64560684 CAGAGCCAGGCACTGTGATGAGG - Intronic
1083965463 11:66041249-66041271 GTGTGCCAGCCACTGTTTAAGGG - Intergenic
1084433080 11:69122342-69122364 GTGTGCCAGGCACTGGGTAGGGG - Intergenic
1084445535 11:69201515-69201537 TTGTGCCAGGCACTTTGCTGGGG + Intergenic
1084471125 11:69359502-69359524 GTGAGCCAGCCACTGTTCTGAGG - Intronic
1085067646 11:73512046-73512068 GTGTGCCAGGTATTGTTTTAGGG - Intronic
1085215107 11:74822886-74822908 GTATGCCAGGCACTGTGTTAGGG + Intronic
1085244429 11:75088695-75088717 CTGTGCTAAGCACTGTTATTTGG + Exonic
1085411911 11:76296469-76296491 CTGTGCCCGGCCCAGTGTTGGGG + Intergenic
1085447702 11:76611600-76611622 ATGTGCCAGGCACTGATCTAGGG - Intergenic
1085811504 11:79686706-79686728 CTGTGTCTGGCACTGTTTTAAGG - Intergenic
1086072039 11:82810556-82810578 CTGTGGCAGGCACTGTGTTATGG - Intergenic
1086146077 11:83553444-83553466 TTGTGCCAGGTACTGATCTGAGG - Intronic
1086162337 11:83735953-83735975 CTGGGTCAGGCCCTGTTTTCTGG - Intronic
1086472101 11:87125002-87125024 CTGTGTCTGGTATTGTTTTGAGG + Intronic
1086520515 11:87663429-87663451 CTTTGCCAAGCACTGTTGAGAGG + Intergenic
1086961810 11:92985600-92985622 ATATGCCAGGCACTGTTCTAAGG + Intergenic
1086998600 11:93389561-93389583 ATGTGCCAGGAACTGTTCTAAGG + Intronic
1087040052 11:93790115-93790137 ATGTGCCAGGCATTGTTCTAGGG + Intronic
1087508369 11:99057645-99057667 TTGTGCTAGGCACTGTTCTCAGG + Intronic
1087834679 11:102861281-102861303 ATGTGCCAGGCACTGTTCCAAGG - Intergenic
1087878603 11:103388978-103389000 CTCTGCCAGGCTTTGTTATGAGG + Intronic
1088090179 11:106029057-106029079 CTGTGCCAAGCACTGATTTATGG + Intergenic
1088098994 11:106133251-106133273 TTGTGCCAGACACTGTTGTAAGG + Intergenic
1088540432 11:110908228-110908250 CTGTGCCAGGGTCTGCTTTGGGG - Intergenic
1088882774 11:113984510-113984532 CTGTGCCAGGCCCTGTGCTGGGG - Intronic
1089344582 11:117782757-117782779 ATGTGCCAGGCACTGTTGTTAGG + Intronic
1089582689 11:119491290-119491312 ATGTTCCAGGCACTGTGCTGAGG + Intergenic
1089787320 11:120917367-120917389 ATGTGCCAGTCACTGTGCTGGGG + Intronic
1090120045 11:124016291-124016313 CTGTGCCTCCCACTGTATTGTGG + Exonic
1090166201 11:124551067-124551089 CTGTGTCAGACACTGTTCTAGGG + Intergenic
1090201068 11:124856895-124856917 CTGTACCAAGCACTCTTTTAAGG - Intergenic
1090410883 11:126508853-126508875 CTATGACAGGCACTGTGCTGAGG - Intronic
1090741929 11:129670055-129670077 ATGTGTCAGGCATTGTTATGAGG + Intergenic
1090835593 11:130451161-130451183 CTGTGCCATGCTCTTTTTTTTGG + Intronic
1090931059 11:131298534-131298556 CTGTGCCTGACACTGTTTAAAGG + Intergenic
1091412201 12:250853-250875 CTGCGCCAGGCCCTGTTTTTAGG - Intronic
1091690365 12:2592294-2592316 ATGTGCCAGGCACCGTTCTGAGG + Intronic
1091845104 12:3649712-3649734 CCATGCCAGGCACTGTGTTGAGG - Intronic
1092033186 12:5306997-5307019 ATGAGCCAGGCACTGTTCTAAGG - Intergenic
1092152142 12:6256673-6256695 CTGTGCCAAGCACTGTTCTAAGG + Intergenic
1092289751 12:7152681-7152703 ATGTGCCAGGCACTGTGCTCGGG + Intronic
1092554628 12:9543803-9543825 CTGTGTCAGGCACTGTTATAAGG + Intergenic
1092606640 12:10127672-10127694 ATGTGCCAGGCACTCTTTTAAGG - Intronic
1092917773 12:13203650-13203672 CTGTGCCAGGCACAGAGTGGGGG - Intronic
1092920123 12:13223642-13223664 CTGTGGCACTCACTGTTTCGGGG + Intergenic
1093215453 12:16356348-16356370 GTGTGCCAGGCACTTATTTAGGG + Intronic
1093494780 12:19743701-19743723 CTGTGCCAGGAACTGTGATAAGG + Intergenic
1093669088 12:21850844-21850866 CTGTACCTGATACTGTTTTGGGG + Intronic
1093685621 12:22050380-22050402 ATGTGCCAGGCACTATTCTAAGG - Intronic
1093766640 12:22971071-22971093 CTGGGCCAGGCAGGGTTTTGAGG - Intergenic
1094033650 12:26043081-26043103 CTGTGCCAGCCACTATGCTGAGG + Intronic
1094424248 12:30302194-30302216 CTGTGCCAATCACTGTATTTTGG + Intergenic
1095127096 12:38492683-38492705 ATGTGCCAGGCACTGTTATAAGG + Intergenic
1095397744 12:41779901-41779923 CTGTGCCAGGCACTGCGTCACGG - Intergenic
1095736799 12:45566441-45566463 CTGTGCCAGGCATTGTGTTAAGG + Intergenic
1095969384 12:47891314-47891336 GTGTGCCAGGCACCCTTCTGAGG - Intronic
1096240962 12:49960195-49960217 CTGTGCCAGGCACTGTGCTAAGG + Intergenic
1096444287 12:51674750-51674772 CTGTACCAGCCACTGTGTTAAGG + Intronic
1096541106 12:52307710-52307732 TTGAGCCAGGCATTGTTTTTAGG + Intronic
1096733130 12:53630603-53630625 CTGTGCCAAGCTGTGTTTTGTGG + Intergenic
1097181155 12:57172803-57172825 GTGTGCCAGGCGCTGTCCTGGGG - Intronic
1097290668 12:57911985-57912007 TTGTGACAAGAACTGTTTTGGGG + Intergenic
1098143949 12:67479664-67479686 ATGTGCCAGGCAATGTTTTGAGG + Intergenic
1098297283 12:69016966-69016988 CCGTGCCTGGCCCTGTTTTCTGG - Intergenic
1098595244 12:72266642-72266664 CAGTGCCAGGCACTGTGCTAGGG - Intronic
1098854360 12:75635592-75635614 GTGAGCCAGGCACTGTTCTAAGG - Intergenic
1098861392 12:75714818-75714840 CTGTGCCAGGGACTATTCTAAGG - Intergenic
1099648250 12:85388820-85388842 TTGTGCCAAGCACTGTTGTAAGG + Intergenic
1099968749 12:89478517-89478539 CAGTGCCAGGCACTGTGTCTGGG - Intronic
1100347785 12:93749041-93749063 ATCTGCCAGGCACTATTCTGGGG + Intronic
1100527724 12:95435665-95435687 ATATGCCAAGCACTGTTTTTGGG + Intergenic
1100555354 12:95687811-95687833 ATGTACCAGACACTGTTCTGGGG - Intronic
1100596038 12:96072954-96072976 ATGTGCCAGGCACTGTTCTTGGG - Intergenic
1100635249 12:96429295-96429317 GAGTGCCAGGCACTGTTATGAGG + Intergenic
1100888043 12:99094128-99094150 ATGTGCCAGGCACTGGGCTGTGG + Intronic
1101058491 12:100945862-100945884 CTATGCCAGGCATTGCTTTAAGG + Intronic
1101289752 12:103355914-103355936 ATGGGCCAGGCACTGTTTCAAGG + Intronic
1101366779 12:104079243-104079265 ATGTACCAGGCACTCTTCTGGGG - Intronic
1101437235 12:104674355-104674377 CTGTGCCAGGCATTGTTGTAAGG + Intronic
1101519820 12:105471225-105471247 ATGTCCCAGGCACAGTTCTGGGG + Intergenic
1101598613 12:106189204-106189226 CTGTGCCAGGCACTGTCTCAGGG + Intergenic
1101757458 12:107632143-107632165 GTGTGAAAGGCACTCTTTTGGGG - Intronic
1101836802 12:108301538-108301560 ATGTGCCAGGCACTGAGCTGGGG - Intronic
1101845228 12:108358177-108358199 ATGTGCCAGGCACTGGGCTGGGG + Intergenic
1101857786 12:108458276-108458298 CTGGGCCAGGCACTGTTGAGGGG - Intergenic
1101908140 12:108843124-108843146 GTGTGCCAAGCCCTGTTTTAGGG - Intronic
1102507255 12:113391446-113391468 ACATGCCAGGCACTGTTATGAGG + Exonic
1102540920 12:113618531-113618553 CTGTGCCTGGCACTGTCCTCAGG + Intergenic
1102571190 12:113827949-113827971 GTGTGCTAGGCACTATTGTGAGG - Intronic
1102762582 12:115401354-115401376 CTCTGGCAGGCACTGTGCTGGGG - Intergenic
1102989078 12:117301946-117301968 CTGTGCCAGGCCCTGTAGAGTGG + Intronic
1103054459 12:117807708-117807730 ATGTGCCAGGCACAGTTTCAAGG + Intronic
1103137410 12:118519491-118519513 ATGTGCCAGGCACTGGGTAGGGG - Intergenic
1103193794 12:119024919-119024941 GTGTGCCAGGGCCTGTTCTGGGG + Intronic
1103331006 12:120154006-120154028 CTGAGGCAAACACTGTTTTGGGG + Intronic
1103673828 12:122640315-122640337 ATGTGCCAGGAACTGTTCTGGGG + Intergenic
1103885149 12:124194923-124194945 ATGTGCCAGGCACTGTTTTAGGG - Intronic
1104301319 12:127567709-127567731 CTGTGCCTGGCAGTGTTCTAAGG + Intergenic
1104337848 12:127917258-127917280 CTGTGTCAGGTGCTGTTTTAAGG - Intergenic
1104634277 12:130427899-130427921 CTGTGCCAGGAACTGAAGTGGGG - Intronic
1104858188 12:131911645-131911667 CTCTGGGAGGCCCTGTTTTGGGG - Intronic
1105303389 13:19153908-19153930 CTCTCCCAGGCCCTGCTTTGTGG - Intergenic
1105356307 13:19663192-19663214 CACTGCCAGGCACTGTGCTGGGG + Intronic
1105656590 13:22447550-22447572 CTGAGCTTGCCACTGTTTTGGGG - Intergenic
1105746718 13:23383897-23383919 CTGTGCCAGGCACTGGGGTTGGG - Intronic
1105796528 13:23859651-23859673 CTGGGCCAGGTACTGTTCAGGGG - Intronic
1105830996 13:24162649-24162671 GTGTGCCAAGCACTGTTCTGAGG + Intronic
1105958198 13:25303817-25303839 CTATGCCAGGCACTGTCCTTGGG - Intronic
1106240427 13:27907867-27907889 CTGTGCCAGGCACTGTTGCCAGG - Intergenic
1106295358 13:28408612-28408634 CTGTGCTGGGAACTGTCTTGAGG + Intronic
1107114136 13:36728200-36728222 CTGTACCAGGCACTGTGTCAGGG - Intergenic
1107197305 13:37667942-37667964 CTGTGTCAGGCACTGTCTTCGGG + Intronic
1107506584 13:41040474-41040496 CGGTACCAGGGACAGTTTTGTGG + Intronic
1107834435 13:44402182-44402204 CTGTGCCAGGCCCTGTTTTAAGG + Intergenic
1108072234 13:46640270-46640292 CTGTGGCAGGCACTGCTCTAAGG + Intronic
1108604202 13:52020969-52020991 ATGTGTCAGGCACTGTTCTGGGG + Intronic
1109120013 13:58443540-58443562 GTGTGCCAGGCTCTGTTATAGGG + Intergenic
1109388746 13:61666822-61666844 CTGACAGAGGCACTGTTTTGGGG + Intergenic
1111341456 13:86891548-86891570 ATGTGGTAGGCACTGTTCTGAGG - Intergenic
1111828342 13:93296603-93296625 CTGTGCCAGCCACTGTAGTAGGG - Intronic
1112433943 13:99377157-99377179 GTGTGTCAGGCTCTGTGTTGGGG + Intronic
1112756600 13:102641868-102641890 CTGTGCCAGGCCCTTTTCAGTGG + Intronic
1113034197 13:106030986-106031008 CTTTTTCAGGGACTGTTTTGTGG - Intergenic
1113294444 13:108942812-108942834 TTGTGACAGACAGTGTTTTGTGG - Intronic
1113543039 13:111123703-111123725 GTATGCCAGGCACTGTTCTAAGG + Intronic
1113864150 13:113510047-113510069 CTGTGCCAGGCACTGTCACAGGG - Intronic
1114599948 14:23947119-23947141 CTCTGCCAGGCTTTGTTTTCAGG - Intergenic
1114634258 14:24178518-24178540 CTTTGCAATGCACTGTTCTGGGG - Intronic
1114669800 14:24403637-24403659 ACATGCCAGGCACTGTTTTAGGG - Intronic
1114797550 14:25733661-25733683 CTTTGCCAGGCACTGCTTTAGGG - Intergenic
1114841442 14:26267342-26267364 AGGTGCCAGGCATAGTTTTGAGG + Intergenic
1117541029 14:56746688-56746710 TTGTGCCAAGCACTGTATTAGGG - Intergenic
1117717748 14:58598204-58598226 CTGTTCCAAGCACTGTGCTGAGG - Intergenic
1117863766 14:60122751-60122773 CTGTGCCAGGCACTGTTTCAGGG - Intronic
1119347783 14:73940691-73940713 CTGTGCCAGGCACAGTGTTAAGG - Intronic
1119391679 14:74295302-74295324 CTGAGGCAGCCACGGTTTTGAGG - Intronic
1119418197 14:74489718-74489740 CTGTTACAGGCACTGTTATCAGG - Intronic
1119497612 14:75093910-75093932 ATTTGCCAGGCACTGTTCTAGGG + Intronic
1119537439 14:75413934-75413956 GTGTGCCAGGCACTGTGTGGGGG + Intergenic
1119552384 14:75524326-75524348 ATGTGCCAGGCATTGTGCTGGGG + Intronic
1119616041 14:76099700-76099722 ATGTGCCAGGCGCTGTGCTGAGG + Intergenic
1119910758 14:78347186-78347208 CTGTAGCAGGCAATGTTTTATGG + Intronic
1120048904 14:79842132-79842154 ATGTGCCTGGCGCTGTTCTGTGG + Intronic
1120628885 14:86864653-86864675 CTGTGCCAGGTACTTTTTTCTGG + Intergenic
1121438988 14:93937019-93937041 CTGTGCCAGGCACAGTGAAGTGG - Intronic
1121488735 14:94342725-94342747 GTGTGCCAGGCACAGTTCTAGGG - Intergenic
1121521908 14:94591881-94591903 CTGCCCCAGGCACTGTGCTGGGG - Intronic
1121693911 14:95897124-95897146 TTGTGCCAGGCACTGTTCTGGGG + Intergenic
1122295671 14:100704412-100704434 TTGCGCCAGGCACTGTGCTGTGG - Intergenic
1122353866 14:101112167-101112189 GAGTGCCAGGCACCGTTCTGGGG - Intergenic
1122482126 14:102054146-102054168 CTGTGCCCAGCACTGCGTTGAGG - Intergenic
1122973709 14:105162613-105162635 CTGGGCCATGCAGTGCTTTGGGG - Intronic
1124504877 15:30264083-30264105 CAGTGCCAGGCCCTGTGCTGAGG + Intergenic
1124738675 15:32274552-32274574 CAGTGCCAGGCCCTGTGCTGAGG - Intergenic
1124988586 15:34648095-34648117 ATGTGCCAGGCACTGTGTTAGGG - Intergenic
1125117741 15:36115167-36115189 CTGTGCCAGGCAATGTTATGTGG - Intergenic
1126055605 15:44727105-44727127 TTGTGCCGGGCACTCTTTTTAGG + Intergenic
1126070334 15:44860370-44860392 ATGTGCCAGGCACTGGGCTGAGG - Intergenic
1126087701 15:45024747-45024769 ATGTGCCAGGCACTGGGCTGAGG + Intronic
1126135197 15:45383076-45383098 CTGTGTCAGGCACTGTGCTAGGG - Intronic
1126376878 15:48005876-48005898 GTGTGCCAGGCACTGTGCTAGGG - Intergenic
1126529583 15:49698474-49698496 CTGTATTAGGCTCTGTTTTGGGG + Intergenic
1127315159 15:57788173-57788195 CTGTGCCTGGCACTTTTTAGCGG - Intergenic
1127629692 15:60815418-60815440 CTTGGCCAGGCGCTGTTTTAAGG - Intronic
1127646204 15:60961861-60961883 CTGTGTCAGTTACTGTTTTCAGG - Intronic
1127907099 15:63383985-63384007 GTGTGTCAGGCACTTTTTTGGGG + Intergenic
1128183681 15:65626122-65626144 CTCTGCCAGGCACTGTGCTGGGG + Intronic
1128614368 15:69097800-69097822 CTGTGCCAGTCACTTCTTTTAGG - Intergenic
1128844297 15:70876339-70876361 CTGTGCCAAGCACTGTTCTAAGG - Intronic
1129109206 15:73327926-73327948 CTGTCCCAGGCACTGTCCTTTGG - Intronic
1129383257 15:75181166-75181188 GTGTGCTAGGCACTGCTTTGGGG + Intergenic
1129542582 15:76363033-76363055 CTGTGGCAGGCACAGTGCTGGGG - Intronic
1129705171 15:77790280-77790302 ATGTGCCAAGCAGTGTTCTGGGG - Intronic
1129819349 15:78586900-78586922 GTGTGCCAGACACTGTTATGGGG + Intronic
1130392872 15:83474213-83474235 ATGTGCCAGGCAGTGTTTGAGGG - Intronic
1130526823 15:84714386-84714408 ATGTGCCAGACACTCTTCTGAGG + Intronic
1130563839 15:84978995-84979017 CTGTGACTGGCACAGATTTGTGG - Intergenic
1131090183 15:89618618-89618640 ATGTGCCAGGCACTGTGTGTTGG - Intronic
1131090752 15:89623174-89623196 ATGTGCCAGGCACTGTGTGTTGG - Intronic
1131224000 15:90608701-90608723 CTGTGCCGGGCACTGTGCTAGGG - Intronic
1131384675 15:91994180-91994202 GTGTGCCAGGCTTTGTTTTAAGG + Intronic
1131794501 15:96001051-96001073 CTGTGCCAGGCACTGTGCTGGGG + Intergenic
1132110484 15:99099154-99099176 CTGGGCCAGGCACAGTGGTGTGG - Intronic
1132752590 16:1465657-1465679 CTGTGGCGGGCACTGCATTGGGG - Intronic
1132761728 16:1511801-1511823 ATGTGCCAGGCGCTGTGCTGGGG + Intronic
1132778350 16:1609555-1609577 CTGTGCAAGGCACTGTTGTAAGG - Intronic
1133147536 16:3800997-3801019 CTGTGCCAGGCTCTGTGTTCAGG + Intronic
1133715976 16:8449069-8449091 TTGTGCCAGGCACTGGACTGGGG + Intergenic
1133773207 16:8879794-8879816 CTGTGCCAGGCCTTATTTGGAGG + Intergenic
1134114046 16:11534782-11534804 GTGTGCCAGTCACTGTTTACTGG + Intergenic
1134760584 16:16710884-16710906 ATGTGCCAGGAACTGTTCTAAGG + Intergenic
1134907421 16:17992486-17992508 TTGTGCCAGGCACTGTGCTCAGG - Intergenic
1134985475 16:18648289-18648311 ATGTGCCAGGAACTGTTCTAAGG - Intergenic
1135063267 16:19288693-19288715 GGGTGCCAGACACTGTTCTGAGG - Intronic
1135195025 16:20387115-20387137 ATGTGCCAGGCACTGTCCTAGGG + Intronic
1135415772 16:22267006-22267028 ATGTCCCAGGCACTGGTTTGGGG + Intronic
1135955278 16:26951771-26951793 CTGTCTCAGGAGCTGTTTTGGGG - Intergenic
1136052360 16:27660919-27660941 CTATGCCAGGCACTTTTCTAGGG - Intronic
1136515744 16:30767179-30767201 CTGAGCCAGGCTCTGTTCTAGGG + Intronic
1136652354 16:31683605-31683627 CTTTGTCATGCACTGTTCTGAGG - Intergenic
1137020522 16:35421320-35421342 CTGTGCCACCGACTCTTTTGGGG - Intergenic
1137033703 16:35548924-35548946 CTGTGCCACAGACTCTTTTGGGG - Intergenic
1137279062 16:46959673-46959695 ATATACCTGGCACTGTTTTGAGG - Intronic
1137308412 16:47229075-47229097 ATGTGTCAGGCACTGTGCTGGGG + Intronic
1137316184 16:47325989-47326011 CTCTGCCAGGCATTGTTATCAGG - Intronic
1137499545 16:48999840-48999862 CTGTGCCAGGCATTTTTCTAGGG + Intergenic
1137522628 16:49208085-49208107 TTGTGCCAGGCACTGTGCTGAGG + Intergenic
1137606526 16:49790370-49790392 CTGAGCCAGGCACTGTGCTGGGG + Intronic
1137769538 16:51004834-51004856 ATGTGCCAGGCACTGTTTTAGGG - Intergenic
1138240059 16:55420202-55420224 CTATGCCAGGAACTGTAATGAGG - Intronic
1138607570 16:58098746-58098768 CTGTGCCAGGCACTGTCCTGGGG + Intergenic
1138834215 16:60413516-60413538 CTGTGGCAGGCACCATTCTGAGG - Intergenic
1139294602 16:65889432-65889454 ATGTGCTAGGCACTGTGTTAGGG - Intergenic
1139321984 16:66122267-66122289 CTGTTCCAGGCACTGTTTGTAGG + Intergenic
1139460102 16:67115193-67115215 CTGTGCCAGGCACAGTGATTGGG + Intronic
1139643727 16:68311975-68311997 ATGTGCCAGGCACTATATTAGGG - Intronic
1140000902 16:71024064-71024086 ATGTGCTAGGCACAGTGTTGGGG - Intronic
1140313313 16:73869897-73869919 TTGTTCCAGGCACTGTCCTGGGG - Intergenic
1140640632 16:76967827-76967849 TTGTGCCAGGTACTGTCTTTGGG + Intergenic
1140854121 16:78962576-78962598 CTGTGCCAGGCATTCTTTCTGGG - Intronic
1140967502 16:79981166-79981188 CTGCGCCAGGCTCTGTGCTGGGG + Intergenic
1141124560 16:81391928-81391950 CTGTCTCAGGCACTGGTTTCTGG - Intergenic
1141185512 16:81784246-81784268 CTATGCCAGGCACTGAGGTGGGG - Intronic
1141395440 16:83700478-83700500 ATGTGCCAGGCACTGTTGTTAGG + Intronic
1141643326 16:85354388-85354410 ATGTGCCAGGCACTGATCTAGGG - Intergenic
1141737373 16:85862527-85862549 CAGTGGCAGGCCCTGTCTTGGGG + Intergenic
1141855710 16:86680124-86680146 CTGTGGCAGGCACTATTTTGGGG - Intergenic
1142318390 16:89364522-89364544 CTGTGCTCAGCGCTGTTTTGAGG - Intronic
1142328232 16:89432410-89432432 CCGTGGCATGCACTGTGTTGAGG + Intronic
1142615879 17:1134840-1134862 CTGTGCCAGGCACTCCTCGGAGG - Intronic
1142882023 17:2889352-2889374 CAGTGCCAGGCCCTGTGCTGGGG + Intronic
1143100884 17:4504084-4504106 CTAAGCCAGGCCCTGTCTTGTGG + Intronic
1143236846 17:5409612-5409634 CTGTGCCAGGTACTTTTCTAGGG + Intronic
1143271246 17:5676603-5676625 TTGTGCCAGGCATTGTGTTAAGG + Intergenic
1143425748 17:6835987-6836009 ATGTGCCAGGCACTGTGCTTGGG + Intergenic
1143974665 17:10821082-10821104 CTGTGCCAGACCCTGTGCTGGGG - Intergenic
1144029896 17:11310222-11310244 GTGTGCCAGGCACTGTTTTAGGG + Intronic
1144052817 17:11511575-11511597 CTGAACCAGGCATTTTTTTGGGG - Intronic
1144105776 17:11983893-11983915 GTGTGCCAGGAACTGTTTGTGGG - Intronic
1145889979 17:28407478-28407500 ACGTGCCAGGCACTGTGCTGGGG + Intergenic
1146393908 17:32446571-32446593 CTGTTCCAGTCACTATTTTATGG - Intronic
1146481529 17:33208770-33208792 ATGTGCCAGGCCCTGTTCTGAGG - Intronic
1146631005 17:34469294-34469316 CTGGGCCAGGCATTGTCTGGGGG - Intergenic
1146635188 17:34498840-34498862 TTGTGCCAGGCATTGTGCTGTGG - Intergenic
1146638675 17:34524398-34524420 TTGTGCCAGACATTGTGTTGGGG - Intergenic
1146922005 17:36719832-36719854 CTGTTCCAAGCACTGTACTGAGG - Intergenic
1147179552 17:38675417-38675439 GTGTGCCACGCACTGTTTTAGGG - Exonic
1147653792 17:42077091-42077113 GTGTGTCAGGCACTGTTCTAGGG - Intergenic
1147870713 17:43585508-43585530 TTGTGCCAGGCATTGTCCTGGGG - Intergenic
1147988065 17:44317912-44317934 CTGTGCCAGGCACCGTGCTGGGG - Intronic
1148194939 17:45706565-45706587 TTGTGCCAGGCACTGTTCTAGGG - Intergenic
1148750102 17:49940690-49940712 GTGTGCCAGGCACTGTGCTGAGG + Intergenic
1148775616 17:50094136-50094158 ATATGCCAGGCACTGTTTACAGG - Intergenic
1148995450 17:51705469-51705491 ATGTGCCAAGCACTGTTTTAGGG - Intronic
1149098891 17:52880044-52880066 AGGTGCCAGGCACTGTTCTAAGG + Intronic
1149329119 17:55563339-55563361 ATGTGCCAGGCACTGTCCTTGGG + Intergenic
1149447607 17:56725711-56725733 CTGTGCCTGGCCCTGTGTTAAGG + Intergenic
1150183122 17:63147989-63148011 CTGGGCTAGGTACTGTTTTGAGG + Intronic
1150716140 17:67574094-67574116 ATGTGCCAGTCACTGTGCTGGGG + Intronic
1150828684 17:68499087-68499109 CTGTGCCTGGAACCGTTGTGAGG - Intergenic
1151675954 17:75597529-75597551 CTGTGCCAGGAACTGTGCTAAGG + Intergenic
1151794209 17:76332356-76332378 CTGTGCCAGGAACATTATTGGGG - Exonic
1151994594 17:77600660-77600682 TTGTCTCAGGCTCTGTTTTGGGG + Intergenic
1152782909 17:82234301-82234323 CTGTCCCAGGCACTGTGGTGGGG + Exonic
1152998584 18:431861-431883 ATGTGCCAGGCACTGTGCTAAGG + Intronic
1153698575 18:7668951-7668973 ATGTGCCAGGCACTGGTCTAAGG - Intronic
1154141600 18:11828914-11828936 AAGTGCCAGGCACTATTTTGAGG - Intronic
1154304941 18:13223727-13223749 GTGTGCCAGGCTCTGTTCTGAGG + Intronic
1154945433 18:21157616-21157638 CTTACCCAGGCTCTGTTTTGGGG - Intergenic
1155038073 18:22042114-22042136 CTGTGCCAAGCACTGTGCTAGGG - Intergenic
1155095421 18:22550600-22550622 CTGTCCCAGGCACTGTGCTGAGG - Intergenic
1155518982 18:26650357-26650379 GTGTGCCAGGCACTGTATTAAGG + Intronic
1156584306 18:38414942-38414964 AAGTGCCAAGCACTGTTTTAGGG - Intergenic
1156734820 18:40242822-40242844 CTGTGCTAGGGACTTTTTTCCGG + Intergenic
1156920129 18:42512085-42512107 CTGTGTCAGAAACTGTTGTGTGG + Intergenic
1156966367 18:43098656-43098678 AAGTGCCAGGTACTGTTTTCAGG + Intronic
1157047806 18:44123927-44123949 GTGTGTCTGGCACTGTTCTGAGG + Intergenic
1157699885 18:49755538-49755560 ATGTGCCAGGCATTGTGCTGGGG + Intergenic
1158428977 18:57366561-57366583 CCTTTGCAGGCACTGTTTTGTGG - Exonic
1158791777 18:60788578-60788600 CTGTTTCAGGCTCTATTTTGGGG + Intergenic
1160060622 18:75526033-75526055 ATGTGTCAGGCACTGTGCTGGGG + Intergenic
1161007427 19:1943599-1943621 GTGTGCCAGGCACGGTTGGGAGG + Intronic
1161482763 19:4519021-4519043 GTATGCCAGGCACTGTTCTGTGG - Intergenic
1161630990 19:5355351-5355373 CTGTTCCAGGCACTGTTCCTGGG + Intergenic
1161969867 19:7572085-7572107 GTATACCAGCCACTGTTTTGAGG + Intergenic
1162104205 19:8360348-8360370 ATATGCCAGGCACTGTACTGGGG - Intronic
1162981820 19:14245361-14245383 GTGGTCCAGGCACTGCTTTGAGG + Intergenic
1164186746 19:22876680-22876702 CTGTGCCAAACACTGTTATTTGG - Intergenic
1164485669 19:28653721-28653743 AAATGCCAGGCACTGTTTTCTGG + Intergenic
1164714446 19:30381266-30381288 ATGTGCCAGGCACTGTGCTGGGG + Intronic
1164760596 19:30725698-30725720 AGGTGCCAGGCGCTGTGTTGAGG - Intergenic
1164811666 19:31162198-31162220 GTGGGCCAGGCACTGTGCTGGGG - Intergenic
1165450798 19:35881148-35881170 CTGTGCCAGGCACTACTCTGAGG + Intergenic
1165655318 19:37527446-37527468 ATGTGCCAGGCACTGTTCAAAGG + Intronic
1165733585 19:38162066-38162088 ATGTGCCAGACACCGTTCTGAGG - Intronic
1165834562 19:38746213-38746235 CCATGCCCGGCCCTGTTTTGGGG - Intronic
1165886415 19:39082261-39082283 CTGTGCTAGGCACTGTTCTAAGG + Intergenic
1166093050 19:40522685-40522707 CTGTGCTGGGCGCTATTTTGGGG + Intronic
1166558562 19:43717394-43717416 CTGAGCCAGGCGCCGTTTTATGG + Intronic
1166730190 19:45054848-45054870 CTGTGCCAGGCTCGGTGCTGGGG - Intronic
1166959669 19:46489922-46489944 GCGTGCCAGGCACGGTGTTGGGG + Intronic
1167015713 19:46839691-46839713 CTGTGCCTGGCCCTGTGCTGGGG + Intronic
1167747737 19:51362600-51362622 GTGTGCCAGGCACTGTTCCAAGG + Intronic
1168328513 19:55551701-55551723 ATGGGCCAGGTACTGTTCTGGGG + Intergenic
1168412799 19:56150130-56150152 ATGTGCCAGGTCCTGTTCTGAGG - Intronic
1168470175 19:56633482-56633504 CTGTGCCAGGCACTGTTGCAGGG + Intergenic
925039620 2:721245-721267 CTGTGCAAGGCTCTGATGTGTGG - Intergenic
925293174 2:2761917-2761939 CTGTGTCAGGCACTGTACTAGGG - Intergenic
925395288 2:3529141-3529163 CTGTGCAAGACACTGTCCTGGGG + Intergenic
925443711 2:3909813-3909835 CTGTGCCAGGCCTTGTGATGGGG + Intergenic
925645722 2:6034729-6034751 CTGAGCCAGACACTGTATTTTGG + Intergenic
925976111 2:9143254-9143276 GTGTGCCAGGCCCTGTGCTGGGG + Intergenic
926668410 2:15550367-15550389 GTGTGCCTGGCACTGTATTTAGG - Intronic
926796723 2:16625622-16625644 CTGTGCCAGGCGGTGCTTGGTGG - Intronic
927571769 2:24166540-24166562 CTGAGCCAGGCAGTGTTTGAGGG + Intronic
927962847 2:27251260-27251282 TTGTGCAAGGCACTGTGGTGCGG - Intergenic
928035436 2:27818218-27818240 ATGTGCCAGGCACTGTTCTCAGG + Intronic
928114871 2:28539359-28539381 CTCTGCCAAGCATTGTTTTGGGG + Intronic
928157723 2:28892212-28892234 ATGTGCCAGGCACTGTTTTAGGG - Intergenic
928924695 2:36565665-36565687 CTGAGCCTGGCTCTGTTCTGTGG - Intronic
929164411 2:38866640-38866662 ATGCACCAGGCACTGTTTTAGGG - Intronic
929239392 2:39638413-39638435 ATGTGCCAGGCAGTGGTTTAAGG + Intergenic
929267425 2:39934016-39934038 ATGTGACAGGCACTGCTTTATGG + Intergenic
929449270 2:42025757-42025779 CTCCTCCAGGCTCTGTTTTGGGG - Intergenic
929733189 2:44518023-44518045 TGGTGCCAGCCAGTGTTTTGTGG + Intronic
930887166 2:56339143-56339165 TTGTGTCAGGCACTGTTCTAGGG - Intronic
931384167 2:61782277-61782299 CTGTGCCAGTCACTGAGTTTTGG - Intergenic
931547553 2:63406401-63406423 ATGTGCCAGGCACTGGTTCTGGG + Intronic
931872069 2:66472142-66472164 CTGTGCCAGGCTGTGTGTGGTGG - Intronic
932471825 2:71964205-71964227 ATGGGCCAGGCACTGTTCTCAGG + Intergenic
932886630 2:75554718-75554740 GGGTGCCAGGCACTGTGTTAGGG - Intronic
933575150 2:84058829-84058851 GTGTGTCAGGCACTGTTCTAGGG + Intergenic
933608901 2:84413936-84413958 CTGGTCCAGGCACTATTTGGAGG - Intergenic
933771507 2:85747454-85747476 CTGAGCCGGGCACTGTAATGGGG - Intergenic
934894318 2:98100696-98100718 CTGTGTCAGGCCCTGTATTAGGG + Intronic
934989342 2:98910576-98910598 GTTTCCCAGCCACTGTTTTGAGG + Intronic
935290363 2:101604996-101605018 ATATGCCAGGCACTGTTCAGGGG + Intergenic
935415071 2:102806713-102806735 ATGTTCCAGGCACTGTTTTCAGG + Intronic
935426280 2:102921420-102921442 CTGTGCCAGCCATGGTTTTTAGG + Intergenic
935516190 2:104042410-104042432 ATATGCCAGGCACTGGTTTAAGG + Intergenic
935782365 2:106519435-106519457 CTGAACCAGGCCCTGTATTGAGG + Intergenic
935863514 2:107360163-107360185 CTGAGCCAGGCACGGTGCTGTGG - Intergenic
936142008 2:109948593-109948615 CTGTGCCAGGCACTGTGCCAGGG - Intergenic
936178696 2:110246541-110246563 CTGTGCCAGGCACTGTGCCAGGG - Intergenic
936202682 2:110422891-110422913 CTGTGCCAGGCACTGTGCCAGGG + Intronic
936400972 2:112164203-112164225 ATGTGCCAGGCACTATATTAGGG - Intronic
937002469 2:118480032-118480054 CAGTGCCAGGTACTGTTCTAGGG - Intergenic
937034856 2:118772498-118772520 GTGTGCCAGGCACTGTTTCTAGG + Intergenic
937357314 2:121206117-121206139 GTGTGCCAGGCGCTGCTGTGTGG - Intergenic
937734783 2:125276471-125276493 CTATGCCAGCCACTGTTTCAAGG + Intergenic
938750863 2:134328645-134328667 GTGTGCCAGGTACTGCTTTCAGG + Intronic
938772529 2:134512620-134512642 TTGTGCCAGGCACTGTTCTGGGG + Intronic
938986695 2:136583479-136583501 CTGTGCCAGGCACTGGGCTGTGG + Intergenic
939462982 2:142521208-142521230 GTGTGTCAGGCACTGTTTTTTGG - Intergenic
939786185 2:146516047-146516069 ATGTGCCAGGCACTGTTTATAGG + Intergenic
940110558 2:150147941-150147963 ATGTGCCAGGCCTTGTTCTGGGG + Intergenic
940728664 2:157364101-157364123 AAGTACCAGGCACTGTTTTCAGG + Intergenic
940825227 2:158404103-158404125 CTATACCAGGCACTGTGTTAAGG - Intronic
941203566 2:162544384-162544406 GTGTGCCAGCCACTGTTATGAGG + Intronic
941306311 2:163872690-163872712 CTTTGAAAGGCACTTTTTTGGGG + Intergenic
942034053 2:171993745-171993767 CTGTGCCCGGCACTATTTGCTGG - Intronic
942053138 2:172159075-172159097 GTGCACCAGGCACTGTTTGGGGG + Intergenic
942158331 2:173155447-173155469 ATGTGCCAGGCACTATTTTTTGG - Intronic
943565926 2:189516339-189516361 CTGTGCCAGGCATTGTTACATGG - Intergenic
944255068 2:197617237-197617259 CAGTGCCAGGCGATGTTTTTTGG + Intronic
944611982 2:201420077-201420099 GTGTGCCAGGCATTGTTGTTAGG + Intronic
944658675 2:201901927-201901949 CTTCCCCAGGCACTCTTTTGGGG - Intergenic
944678448 2:202053850-202053872 ATGTGCCAGGCTCTGTGCTGGGG - Intergenic
944699104 2:202230120-202230142 TTTTGCCCGGCACTGTTTAGAGG - Intronic
945406856 2:209459318-209459340 ATGTGCCAGGCACTGTTCTAGGG - Intronic
945476234 2:210285440-210285462 GTGGCCAAGGCACTGTTTTGTGG + Intergenic
945585421 2:211655381-211655403 CTAAGCCAGGCACTGTTCTAAGG + Intronic
946148126 2:217746178-217746200 ATGTGCCAGGCACTGTCCTGTGG - Intronic
946170911 2:217894983-217895005 GTGAGCCAGGGGCTGTTTTGGGG - Intronic
946902678 2:224387500-224387522 GTGAGCCTGGCACTGTTTAGAGG - Intronic
946921050 2:224582822-224582844 ATGTGCCAGGCACTGTTCTGGGG - Intronic
947073795 2:226319537-226319559 ATGTGCCAGGTACTGTTCTGGGG - Intergenic
947159476 2:227197778-227197800 CTGTGCCAGGCATGGTGGTGAGG + Intronic
947329846 2:229016849-229016871 CTGGGCCAGGCACTGTATTAAGG - Intronic
947718671 2:232354358-232354380 CTGGGCGAGGGACTGATTTGGGG + Intergenic
948949776 2:241241605-241241627 TAGCGCCAGTCACTGTTTTGTGG - Intronic
1168759155 20:337083-337105 ATGTTCCAGGCACTGTCTTAAGG + Intergenic
1168793692 20:597001-597023 CAGTGCCAGGCACTGTTCCACGG - Intergenic
1168854437 20:998756-998778 CTGTGCCAGGCTCTGTGTTGGGG - Intronic
1168952589 20:1812571-1812593 GGGTGCCAGGTACTGTTTTGGGG + Intergenic
1168957291 20:1843155-1843177 ATGTGCCAGGCATTGTTGTGAGG - Intergenic
1168986869 20:2056490-2056512 CTGTGCCAGGCACTGTACTAAGG + Intergenic
1169004431 20:2195011-2195033 ATGTACCAGGCACTCTTCTGAGG - Intergenic
1169328971 20:4701626-4701648 CTGTGTTGGGGACTGTTTTGGGG + Intergenic
1169411479 20:5374215-5374237 GTATGCCAGGCACTGTTTTAAGG - Intergenic
1170291631 20:14776430-14776452 GTGTATCAGGCACTGTATTGAGG - Intronic
1170510107 20:17067728-17067750 ATGTGCTAGGCACTGTTCTGGGG + Intergenic
1170907734 20:20530860-20530882 CTCTGCCAGGCGCTGTGCTGAGG - Intronic
1171142622 20:22755999-22756021 CTGAGCCAGTCACTGTTTATTGG + Intergenic
1171188915 20:23144569-23144591 CTGTGGTCAGCACTGTTTTGAGG - Intergenic
1171337164 20:24395037-24395059 CTGTCTCAGGCTCTGCTTTGGGG - Intergenic
1171395505 20:24830291-24830313 GTGTGTCTGGCACTGGTTTGTGG - Intergenic
1172145527 20:32755200-32755222 CTGTGCCAGGCACTGTGGTAAGG - Intergenic
1172256626 20:33524164-33524186 ATGTGCCAGGCACTGAGTTAAGG - Intronic
1172287847 20:33753503-33753525 GTGTGCCAGACACTGTGCTGGGG + Intronic
1172597273 20:36157982-36158004 ATGTGCCAGGCCCAGTTTTAAGG + Intronic
1172606229 20:36216057-36216079 ATGCGCCAGGCACTGTTCTCAGG - Intronic
1172714510 20:36952648-36952670 GTGTGCCAGGCACGGTTCTAAGG + Intergenic
1172789167 20:37490679-37490701 CCTTGGCAGGAACTGTTTTGGGG - Intergenic
1173025751 20:39305889-39305911 ATGTGCCAGGTACTGTGCTGGGG + Intergenic
1173351422 20:42248923-42248945 ATGTGCCAGGCACTGTGCTAAGG + Intronic
1173582585 20:44158070-44158092 ATGTGCCAGTCACTGTTCTGAGG - Intronic
1173660099 20:44727287-44727309 CTCTAGAAGGCACTGTTTTGTGG - Exonic
1173789630 20:45819536-45819558 ATGTGCCAGGCATTGTTCTAAGG - Intergenic
1173923197 20:46761377-46761399 CTGTGCCAGGCTCTGGTGTTGGG - Intergenic
1174060259 20:47827355-47827377 CTGTGCCAGGCACTGCGCTCAGG - Intergenic
1174071638 20:47904015-47904037 CTGTGCCAGGCACTGCGCTCAGG + Intergenic
1174086611 20:48013284-48013306 CTATGCCAGGCACTTTCTAGGGG - Intergenic
1174152411 20:48494620-48494642 CTGTGCCAGGCACTGCGCTCAGG - Intergenic
1174224470 20:48985736-48985758 GTGTGCCAGGCACTGTGCTAAGG + Intronic
1174424470 20:50422424-50422446 CTGTGCCAGGTACTGACTTACGG + Intergenic
1174523511 20:51153529-51153551 ATGTGCCAAGCACTGTGCTGAGG + Intergenic
1174622492 20:51886652-51886674 ATGTGCCTGGCACTGTCCTGGGG - Intergenic
1174634521 20:51987539-51987561 ATGTGCCAGGCACTGTTCTATGG + Intergenic
1174715686 20:52755670-52755692 CTGTGCCAGGCAATGCTTGAAGG + Intergenic
1174806614 20:53608881-53608903 ATGTGCCAGGCACCGTTTTAAGG - Intronic
1174929962 20:54802762-54802784 ATGTGCCAGGCATTGTGCTGGGG - Intergenic
1175172190 20:57088589-57088611 CTGTGGCAGCCTCTCTTTTGGGG - Intergenic
1175210670 20:57351946-57351968 CTGGGCCAGGCATTGTACTGTGG + Intronic
1175252073 20:57615825-57615847 ATTAGCCAGGCACTGTTTTGGGG - Intronic
1175280777 20:57802680-57802702 CTGTGCCAGGTACTGCTCTGGGG - Intergenic
1175291199 20:57876654-57876676 CTGTGCCAGATACAGTTCTGAGG - Intergenic
1175360048 20:58402600-58402622 CTGTGCTAGGCACTGGGATGTGG - Intronic
1175373479 20:58508714-58508736 ATGTGCCAGGCACTGTTCTAGGG + Intronic
1175376088 20:58524954-58524976 CTGTGCCAGGCTCTGGTCTTGGG - Intergenic
1175495518 20:59411563-59411585 CCGTGCGAGGTACTGTTGTGAGG + Intergenic
1175640720 20:60628030-60628052 ATGTGCCAGGCACTGTGCTAAGG - Intergenic
1176078160 20:63258538-63258560 CTGTGCCAGGCCTAGATTTGGGG + Intronic
1177848688 21:26321269-26321291 CTATGCCAGGCACTGCTTTGTGG + Intergenic
1178411899 21:32370909-32370931 ATGTGCCAGGCACTGTCCTAGGG + Intronic
1178437259 21:32570944-32570966 ATGTGGCAGGCATTGTTTTAGGG - Intergenic
1178618855 21:34157004-34157026 CTGAGCCAGGAGTTGTTTTGAGG + Intergenic
1178769135 21:35486133-35486155 ATGTGCCAGGCACTATGTTAAGG - Intronic
1178992861 21:37368604-37368626 AAGTGCCAGGCTCTGTTTTTAGG + Intronic
1179157600 21:38863557-38863579 CTGCCCCAGGCACTGGTCTGGGG + Intergenic
1179256534 21:39721337-39721359 CTGTGCCAGGTACTTTGTAGGGG - Intergenic
1179472305 21:41619864-41619886 GGGTGCCAGGCACTATTCTGGGG + Intergenic
1181361979 22:22344551-22344573 CTGTCCCAGGCCCTGCCTTGGGG + Intergenic
1181410518 22:22715257-22715279 CTGTGTCACCCAGTGTTTTGGGG - Intergenic
1181769401 22:25114351-25114373 GTGTGCCTGGCACTGTGCTGGGG - Intronic
1181914675 22:26270145-26270167 CTGTGCCAGGTTCTATTTTTGGG - Intronic
1182007961 22:26977227-26977249 CTGTGCCAGGCACTGTGATAAGG - Intergenic
1182025352 22:27114023-27114045 ATGTGCCAGGCCCTGTGTTAGGG + Intergenic
1182044804 22:27265968-27265990 CGATGCCAGGCTCTGTTTGGTGG - Intergenic
1182114337 22:27746694-27746716 CTGTGCCTGGCACTGTGCTCAGG + Intergenic
1182799711 22:33021894-33021916 ATGTGCTAGGCACTGTTTCTAGG - Intronic
1182836286 22:33344300-33344322 TTGTGCCAGACACTGATCTGGGG + Intronic
1182861115 22:33560250-33560272 CTGTGCCAGCCACTCTGTTAAGG - Intronic
1182966718 22:34528504-34528526 GTGTGCCAAGCACTGTATTAGGG + Intergenic
1183069688 22:35387437-35387459 CTGTGCCAGACACTGCTGTGGGG - Intronic
1183157695 22:36087834-36087856 ACGTGCCAGGCACTGTTCTAAGG + Intergenic
1183213680 22:36466083-36466105 AGGTACCTGGCACTGTTTTGAGG - Intergenic
1183247962 22:36708606-36708628 CTGTGTCAGGCCCTGTGCTGAGG + Intergenic
1183251979 22:36736844-36736866 TGGTGCCAGGCACTGTGCTGGGG - Intergenic
1183516739 22:38271261-38271283 ATGTGCCAGGCACTATGCTGGGG - Intronic
1184058696 22:42068776-42068798 CTGGGCCAGGCAGTGGCTTGAGG + Intronic
1184234580 22:43176221-43176243 ACGTGCCAAGCACTGTTCTGGGG + Intronic
1184289966 22:43493375-43493397 CTGGGCCATGCACTGTTCCGTGG - Intronic
1184377492 22:44123902-44123924 CTGTGCCAGGCACTGTGCCAGGG - Intronic
1184451339 22:44584489-44584511 TGGTGCCAGGCACTGTTCTGGGG - Intergenic
1184472580 22:44704131-44704153 ATGTGCTAAGCACTGTGTTGAGG - Intronic
1184477869 22:44731138-44731160 CTGTGCCAGGCACACCTGTGTGG + Intronic
1184877146 22:47283097-47283119 CCCTGCCAGGCACAGTTCTGGGG - Intergenic
1185275993 22:49950422-49950444 CTGGGCCAGGCTGTGTTATGGGG + Intergenic
1185297286 22:50060676-50060698 CTGTGACAGGCAGTGTTCTTGGG - Exonic
949121516 3:390306-390328 ATGTGTCAGGCACTGTTCTAAGG - Intronic
949202790 3:1399764-1399786 ATGTGCCAGGCACTGTGCTAGGG + Intronic
949305833 3:2639617-2639639 GTGTGCCAGGCACTATTCTCAGG - Intronic
949493976 3:4614428-4614450 CTGTGCCAGGATCTGTTTGAAGG + Intronic
949497339 3:4644926-4644948 CTGTGCCAGGCACTAGGTTTAGG - Intronic
949541692 3:5037482-5037504 CTGTGCCAGGCACTATGCTCAGG - Intergenic
949734937 3:7160918-7160940 GTGTCCCAGGCACTGTTCTAAGG - Intronic
949838415 3:8293821-8293843 CTGTGCCAGGCATTGTTCTGGGG - Intergenic
949866132 3:8549050-8549072 CTGTGCCAGGCACTGTCCCATGG + Intronic
950580892 3:13861402-13861424 ATGTGCCAGGCACTGTTCTAGGG + Intronic
950651735 3:14411437-14411459 ACGTGCCAGGCACTGTTAAGAGG - Intronic
950708835 3:14800947-14800969 CTGTGCCTGCCACTGTTTCAGGG + Intergenic
950914884 3:16634295-16634317 GTGTGCCAGGCACTGTGCTAAGG - Intronic
952176200 3:30866086-30866108 ATGTACCAGACACTGTTTTAAGG - Intronic
952180817 3:30914653-30914675 GTGTGCCAGGCACTGCTCTAAGG - Intergenic
952206682 3:31187363-31187385 GTATGCCAGGCACTGTGCTGAGG + Intergenic
952271716 3:31839359-31839381 ATGTGCCAGGCACTGCTCTCAGG + Intronic
952333130 3:32383012-32383034 ATGTGCCAGGCACTGTGCTGAGG + Intergenic
952512293 3:34069594-34069616 ATGTGTCAGGCACTGTGTTGGGG + Intergenic
952555943 3:34531321-34531343 CTGTGCCTGGCACTGCTTTGAGG - Intergenic
952681730 3:36101194-36101216 TTGGGCCAGGCACTGTTCTAGGG - Intergenic
952827898 3:37539249-37539271 TTGACCCAGGCTCTGTTTTGGGG - Intronic
953368418 3:42366762-42366784 ATGTGCCAGGCCCTGCTTTAAGG + Intergenic
953481502 3:43256125-43256147 CTGTGCCAGGCACTGTGAGGGGG + Intergenic
953693714 3:45141574-45141596 CTGTGCCAGCCACTCCTCTGAGG - Intronic
953698403 3:45177821-45177843 ATGGGTCAGGCACTGTTTTGAGG - Intergenic
954593039 3:51800612-51800634 ATGTGCCAGACACTGTTATAGGG + Intergenic
954700285 3:52447247-52447269 CTGTGTCAGGCCCTGTGTTGGGG + Intergenic
954945808 3:54423463-54423485 CTGTGCCAGGCACGGTACTAGGG - Intronic
955060960 3:55491046-55491068 AAGTGCCAGGCATTGTTCTGAGG - Intergenic
955102705 3:55867309-55867331 CTGTGCTAGGCACTGTGTGTGGG - Intronic
955376268 3:58399882-58399904 ATGTACCAGGCACTGTTCTAGGG + Intronic
955378070 3:58414658-58414680 CTCTGCCAGGCATTGTGCTGGGG - Intronic
955892726 3:63667010-63667032 ATGAGCCAGGCACTGTTCTAGGG + Intronic
956345797 3:68277058-68277080 ATGTGCCAGGCACTGTGCTAAGG + Intronic
956354221 3:68373106-68373128 ATGTGCCAGGCACTGTGTTAGGG - Intronic
956403481 3:68904602-68904624 TTGTCCCAGGCTCTGCTTTGGGG - Intronic
956897169 3:73674341-73674363 CAGTGCCAGGTACTGTTCTAAGG + Intergenic
957573184 3:81975342-81975364 CTGTGCCAGGCACTGCGCTTGGG + Intergenic
958962338 3:100522226-100522248 AGGTGCCAGGCAGTGGTTTGGGG + Intronic
959550405 3:107649511-107649533 ATGTGCCAGGGACTCTTTTCAGG - Intronic
959566672 3:107839538-107839560 ATGTGCCGGGCACTGTTGTAGGG - Intergenic
959855626 3:111153546-111153568 CTGTGTCAGGCACTATTCTAAGG - Intronic
960436711 3:117635216-117635238 CTGTGCCAGGAATTGATTTTAGG + Intergenic
960785425 3:121368693-121368715 CTGTGCCAAGGACTGGTCTGGGG + Intronic
960942563 3:122944142-122944164 CTGTGCCAGGCACTGGACTTGGG - Intronic
960997246 3:123348368-123348390 ATGTGCCAGGCACTATTCTGGGG + Intronic
961047373 3:123718877-123718899 CAGTGCCAGGCATTGTTCTGGGG - Intronic
961115217 3:124323456-124323478 GTGGGCCAGGCTCTGTGTTGGGG - Intronic
961270586 3:125684757-125684779 CAGTGCCAGGCATTGTTCTGGGG + Intergenic
961361520 3:126371027-126371049 ATGTGCCTGGTACTGTTCTGGGG + Intergenic
961519927 3:127461202-127461224 CTGTGCTAGGCCCTGTGCTGGGG + Intergenic
961621073 3:128225578-128225600 ATGTGCCAGGCACGGTGCTGGGG - Intronic
961635503 3:128330354-128330376 ATGTGGCAGGCACTGTGCTGAGG + Intronic
961637088 3:128340536-128340558 GTGTGCCAGGCACTGTTCTAGGG - Intronic
961802451 3:129462342-129462364 GTGTGCTAGGCACTGTTCTAAGG + Intronic
962036438 3:131656606-131656628 ATATGCCAAGCACTGTTTTAGGG + Intronic
962050701 3:131811781-131811803 TTGTGTCAGGCACTGTGTTAAGG + Intronic
962099122 3:132323336-132323358 ATGTTCCAGGCACTGTTTTGGGG + Intronic
962239849 3:133743231-133743253 ATGTGTCAGGCACTGTCCTGGGG - Intergenic
962266144 3:133945623-133945645 CGGTCCCAGCCACTGTTTTTCGG - Intronic
962629642 3:137263291-137263313 ATGTGCCAGGCTCTGTGTTGGGG - Intergenic
962745722 3:138396211-138396233 TTGTGCCAGGCACTGCACTGAGG + Intronic
964133453 3:153317179-153317201 GTATGCCAGGAATTGTTTTGAGG + Intergenic
964159862 3:153633996-153634018 CTGTGGCAGCCACATTTTTGGGG + Intergenic
964216408 3:154289396-154289418 ACGTGCCAGGCACTGTTCTAAGG + Intronic
964623476 3:158737460-158737482 GTGTGCCAGTCACTGTTCTAGGG - Intronic
964628399 3:158781550-158781572 CTGAGTTAAGCACTGTTTTGTGG - Intronic
964687723 3:159415809-159415831 ATGTGCCAGGCACTGTACTAGGG - Intronic
964704609 3:159604496-159604518 CTGTGCCAGGCACTGTGCCAGGG + Intronic
965756285 3:172030924-172030946 CTATGCCAGACACTAATTTGTGG - Intergenic
965798189 3:172463478-172463500 ATGTGTCAGGCACTGTTGAGAGG - Intergenic
966259419 3:177957101-177957123 CTGTGCCAAGCAATTTCTTGAGG - Intergenic
966414303 3:179673347-179673369 CTGTAGCAGGTACTGTTTTTGGG + Intronic
966414315 3:179673412-179673434 CTGTACCAGGTACTATTTTTAGG + Intronic
966431937 3:179841117-179841139 CTGTGCCAAGCAATGGGTTGTGG - Intronic
966742804 3:183249889-183249911 CTGTGACAGGCATTATTGTGAGG + Intronic
966775199 3:183537579-183537601 CTGGGTCAGGCTCTATTTTGGGG - Intronic
966883971 3:184364643-184364665 CTATGCTAGGCACTGTGCTGAGG - Intronic
966913826 3:184574130-184574152 ATGTGCCAGACACTGTTCTACGG - Intronic
967088328 3:186113764-186113786 CTGTGCTAGACTCTGTTTAGGGG + Intronic
967141893 3:186568494-186568516 CCATGCCAGGCACTGTTCTAAGG + Intronic
967473381 3:189888924-189888946 CTGTGCCAGGCACTGTGCTAGGG + Intronic
967888784 3:194350573-194350595 ATGTGCCAGGCGCTGTGTTAAGG - Intronic
967935071 3:194720720-194720742 CTGTGCCAGGCATTGTGCCGAGG - Intergenic
967935794 3:194726381-194726403 CTGTGCCAGACACTGTCCTGGGG - Intergenic
968976633 4:3825488-3825510 ATGTGGCAGGCCCTGTTTTAGGG - Intergenic
969040408 4:4290964-4290986 GTGTGCCAGACCCTGTTTTAAGG - Intronic
969124442 4:4936001-4936023 AGGTGCCAGGCACTGTTCTATGG - Intergenic
969394721 4:6912736-6912758 CTGTGCCAGGCACGATTTTAAGG + Intronic
969482424 4:7453822-7453844 TGGGGCCAGGCACTGTGTTGGGG + Intronic
969482468 4:7454034-7454056 TGGGGCCAGGCACTGTGTTGGGG + Intronic
970362191 4:15321204-15321226 CTGTGTCAGGCACTATTCTAAGG + Intergenic
970608450 4:17704100-17704122 CTGGGGCATGCACTGTTGTGTGG - Intronic
971309072 4:25508193-25508215 ATGTGCCAGGCACTAGTTTTTGG + Intergenic
971675745 4:29626402-29626424 CCATGCCAGGCACTGTTGTATGG - Intergenic
971750133 4:30636323-30636345 ATGTGCCAGGCACTATTCTGGGG + Intergenic
972277074 4:37567297-37567319 ATGTGCCAAGGACTGTTTTGGGG - Intronic
972293657 4:37715641-37715663 ATGTGCCAGGCACTTTTCTAAGG - Intergenic
972629138 4:40828521-40828543 CTGTGCCAGGCCATGTTCTGAGG + Intronic
973107430 4:46357570-46357592 ATGTGCCAGGCACTGTTCTAGGG + Intronic
973645128 4:52942639-52942661 CAGTGTCAGGCACTGTTTCAAGG - Intronic
973647876 4:52968200-52968222 GTGTGCCAGGCACTGTGCTAGGG + Intronic
973701795 4:53544755-53544777 ATGCGCCAGGCACTGTACTGGGG + Intronic
976008902 4:80463080-80463102 CTGCCCCAATCACTGTTTTGGGG - Intronic
976521990 4:86039406-86039428 CTGTGGCAGGCCCAGTGTTGGGG - Intronic
977096695 4:92754591-92754613 CTGTGTCAGGCGCTGATTTAAGG - Intronic
977324530 4:95557974-95557996 CTGTGCCAGGTAGAGTTTTAGGG - Intergenic
977565657 4:98577878-98577900 ATGTGCCGGGCACTGTGCTGAGG - Intronic
977661203 4:99588617-99588639 CTGCCCCAGGCACTGCTTTGAGG - Intronic
978182011 4:105809650-105809672 ATGTGCTAGGCACTGTTTTAAGG - Intronic
978189091 4:105893028-105893050 TTGTGCCAGGCATTGTGCTGGGG + Intronic
978198727 4:106000139-106000161 GTGTGCCAGGCAATGTGTTAAGG + Intronic
978358720 4:107905480-107905502 CTGTCCCAGGCACTATTCTAGGG + Intronic
978418081 4:108500184-108500206 CTCTGACAGGCTCTGATTTGAGG - Intergenic
979592771 4:122499191-122499213 ATGTGCCAGGCACTGGGTTAGGG + Intergenic
980190468 4:129518816-129518838 ATATGCCAGGCACTGTTTTAGGG + Intergenic
980283764 4:130756149-130756171 CTGTGGCAGGCCCAGTGTTGAGG + Intergenic
980562434 4:134495176-134495198 CTGGGCCAGGCAATATTTTATGG + Intergenic
980684522 4:136209292-136209314 ATGTGCCAGTCATTGTATTGTGG - Intergenic
980953814 4:139408292-139408314 CTGTGCCAGCCACTATTCTAGGG - Intronic
981135723 4:141208757-141208779 GTTTGCCTGCCACTGTTTTGTGG + Intronic
982090461 4:151875957-151875979 CTGTGCCAGGAACAGTTTCCCGG - Intergenic
982163233 4:152590918-152590940 ATGTGCCAGGTACTGTTCTAAGG + Intergenic
982564791 4:156972471-156972493 CTATGTCGGGCACTGTTTAGAGG + Intergenic
983916677 4:173300078-173300100 GTATGCCAAGCACTGTTTTCTGG + Intronic
984181935 4:176494465-176494487 CTGTGCCAGTCACTGAGTTTTGG + Intergenic
984929477 4:184834104-184834126 AAGTGCCAGGCACTGTATTGGGG - Intergenic
985924883 5:3008059-3008081 CAGTGCAAGGCATTGTTTTGTGG + Intergenic
986724568 5:10584679-10584701 CTGTGCCAGGCGCTGTTCTAGGG + Intronic
987270580 5:16304361-16304383 ATGTGCCAGGCATTGTCATGGGG + Intergenic
987383515 5:17307903-17307925 ATGTGCCAGGCACTCATTTAGGG + Intergenic
987600571 5:20063680-20063702 GAGTACCAGGCACTGTCTTGAGG + Intronic
988087598 5:26491203-26491225 TTGTGCCAGTCACTGAGTTGTGG - Intergenic
988367016 5:30313327-30313349 CTGTGCCAGTCACTGAGTTTTGG - Intergenic
988412047 5:30898975-30898997 ATGTGCCAGGCACTGTGGTAGGG + Intergenic
988986108 5:36620661-36620683 GTGTGCCAGGAACTGTTTGAGGG + Intronic
989363658 5:40631952-40631974 ATGTGCCAGGCACTCTTCTGAGG + Intergenic
990943587 5:61228289-61228311 ATGTGCCAGGCACTGTGGTAGGG - Intergenic
992006013 5:72478208-72478230 CTGTGCCAGGCCTTGTGTGGGGG + Intronic
992441288 5:76799865-76799887 ATGTGCCAGGTACTGTGTTACGG + Intergenic
992557295 5:77916181-77916203 CTGTGGCAGGCACCTTTCTGGGG - Intergenic
992771803 5:80055590-80055612 GTGTGCTAGGCACTGTTTTCAGG - Intronic
993038623 5:82786484-82786506 ATGTGCCAAGCACTGTTTTAAGG + Intergenic
993082765 5:83322400-83322422 CTGTGCCAGGCAATATGCTGTGG + Intronic
993906753 5:93632044-93632066 GTATGCCAGGCACTGTTTCTTGG + Intronic
994432497 5:99685447-99685469 CTGCGACAGGCACTGTCTAGGGG - Intergenic
994786258 5:104168246-104168268 CTGTGCAAGTCACTGGATTGTGG - Intergenic
995275574 5:110274169-110274191 CAGAGCCAGGCTCTGTCTTGGGG - Intergenic
995601392 5:113800848-113800870 ATGTGCCAGGCACTGGTATAAGG + Intergenic
995755245 5:115496475-115496497 ATGTGCCAGGCTCTCTTCTGGGG - Intergenic
995814625 5:116153562-116153584 ATGTGCCAGGTATTGTTCTGTGG + Intronic
996330659 5:122324994-122325016 CTGAGCCAGGCCTTGTTCTGAGG - Intronic
996527441 5:124493739-124493761 CTATGTCAGGCACTTCTTTGGGG + Intergenic
996918340 5:128736877-128736899 CTGTGCCAGGCACTGTAACTTGG - Intronic
997019981 5:129988579-129988601 ATGTGCTAGGCTCTGTTTTAGGG - Intronic
997276342 5:132595301-132595323 ATGTGCCAGGCACTGTTCTAAGG - Intronic
997443737 5:133926579-133926601 CTGTGCCAGGAACAGTGGTGGGG - Intergenic
997928599 5:138053661-138053683 CAGTGCCTGGCACTTTTTTTGGG - Intergenic
997929947 5:138064292-138064314 CCAGGCCAGGCACTGTGTTGAGG + Intergenic
998425357 5:142022136-142022158 CTGTGCCGGGCACTGTTCTAAGG - Intergenic
998685430 5:144518547-144518569 CTGTGTCAGACACTGTTCTAAGG + Intergenic
999042690 5:148432595-148432617 GTGTGTCAGGCACTGTTCTAAGG - Intronic
999099316 5:149009528-149009550 CTGTGCCAGGCACTGAGCTAGGG - Intronic
999102207 5:149036029-149036051 CTGTGCCAGGCACCATTCTAAGG + Intronic
999110385 5:149115438-149115460 CTGTGCCAGGCACCATTCTGAGG + Intergenic
999114526 5:149150967-149150989 ATGTGCCATGCACTGTTTTAAGG - Intronic
999265856 5:150266485-150266507 CTGTGCCAAGCACTGTGCAGAGG + Intronic
999373802 5:151072474-151072496 CTGCCCCAGGAATTGTTTTGGGG - Intronic
999497555 5:152114837-152114859 TTGTTCAAGTCACTGTTTTGGGG - Intergenic
999584814 5:153078574-153078596 ATGTGCCAGGCACTCTGTTAGGG - Intergenic
999743751 5:154576376-154576398 GTGTGCCAGGCACTGGGTTAGGG - Intergenic
999862534 5:155663877-155663899 CTGTATCAGGCACTGTTGTGAGG - Intergenic
1000367932 5:160508250-160508272 ATGTGCTAATCACTGTTTTGGGG + Intergenic
1000702102 5:164465259-164465281 CTGTGCCAGGCACCACTGTGGGG - Intergenic
1000810143 5:165851358-165851380 CTGTGCCAGGCATTGTTTAGGGG + Intergenic
1001030189 5:168257060-168257082 TTGTGCCAGGCATTGTTGTAGGG + Intronic
1001572738 5:172741190-172741212 ATGTGCCGGGCACTATTCTGAGG + Intergenic
1001581335 5:172800527-172800549 GGGTGCCAGGCACTGTTTCTAGG + Intergenic
1001587005 5:172839714-172839736 TAGTGCCAGGCACTGTTGTAAGG + Intronic
1001628868 5:173159938-173159960 CTGGGCCAGGCTCTCTTTGGTGG - Exonic
1001685865 5:173594632-173594654 TTGTGCCAGGAAATGTTTTAAGG + Intergenic
1001781876 5:174375807-174375829 CTGTGCCAGACACTGTGCTAAGG + Intergenic
1001829440 5:174773332-174773354 CTGTGCCAGGAACTGATCTGAGG + Intergenic
1002021738 5:176368006-176368028 ATGTGCCAGGCATTGTGCTGAGG + Intronic
1002085051 5:176769431-176769453 ATGTGCCAGGCACTCTTGTGGGG + Intergenic
1002602905 5:180364176-180364198 CTGGGCCTGGCAGTGTTTAGAGG + Intergenic
1002618948 5:180472873-180472895 TTGTGCCATGCATTGTTCTGGGG - Intergenic
1002759063 6:187813-187835 CTGGGCCAGGCAGTCTCTTGAGG + Intergenic
1002781562 6:370593-370615 CTGTGCCAAGCACTGCTCTGGGG - Intergenic
1003050093 6:2772431-2772453 GTGTGCCAGGCACTGTGCTGGGG - Intronic
1003269237 6:4592668-4592690 CTGGGCCAGGAACTGTTTGAAGG - Intergenic
1003515972 6:6818959-6818981 GGGTGCCAGGCACTGTTCTGAGG - Intergenic
1004082353 6:12407140-12407162 ATGTCCCAGGCACTGTTTCCAGG - Intergenic
1004171502 6:13299054-13299076 CTGTGCCAGACACTGGTCTAAGG + Intronic
1004174985 6:13331683-13331705 GTGTGCCAGGCGCTGTTCTATGG - Intergenic
1004401217 6:15290633-15290655 CAGCGCAAGGCACTGTCTTGGGG - Intronic
1004464500 6:15871984-15872006 GTGTGCCAGGCACTATTCTAAGG + Intergenic
1004641122 6:17516290-17516312 CTGTGCCAGGCACTATACTAGGG - Intronic
1006375040 6:33667367-33667389 CTGTGCCAGGCACTGTTTTGGGG + Intronic
1006525488 6:34601226-34601248 ATGCGCCAGGCACTGTGCTGAGG - Intronic
1006643326 6:35499502-35499524 ATGTGCCAGGCACTGTTCTCAGG - Intronic
1006967982 6:38009246-38009268 TGATGCCAGGTACTGTTTTGTGG + Intronic
1007122732 6:39396735-39396757 ATGTGCCAGGCACTGTGCTGGGG - Intronic
1007257075 6:40536911-40536933 ATGTACCAGTCACTGTTTTCAGG + Intronic
1007304470 6:40893309-40893331 GTGTTCCTGGCACTGTTCTGGGG - Intergenic
1007313444 6:40964877-40964899 TTGTGCCAGGCACTGTTTAAAGG - Intergenic
1007410469 6:41658403-41658425 CTGTTCCAAGGACTGTTCTGGGG + Intergenic
1007493419 6:42242279-42242301 ATGTGCCAGGCATTGTGTTAGGG - Intronic
1008013649 6:46493177-46493199 GTGTGCCAGGCACTGTGCTTAGG - Intergenic
1008051448 6:46903854-46903876 CTGTGCTAGTCACTGTGCTGTGG + Intronic
1008088416 6:47268284-47268306 ATGTTCCAGGCACTGTTCTATGG - Intronic
1008355718 6:50550571-50550593 CTCTGCCAGGGACTGTGTTTGGG - Intergenic
1008794681 6:55288525-55288547 ATGTGCCAGGCATTGTTCTAGGG - Intergenic
1009425269 6:63506883-63506905 TTGTCTCAGGCTCTGTTTTGAGG - Intergenic
1009655932 6:66544568-66544590 CTCTGCCAGGCATTGTTATCAGG - Intergenic
1009857257 6:69280718-69280740 GTGTGCCAGGCATTGTGCTGAGG - Intronic
1010329023 6:74600228-74600250 ATGTGTCAGACACTGTTTTTGGG - Intergenic
1011335105 6:86251539-86251561 ATGAGCCAGGCCCTGTGTTGGGG + Intergenic
1011443901 6:87417179-87417201 CTGCACCAGGAACTGTTTTCAGG - Intronic
1011471682 6:87714314-87714336 GTGTGCCAGGCACTGTTCTGAGG + Intergenic
1011610321 6:89144648-89144670 CTGTGCTAGGCACTGTTCCAAGG - Intergenic
1011749347 6:90439582-90439604 CTGTGTCAGGCACTGCATTAGGG - Intergenic
1012347714 6:98212085-98212107 CTGTTCCAGAGAGTGTTTTGAGG + Intergenic
1012840931 6:104327974-104327996 TTGTCCCAGGCACTATTTTTAGG - Intergenic
1012864874 6:104606845-104606867 ATGTGCAAGGCACTGTCCTGTGG - Intergenic
1013015962 6:106160844-106160866 CTGTGCCAGGACATGTCTTGTGG + Intergenic
1013033408 6:106358253-106358275 ATGTGCCAGGCCCTGACTTGGGG - Intergenic
1013054827 6:106573542-106573564 ATGTGCCAGGCACTGTTTTAGGG + Intronic
1014032506 6:116721586-116721608 CTATGTCAGGCACTGTTCTTAGG + Intronic
1014510292 6:122312527-122312549 ATGTGCCAGTCACTGTGTTTAGG - Intergenic
1014937804 6:127404429-127404451 ATGTGTCAGGCACTGTTCTAAGG - Intergenic
1015941397 6:138456020-138456042 CTGTGCCAGGCACTGTGCTAAGG + Intronic
1016358314 6:143241585-143241607 GTGTGTCAGGCACTGTTCTAAGG + Intronic
1016651244 6:146463464-146463486 ATGTGCCAGACACTGTGCTGAGG - Intergenic
1016741299 6:147532089-147532111 ATGTGCCAGTCACTGTTCTAGGG - Intronic
1017283677 6:152650428-152650450 ATGGGCCAGGCAATGTTTTTTGG + Intergenic
1017829894 6:158116660-158116682 CTGTGTCAGGCAATTTTTTCGGG + Intronic
1018286036 6:162238807-162238829 ATGTGCCAGGCACAGCTGTGTGG + Intronic
1018569127 6:165188261-165188283 ATGTGCCAGGCACTGGGCTGGGG + Intergenic
1018796521 6:167189713-167189735 CTGTGGCAGGCATTGTTTTAGGG + Intronic
1018819799 6:167365404-167365426 CTGTGGCAGGCATTGTTTTAGGG - Intronic
1019135487 6:169905123-169905145 ATGTGCCAGGCAACCTTTTGAGG - Intergenic
1019399606 7:844729-844751 CTGCGCCAGGCACTGTTCATGGG + Intronic
1019860022 7:3649606-3649628 GAGTGCCAGGCACTGTTTTAAGG + Intronic
1021088319 7:16450472-16450494 CTGTGCCAGGCTTTGCTTCGTGG - Intergenic
1021392828 7:20115393-20115415 ATTTGCCAGGCACTATTTTAAGG + Intergenic
1021402945 7:20230866-20230888 GTGTGCCAGGCACTGTTTTAGGG - Intergenic
1021978925 7:26035910-26035932 CCATGCCAGGCACTGTTTCCTGG - Intergenic
1022226866 7:28372006-28372028 GTGTGCCAGGCTCTGTTCTGGGG + Intronic
1022331869 7:29387150-29387172 CTGTGCCAGGCAGAGTCCTGAGG - Intronic
1022939087 7:35214089-35214111 ATGTGCCAGACACTATTTTAGGG - Intronic
1023367270 7:39476214-39476236 TTGGGCCAGGCACTGTTTTGGGG - Intronic
1023938743 7:44757032-44757054 CTGTCCCAGGCACTGTGGGGAGG - Exonic
1024633832 7:51270419-51270441 ACGTGCCAGGCACTGTTCTCAGG + Intronic
1024977785 7:55129893-55129915 CTTTGCCAGCCCCTGTTTTAGGG - Intronic
1024984497 7:55183519-55183541 CTGTGCAACCCACTGTCTTGGGG + Intronic
1025008660 7:55376828-55376850 ATGTGCCAGGCACTGTTATTGGG - Intronic
1026151176 7:67789252-67789274 CTGTTCCAGGCACTGTTCCTTGG + Intergenic
1026198075 7:68190183-68190205 CTGTGCCAGGCTAATTTTTGTGG + Intergenic
1026256744 7:68718795-68718817 ATGTGCCAGGCCCTATGTTGAGG - Intergenic
1027057860 7:75062610-75062632 ATGAGCCAGGCACTATTCTGGGG - Intronic
1027200959 7:76063637-76063659 CTTTACCAGGCCCTGCTTTGAGG + Intronic
1027579408 7:79975589-79975611 ATATGCCAGGCACTGTTGTAGGG + Intergenic
1028025474 7:85832250-85832272 CTTTGACAGGGACTCTTTTGTGG + Intergenic
1028600811 7:92598446-92598468 ATGTGCCAGGCACTGTCCTTAGG - Intergenic
1029557370 7:101279732-101279754 CTGTGCCTGGCACTACTCTGTGG + Intergenic
1030023262 7:105296752-105296774 ATGTGCCAGGTACTGTTGTGGGG + Intronic
1030323635 7:108196154-108196176 TTGTGCCAGACACTGTGCTGGGG - Intronic
1030764402 7:113390955-113390977 CTGTGTCAGGCACTGGGTAGAGG + Intergenic
1030876199 7:114816524-114816546 ATGTGCCAGGCACTGTTTTAGGG - Intergenic
1031076178 7:117214844-117214866 TTGTGCCAGGCATTGGGTTGAGG + Intronic
1031669946 7:124530074-124530096 CTGTGACAGGCAGGGTTTGGAGG - Intergenic
1031934629 7:127724104-127724126 TTGTGCCAGATACTGTGTTGGGG + Intronic
1031976568 7:128097446-128097468 CTGCTCCAGGCACTGTTCTAAGG + Intergenic
1032156668 7:129475264-129475286 CTGTGCAAGGAAATGCTTTGGGG + Intronic
1032411455 7:131696067-131696089 CTGTGTCAGGCTCTGTTTTGGGG + Intergenic
1032411559 7:131697164-131697186 CTGAGCCAGGGACTGTTCTAGGG + Intergenic
1032420762 7:131777340-131777362 CTGTGTCATGCACTGTTCTAAGG - Intergenic
1032497402 7:132373014-132373036 ATGTGCCAGGCACTTTTCTGAGG + Intronic
1033046036 7:137962804-137962826 TTGTGCCAGGTACTGTGTTCTGG - Intronic
1033271647 7:139937858-139937880 CTGTGCCAGGGGCTGTCTGGAGG + Intronic
1033586647 7:142779389-142779411 CTGAGCCAAGCACTGTCTTCAGG - Intergenic
1033954793 7:146833503-146833525 CTGTGCCTGGCAGTGTTTTTAGG + Intronic
1034662210 7:152781432-152781454 ATGTGCCAGGCACTGTGCCGGGG + Intronic
1034692251 7:153023214-153023236 CTGTGCCAGGCACTGTTTAAGGG + Intergenic
1035649490 8:1254196-1254218 CTGTGGGAGGCACTGATTTCAGG - Intergenic
1035678713 8:1472002-1472024 CTGTGCCAGGCACTACGTTAAGG + Intergenic
1035898966 8:3436451-3436473 GTGTGCCAGGCACTATTTTGAGG - Intronic
1036036325 8:5023349-5023371 CTGTGCCAATCACTGAGTTGTGG + Intergenic
1036233425 8:7018947-7018969 CTGGGCCAGGAACTGGTCTGAGG + Intergenic
1036635810 8:10548836-10548858 GTGTGTCAGGCACTGTGCTGGGG + Intronic
1037105662 8:15104200-15104222 CTGTGCAAGGGATTGTTTTGAGG - Intronic
1037560601 8:20071221-20071243 CTGGGCCTGGTACTGTTCTGTGG + Intergenic
1037750884 8:21681591-21681613 CTCTGCCAGGCACTGTTCTAGGG + Intergenic
1037864610 8:22433273-22433295 GTGTGCCAGGCACTGTGTTAAGG - Intronic
1037944944 8:22983149-22983171 CTGACACAGGCACTGTCTTGAGG + Intronic
1038941543 8:32311178-32311200 ATGTTCCAGGCACTGTTTTAGGG + Intronic
1038970979 8:32635219-32635241 CTGTGACAGGCATTGTGCTGGGG - Intronic
1039007918 8:33061358-33061380 CTGTGGCATGCATTGTTCTGAGG - Intergenic
1039835562 8:41253722-41253744 ATGTGCAAGGCACTGTACTGAGG + Intergenic
1039969166 8:42306957-42306979 CTGTGTCAGGCACTGTGCTCAGG + Intronic
1041361732 8:57061828-57061850 GTGTGCCAGGCACTGTGTTAAGG - Intergenic
1041390459 8:57343122-57343144 ATGTGCCAGGCCCTGTGCTGGGG - Intergenic
1041870009 8:62622734-62622756 CTGTGACAGGCCCTGTTAAGAGG - Intronic
1041890898 8:62867374-62867396 CTGTGCTAGGCACTATGTTGAGG - Intronic
1042183664 8:66115855-66115877 ATGTGCCAGGCACTGTACTAAGG - Intergenic
1042656705 8:71106470-71106492 CTGTGTCATTCACTGCTTTGGGG + Intergenic
1042769985 8:72369020-72369042 ATGTGCCAGGCACTGTTCTAAGG - Intergenic
1042903165 8:73747463-73747485 CTGTGCAACGCACGGTTTAGCGG + Intronic
1042965125 8:74342961-74342983 GTGTGCCAGGAAATGTTTTAAGG - Intronic
1043340824 8:79236908-79236930 CTGTGCCTGGCACTGTGCTAGGG + Intergenic
1043482090 8:80664061-80664083 ATGTGCCAGGCACCATTTTGAGG + Intronic
1043969956 8:86517819-86517841 GTGTGTCAGGCACTGTTCTAAGG - Intronic
1043989872 8:86739419-86739441 ATGTGCCAGGCACTGTTCCATGG - Intronic
1044910461 8:97053222-97053244 AAGTGCCAGGCAGTGTTTTGAGG + Intronic
1044989530 8:97783153-97783175 CTGTGCCAGACACTGTTCACAGG + Intronic
1045135842 8:99217221-99217243 GTGTGCCTGGCACTGTTCTAAGG + Intronic
1045334464 8:101186375-101186397 GTGTGCCATGCACTGATGTGTGG - Intronic
1045506100 8:102779828-102779850 CTGTGGCAGGGACTGTCTTTCGG - Intergenic
1045658849 8:104414936-104414958 CTTTGTCAAGCACTGCTTTGGGG + Intronic
1046126517 8:109915955-109915977 CTGTGCCAGGCTCTTTTTTGTGG - Intergenic
1046647343 8:116800726-116800748 CTATGCCAGACACTGTTTTAGGG + Intronic
1047780116 8:128104407-128104429 CTGTGCCTGGGACTGTCTGGTGG + Intergenic
1047784721 8:128142602-128142624 TTGTGCCAGGCACTGTGCTTAGG - Intergenic
1047819837 8:128506756-128506778 CTGTGCCAAGCACTATGCTGGGG - Intergenic
1048031425 8:130636722-130636744 ATGTGCCAGGCCCTGTTCTTGGG - Intergenic
1048062255 8:130932433-130932455 CTGTGGCAGGCCCAGTGTTGGGG + Intronic
1048242974 8:132762564-132762586 ATGTACCAGGCACTGTTCTAAGG + Intergenic
1048269413 8:133016772-133016794 CAGTGCCAAGTACTGTTTTCAGG - Intronic
1048366825 8:133745601-133745623 CTGTGCCAGGCACCATGCTGAGG - Intergenic
1048384053 8:133894657-133894679 ATGTGCCAGGCAGTGTTATGAGG - Intergenic
1048426206 8:134326159-134326181 ATGTGCCAGGCACTGTATTTTGG - Intergenic
1048502723 8:134993519-134993541 ACGTGCCAGGCACTGTTCTATGG + Intergenic
1049093688 8:140535300-140535322 CTGTGCCAGGCGCTGGGGTGGGG - Intronic
1049230051 8:141477268-141477290 GTGTGCCAGGCACCATTCTGGGG - Intergenic
1050267190 9:3903616-3903638 ATATGCCAGGCACTGTTCTAGGG + Intronic
1050684768 9:8155574-8155596 ATGTGCCAGGCCCTGTGCTGGGG - Intergenic
1050880186 9:10689433-10689455 ATATGCCAGGCATTGTTCTGAGG - Intergenic
1051098404 9:13493248-13493270 ATGTGCCAGACACTCTTATGTGG + Intergenic
1051365130 9:16316561-16316583 CTGTGCCAGGAACTGTTCTCAGG - Intergenic
1051419436 9:16875156-16875178 TTGTGCCTGGCATTGTTTTATGG - Intergenic
1051437116 9:17044625-17044647 CTGCGGCAGGCACTGTTCTAAGG + Intergenic
1051456565 9:17265518-17265540 CTCTGCCAGGCTTTGGTTTGAGG + Intronic
1051560419 9:18435349-18435371 ATGTGCCAGACACTGCTCTGGGG + Intergenic
1052170526 9:25390116-25390138 CCATGCCAGGCCCTGTTTTAAGG + Intergenic
1053114825 9:35490917-35490939 ATGTGCCAGGCACCGTGCTGGGG - Intronic
1053268057 9:36730353-36730375 CTGTGCCAGGCACAGGGTTCTGG + Intergenic
1053321804 9:37105263-37105285 CTGAGCCAGGTCCTATTTTGGGG + Intergenic
1054745543 9:68850618-68850640 CAGTGCTAAGCACTGTTTTGGGG - Intronic
1055083775 9:72293334-72293356 CTGTGTCAGGCACTGGGTTTAGG + Intergenic
1055759560 9:79592021-79592043 CTTTGCCAGGCAGCCTTTTGTGG + Intronic
1056991743 9:91419673-91419695 ATGTGCCAGGCACAGTGTTGAGG - Intronic
1057396278 9:94683212-94683234 CTTTGCCAGCCACTGTTCTTGGG - Intergenic
1057723521 9:97552517-97552539 ATGTGCCAGGCACCTTTCTGGGG - Intronic
1057731545 9:97613360-97613382 ATGTGGCAGGCACTGTTCTAGGG - Intronic
1058100040 9:100908988-100909010 TTGTGCCCAGCACTGTTCTGAGG - Intergenic
1058167690 9:101638641-101638663 ATGTGCCAGGCACTGTTGAATGG + Intronic
1058434043 9:104945839-104945861 CTATGCCAGCAACTGTTTAGGGG - Intergenic
1058486914 9:105450856-105450878 GTATGCTAGGCACTGTTTAGTGG - Intronic
1058652796 9:107192538-107192560 ATGTGCTAGGCACTGTTCTAAGG + Intergenic
1059143615 9:111877218-111877240 ATGTGATAGGCACTGTTTTGAGG - Intergenic
1059472009 9:114512390-114512412 GTGTGCCAGGCACTGTGTGTGGG + Intergenic
1059652077 9:116324373-116324395 CTATGCTGGGCACTGTTTTAAGG - Intronic
1059688707 9:116662818-116662840 TTGTCCAAGGCACTGTTGTGAGG - Intronic
1059948670 9:119439221-119439243 ATGTGCCAGGCACAGTTCTAGGG - Intergenic
1059954456 9:119501163-119501185 CTTTGCCAGGCACTGTGCTATGG - Intronic
1059973261 9:119689464-119689486 CTGTGCCAGGGACTATATAGAGG - Intergenic
1060016119 9:120087926-120087948 CTGTGCCAGGTACTGTAGTGAGG + Intergenic
1060170867 9:121459870-121459892 CTGTGCTAGGCATTGTGTTAGGG - Intergenic
1060195268 9:121619533-121619555 ATGTATCAGGCACAGTTTTGGGG + Intronic
1060215632 9:121736796-121736818 CTGTGCCAGGCTCTGGTTCGAGG + Intronic
1060290052 9:122293727-122293749 ATGTGCCAGGCTCTGTGCTGGGG + Intronic
1060433157 9:123568384-123568406 GTGTGCCAGGCACTGTGCTAGGG - Intronic
1060607750 9:124932603-124932625 ATGTGCCAGGCTGTGTTTTAGGG - Intronic
1060855712 9:126914179-126914201 CTGTGCCAGGCACGGTGAGGTGG - Intergenic
1061017947 9:127993516-127993538 ATGTGCCAGGCCCTGGGTTGGGG - Intergenic
1061087417 9:128407205-128407227 CTGGGTCAGGCTCTGTTCTGAGG + Intergenic
1061192095 9:129087970-129087992 CTGTGCCAGGCTGTGTGCTGGGG + Intronic
1061281628 9:129601011-129601033 CTGTGGCAGGCTCTGTGTTAGGG + Intergenic
1061389859 9:130311443-130311465 GTGTGCCAGGCCCTGTGCTGGGG + Intronic
1061455294 9:130693014-130693036 GTGTGCCAGGCGCTGTTCTAAGG - Intergenic
1061527382 9:131177890-131177912 ATGTGCCAGGCTCTGTGTTAGGG - Intronic
1061707019 9:132461114-132461136 TTGTGCCAGGCACTGTGCGGAGG - Intronic
1061724492 9:132574516-132574538 CTGTGCTTCGCACTCTTTTGCGG - Intergenic
1062606476 9:137350878-137350900 CTCTGCCAGGCTCTGCTCTGGGG + Intronic
1186606327 X:11096603-11096625 CTATGCTAGACACTTTTTTGGGG - Intergenic
1186831562 X:13395570-13395592 ATGTGCCAGGCACTGTAATCAGG + Intergenic
1187025548 X:15432094-15432116 ATGTACCAGGCACTATTTTAGGG + Intronic
1187144945 X:16628942-16628964 CTGTGCCAGGCACTGTTCTAAGG + Intronic
1187238738 X:17493523-17493545 ATATGCCAGGCACTGTGCTGGGG - Intronic
1187387447 X:18861423-18861445 CTGTGCGAGACTCTGTCTTGAGG + Intergenic
1187433007 X:19241842-19241864 GTGTGCCAGGCACTATTTGGAGG + Intergenic
1187553440 X:20328482-20328504 CTGTGCCAGGCACTCTTCAAAGG - Intergenic
1187786403 X:22892401-22892423 TTGTGCCAGGCATTGTGTTAAGG + Intergenic
1187931153 X:24294674-24294696 CTGTGCCAGTCACTGAATTTTGG + Intergenic
1187938337 X:24357508-24357530 ATGTGCCAGACATTGTTTTATGG + Intergenic
1188404341 X:29788224-29788246 ATGTACCAGGCACTCTTTTAGGG + Intronic
1189291257 X:39887609-39887631 CTGTGCCAGCCACAGATTGGGGG + Intergenic
1189316101 X:40057650-40057672 CTGTGCCAGGCACTGAGCTAAGG - Intronic
1189899746 X:45693846-45693868 ATGTGCCAGGCACTTTTCTAGGG + Intergenic
1190380844 X:49838488-49838510 GTGTGCCAGGCACTGTTCCAAGG - Intergenic
1191666025 X:63703596-63703618 ATGTACCAGGCACTGTGCTGGGG + Intronic
1191681561 X:63846007-63846029 GTGTGTCAGGCACTGTTTTAAGG + Intergenic
1191893515 X:65969140-65969162 CTGTGCCAGGCACTGTTCCCAGG + Intergenic
1192054940 X:67763804-67763826 CTGTGCCAGGCCCTGTTTCAGGG + Intergenic
1192090070 X:68144793-68144815 CTGTGCCAAGCCCTGTTTCAAGG + Intronic
1192201746 X:69070745-69070767 ATGTGCCAGACACTGTTCTGGGG + Intergenic
1192205302 X:69091838-69091860 CTGTGCCAAGCACTGTTTCAAGG + Intergenic
1192331152 X:70176260-70176282 GTTTGCCAGGCACTGTGTTTAGG - Intergenic
1192357162 X:70415097-70415119 GTGTGCCAGGCACTGCTATAAGG - Intronic
1192848396 X:74928422-74928444 ATGTGCCAAGCAGTGTTCTGAGG - Intergenic
1192927114 X:75766982-75767004 CAATACCAGGCACTGGTTTGTGG + Intergenic
1194499520 X:94663010-94663032 TTGTGCAAGGGAGTGTTTTGTGG + Intergenic
1194934452 X:99931466-99931488 CTGTGCCAGGCACTATGTTAAGG + Intergenic
1194973658 X:100371777-100371799 TTGTGCCAGGAGCTGTTTTCAGG - Intronic
1195083234 X:101390483-101390505 ATGTGGCAGGCACTGTTCCGGGG - Intronic
1195555356 X:106215281-106215303 TTGTATCAGGCTCTGTTTTGTGG + Intergenic
1195616783 X:106918675-106918697 AGGTGCCAGGCACTGTGCTGAGG - Intronic
1196013814 X:110916272-110916294 CTATGCCAGGCACTGTGCTATGG + Intergenic
1196126688 X:112108947-112108969 CTGTGGCAGGCCCAGTATTGAGG + Intergenic
1197764023 X:130047784-130047806 ATGTGCCAGGCACTGGGTTTAGG + Intronic
1197928670 X:131673224-131673246 CTGTGCCATGTACTGTCCTGAGG + Intergenic
1198033059 X:132774132-132774154 GTGTTCCAGACACTGTTTTAAGG + Intronic
1199681729 X:150229411-150229433 CTGTGCCAAGCCCTGTGCTGAGG - Intergenic
1199935239 X:152567126-152567148 ATTTGCAAGGAACTGTTTTGAGG - Intergenic
1199971494 X:152865201-152865223 CTGGACCAGGCACTGCTCTGAGG + Intronic
1200094649 X:153651564-153651586 CTGTGCCACACACTGTCCTGGGG + Intergenic
1200164542 X:154027092-154027114 CTGTGTCCGGCCCAGTTTTGGGG - Intronic
1200327776 X:155260575-155260597 CCAGGCCAGGCACTGTTTTGTGG - Exonic
1201186174 Y:11405175-11405197 CTCTGCCAGGCTCTGTTATCAGG + Intergenic