ID: 1006375582

View in Genome Browser
Species Human (GRCh38)
Location 6:33670022-33670044
Sequence GAGATGAGAAGAGCCAGCCT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 378
Summary {0: 1, 1: 0, 2: 2, 3: 39, 4: 336}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1006375582 Original CRISPR GAGATGAGAAGAGCCAGCCT TGG (reversed) Intronic
900407600 1:2499361-2499383 GACGGGAGGAGAGCCAGCCTGGG + Intronic
900878144 1:5360752-5360774 GAGATGAGCAGAGGTGGCCTTGG - Intergenic
901251263 1:7782299-7782321 GAGATGAGAGGCGCCTGCCGCGG - Intergenic
901789948 1:11648838-11648860 GAGGTAACAAGAGTCAGCCTCGG + Intronic
902203795 1:14852661-14852683 AAGATGACAAGTGCAAGCCTTGG + Intronic
902332084 1:15735654-15735676 GCGATGAGAAGAGTGTGCCTAGG - Intergenic
902547423 1:17198804-17198826 GAGATGGGAAAAGCCAGCTGGGG + Intergenic
902691728 1:18114058-18114080 GTGATGACCAGTGCCAGCCTTGG + Intronic
902796688 1:18805011-18805033 GAGAGGAGAGAAGCCAGCCCTGG - Intergenic
903128782 1:21264879-21264901 GAGAAGAGACCAGCCAGCCATGG - Intronic
903664116 1:24996226-24996248 GGGGAGAGAAGGGCCAGCCTGGG - Intergenic
904434777 1:30487279-30487301 GAGCTGAGAAGAGCCTGGCCTGG - Intergenic
904462272 1:30687084-30687106 GAGATCTGAAGACCCAGCCCTGG - Intergenic
904496142 1:30887844-30887866 GAGAAGAGCAGGGCCTGCCTTGG - Intronic
905746852 1:40425440-40425462 GAGATGGGAAGAGCTGACCTAGG + Intergenic
905934156 1:41810512-41810534 AAGAGGAGAAGCACCAGCCTTGG + Intronic
906057158 1:42926421-42926443 GAGAGGGGAAGGGCCAGTCTGGG - Exonic
907414618 1:54305669-54305691 GAGCTCAGAAGTACCAGCCTGGG - Intronic
907520250 1:55019307-55019329 GAGATGAGAAACCCCAGGCTTGG - Intergenic
907626189 1:56032438-56032460 GAGATGGTAAGAGCCAGATTAGG + Intergenic
907646772 1:56252225-56252247 GAGTTGAGAAGAGTCAGCAGGGG + Intergenic
908786972 1:67744742-67744764 CAGATGGGAAGAGCGAGCTTTGG + Intronic
915270795 1:154751866-154751888 CAGATGAGAGGAGCCTGCCAGGG + Intronic
915930260 1:160056195-160056217 GAGATGAGCACAGTGAGCCTGGG - Intronic
915937109 1:160096072-160096094 GAGATGAGAAGGGGCAGCTGGGG - Intronic
915943743 1:160135371-160135393 GAGAGGCGAGGAGCCAGGCTTGG + Intronic
917968022 1:180190697-180190719 AAGATGGGGAGAGTCAGCCTTGG + Intronic
919823800 1:201489649-201489671 TAGATGAGAAAATCCAGCCCAGG - Intronic
921199629 1:212792396-212792418 GAGATGCGCAGCGCCCGCCTCGG - Intronic
922076205 1:222247434-222247456 GAATTTAGAAAAGCCAGCCTGGG + Intergenic
922889045 1:229046478-229046500 GGGCTGAGGACAGCCAGCCTGGG + Intergenic
923142165 1:231169741-231169763 GATAGGAGAGAAGCCAGCCTAGG - Intronic
924280717 1:242434360-242434382 GAAATGGGAAAAGCAAGCCTGGG + Intronic
924673504 1:246152205-246152227 GAGGAGAGAAAAGGCAGCCTGGG + Intronic
1063191010 10:3695054-3695076 CACATGAGAAGAGCCAGCCCTGG - Intergenic
1063927231 10:10992340-10992362 GACATGAGAAAAGCATGCCTGGG - Intergenic
1065392192 10:25194241-25194263 AAGATTGGAAGAGCCAGGCTGGG + Intronic
1066105958 10:32157280-32157302 GAGTTCAGAAGGGCCAGTCTAGG + Intergenic
1066240912 10:33533860-33533882 TAGAAGGGAAGAGACAGCCTTGG - Intergenic
1067223087 10:44357710-44357732 GAGATGAGAAAAGCGAGTCTAGG - Intergenic
1067698828 10:48554261-48554283 GGTATGAGAAGATCCTGCCTGGG - Intronic
1067749206 10:48958864-48958886 GTGATGAGAAGGGCCAGGCCAGG + Intronic
1067837780 10:49652262-49652284 GAGCTGAGAAGAGCCAGGAGGGG + Intronic
1070746592 10:78937377-78937399 GTCATGGGCAGAGCCAGCCTTGG - Intergenic
1070779344 10:79128434-79128456 GAGATGAGAAAAGAGAGGCTTGG - Intronic
1070786667 10:79166061-79166083 GAGATGAGGACAGACAGCCACGG - Intronic
1071528488 10:86372143-86372165 GAGAGGAGAAGAGCCACCCCAGG - Intergenic
1072239584 10:93483099-93483121 GAGATCACAAGAGGCGGCCTGGG + Intergenic
1072892989 10:99341467-99341489 ATGATGATAAGAGGCAGCCTGGG + Intronic
1073522278 10:104144163-104144185 TAGATGAGGAAAGTCAGCCTGGG + Intronic
1074447716 10:113534052-113534074 GGGATGAGCAGAGCCTGGCTGGG + Intergenic
1075551002 10:123392256-123392278 GAGAGAAGAAGAGAGAGCCTTGG + Intergenic
1075799224 10:125142413-125142435 GATAGTAGAAGGGCCAGCCTAGG - Intronic
1076278345 10:129224652-129224674 GAGATGAGATGAGCCTGCTAGGG + Intergenic
1076435577 10:130438946-130438968 GAGATGGAAAGAGCCGGGCTTGG + Intergenic
1076491070 10:130862054-130862076 AAGATGAGCGGAGCCAGCTTGGG + Intergenic
1077177444 11:1197173-1197195 GGGAAGAGCACAGCCAGCCTCGG - Intronic
1079034673 11:17011866-17011888 GAGATGGGAAGAGCCGGTTTGGG - Intronic
1079376689 11:19899212-19899234 CAGAAGAGAAGAGCCAGACATGG + Intronic
1080737819 11:35034251-35034273 GTAATGAGAAGAAACAGCCTAGG - Intergenic
1080783481 11:35453089-35453111 CAGATGAGAAGAGCAAGGCTTGG - Intronic
1080842701 11:35999466-35999488 GAGATGAGGAGGGGCAGGCTCGG - Intronic
1081304951 11:41500692-41500714 GAGATTAGAAAACCCAGGCTGGG - Intergenic
1082093160 11:48105879-48105901 GAGATGAGGGGAGGTAGCCTTGG + Intronic
1082274457 11:50206657-50206679 CAGATGAGAAGAGTGAGACTTGG + Intergenic
1082739447 11:56894477-56894499 CAGATGAGCAGAGCCAGCAGAGG + Intergenic
1083224759 11:61277786-61277808 GAGATGAGAAGCACCAACCCTGG + Intronic
1083678926 11:64342482-64342504 GAGCTGGGAACAGCCAGCCGCGG - Intronic
1083686860 11:64381648-64381670 GAAAAAAGGAGAGCCAGCCTTGG - Intergenic
1084461209 11:69297680-69297702 GAGAGGTGAAGAACCTGCCTGGG + Intronic
1085645404 11:78219213-78219235 GAGATGGGAAGGGCCAGCTCTGG + Exonic
1087266377 11:96066169-96066191 GTGATAGGAAGGGCCAGCCTTGG - Intronic
1087805584 11:102552021-102552043 GAGATGAGAACGGCCAGGCAAGG + Intergenic
1087807691 11:102573057-102573079 GAGATGAGAAGAGAAAACATGGG - Intergenic
1088287517 11:108203626-108203648 AGGGTGAGAAGAGCAAGCCTAGG - Intronic
1089156463 11:116406639-116406661 GGGATGAGCAGAGTCAGGCTTGG - Intergenic
1089158956 11:116423310-116423332 GAGATGGGGAGAGACAACCTGGG + Intergenic
1089701348 11:120245952-120245974 AAGGTGAGAAGGGCAAGCCTTGG + Intronic
1089901639 11:121992659-121992681 AGGAAAAGAAGAGCCAGCCTCGG - Intergenic
1089962597 11:122629086-122629108 CTGATGAGAGTAGCCAGCCTTGG - Intergenic
1090437380 11:126697910-126697932 GTGATGAGAAGAGAGAGCCAGGG + Intronic
1091523442 12:1271851-1271873 CAGATGAGATGAGCAAGCCTGGG - Intronic
1091620775 12:2087059-2087081 GAGATAAAAAAACCCAGCCTGGG - Intronic
1091642887 12:2250895-2250917 AAGGACAGAAGAGCCAGCCTGGG - Intronic
1091784775 12:3236663-3236685 GAGAAGAGACGAGTAAGCCTGGG + Intronic
1092017272 12:5169809-5169831 GAGATGAGGAGACCGAGGCTCGG + Intergenic
1092125401 12:6071865-6071887 GAGATGACAGAAGCCAGGCTGGG + Intronic
1092507223 12:9115803-9115825 AAGAGGAGAAGAACCAGACTTGG + Exonic
1092950649 12:13499990-13500012 GAGATGAGCAGAGGGAGTCTGGG + Intergenic
1093858164 12:24130718-24130740 AAGGTGAGAAGAGACAGCCATGG - Intergenic
1093905678 12:24689484-24689506 GAGGTGGGAAAAGCCTGCCTAGG + Intergenic
1096557691 12:52413595-52413617 GAAATGAGAAGAGGCAGCTGTGG + Intergenic
1098848426 12:75566188-75566210 GCATTGAGATGAGCCAGCCTGGG + Intergenic
1100756904 12:97761241-97761263 GAGGTCAGAAAAGGCAGCCTGGG - Intergenic
1102060074 12:109925269-109925291 GAGATGAGAAGAGGCTGGCCTGG - Intronic
1102705164 12:114874636-114874658 GAGAGGAGAGGAGCCAGGCGCGG + Intergenic
1103575734 12:121875970-121875992 GAGAAGAGAAGAGACAGCATTGG + Intergenic
1103762181 12:123258816-123258838 GAGGTGAGAAGAGCCTTCATTGG - Intergenic
1104784939 12:131443376-131443398 GAGAAGAGATGGGCCGGCCTGGG + Intergenic
1107820167 13:44278506-44278528 CAGATGTGCAGAGCAAGCCTTGG + Intergenic
1112721821 13:102254310-102254332 GAGATGGGTAAAGTCAGCCTGGG + Intronic
1114269953 14:21094472-21094494 GAGAGGAGGAAAGCCTGCCTCGG - Intronic
1114531861 14:23401505-23401527 GAGCTGAGAAGAGCCAGTTGTGG - Intronic
1117925431 14:60774247-60774269 GTGATGAGAGGAGGCAGCCATGG + Intronic
1119434162 14:74587018-74587040 GTGAAGAGAGGAGTCAGCCTGGG - Intronic
1119891469 14:78185670-78185692 CCCATGAGCAGAGCCAGCCTAGG - Intergenic
1120844704 14:89115639-89115661 GGGGAGACAAGAGCCAGCCTGGG + Intergenic
1120852110 14:89180665-89180687 GCGCTGGGCAGAGCCAGCCTGGG - Intronic
1121410247 14:93744446-93744468 GAGGTCTGGAGAGCCAGCCTGGG + Intronic
1121625573 14:95383418-95383440 GTGACGGGCAGAGCCAGCCTGGG + Intergenic
1202919144 14_KI270723v1_random:14729-14751 AAGATAAGAAGATCCAGCATGGG + Intergenic
1202925486 14_KI270724v1_random:20266-20288 AAGATAAGAAGATCCAGCATGGG - Intergenic
1123462286 15:20484016-20484038 GAGTTGATAAGAGCGAGACTCGG + Intergenic
1123655773 15:22516355-22516377 GAGTTGATAAGAGCGAGACTCGG - Intergenic
1124309683 15:28611538-28611560 GAGTTGATAAGAGCGAGACTCGG - Intergenic
1124371350 15:29106468-29106490 TGGCTGAGATGAGCCAGCCTTGG + Intronic
1125134342 15:36324259-36324281 GGGAAGGTAAGAGCCAGCCTAGG + Intergenic
1127260430 15:57323160-57323182 GAGATGAAAAGGGCAAGGCTTGG + Intergenic
1127907489 15:63386945-63386967 GCCATGAAAAGAGCCTGCCTGGG - Intergenic
1128271693 15:66316018-66316040 GAGAACAGAAGATCCAGCATGGG - Intronic
1129803855 15:78438180-78438202 GAGAGCAGCAGAGCCAGCCCCGG - Exonic
1130148985 15:81297057-81297079 GGGTGGAGAAGAGCCAGCCCAGG + Exonic
1130846743 15:87754794-87754816 CAGCTAAAAAGAGCCAGCCTTGG - Intergenic
1131123255 15:89836466-89836488 GAGATGAAAAGAGCTGGCTTTGG + Intronic
1131735991 15:95332960-95332982 GAGATGTGAAGAGAGAGCCCAGG - Intergenic
1132031839 15:98444878-98444900 GAGCTGAGAAGCGCCTGCCATGG + Intronic
1132354423 15:101160600-101160622 GAGATGGGAACAGCCAGCCAGGG + Intergenic
1133239174 16:4404422-4404444 GGGATGAGAAGAGCCTGCAGGGG - Intronic
1136554856 16:31001651-31001673 GAGAGCTGGAGAGCCAGCCTTGG - Intronic
1138084104 16:54118181-54118203 GAGATGGGAAGTGCTGGCCTAGG + Exonic
1138584788 16:57962730-57962752 CAGGTGAGAAGATCCAGCCTGGG + Intronic
1141387086 16:83631700-83631722 TTGATGAGGGGAGCCAGCCTTGG + Intronic
1141597430 16:85106048-85106070 GAGATGGGAAGAGACAGCTGGGG + Intronic
1141811074 16:86376488-86376510 GGAATGAGACGAGCCAGACTTGG + Intergenic
1141982248 16:87557757-87557779 CAGATGAGAAAAGCCAGGCTGGG + Intergenic
1142708830 17:1712569-1712591 GAGGTGAGGAGAGGCAGCCTGGG - Intergenic
1142942206 17:3389804-3389826 GAGAGGATAAGATACAGCCTTGG - Intergenic
1143722328 17:8821786-8821808 GAGATGAGAAGGGCAATGCTGGG - Intronic
1144657664 17:17047890-17047912 GAAAGGAGAGGAACCAGCCTAGG + Intronic
1145043847 17:19596840-19596862 AGGATGAGAGGAGCCAGCTTGGG + Intergenic
1146003735 17:29147940-29147962 GAGATAAGAAGGGTCTGCCTAGG + Intronic
1146357255 17:32144492-32144514 GAGCTGAGACATGCCAGCCTGGG + Intronic
1146536528 17:33657415-33657437 GAGATGTGAGGAGCCAGCATAGG - Intronic
1146639574 17:34530068-34530090 GAGATGAGAAAACTCAGTCTGGG - Intergenic
1153152577 18:2111644-2111666 GAAATGATGAGAGCCTGCCTGGG - Intergenic
1155345614 18:24853744-24853766 GTGCTGAGAAAAGCCAACCTGGG - Intergenic
1156006748 18:32451258-32451280 GAGATGAAATGAGCTAGCTTGGG - Intronic
1156454542 18:37285578-37285600 GAGAGGAGATGAGCTGGCCTAGG + Intronic
1157689434 18:49668926-49668948 GAGATGAACAAAGCCAGCATGGG - Intergenic
1157897261 18:51480987-51481009 GGGCTGGGAAGAGCCTGCCTGGG + Intergenic
1157932907 18:51842741-51842763 GAGCTGAGCTGGGCCAGCCTGGG + Intergenic
1158637521 18:59174564-59174586 GAGATGAGATGTGCGTGCCTTGG + Intergenic
1158653173 18:59305820-59305842 GTGAGAAGAAGAGCCAGCCAAGG + Intronic
1159011320 18:63061590-63061612 AGAATGAGAAGGGCCAGCCTGGG - Intergenic
1160536258 18:79595786-79595808 GAGAAGAGAAGACACAGACTGGG + Intergenic
1162186277 19:8907430-8907452 GACTTTAGAAGAGCCAGCCTGGG - Intronic
1163082867 19:14956292-14956314 GAGACCAGGAGAGCCAGCCCAGG + Intronic
1163094133 19:15043313-15043335 GAGTTGGGAAGAACTAGCCTTGG - Intergenic
1163262859 19:16201741-16201763 GAAATGAGAAGAGCCAGGTCAGG + Intronic
1163345855 19:16741657-16741679 GACATGAAAAGAGCCAGGCATGG - Intronic
1163768676 19:19177842-19177864 GAGAAGAGCAGAGCCCGGCTTGG - Intronic
1164180863 19:22817344-22817366 GAGATAAGAAGCTCCTGCCTAGG + Intergenic
1164779570 19:30881615-30881637 GATATGAGAATATGCAGCCTGGG + Intergenic
1164952976 19:32354355-32354377 GAGTTGACAAGAGCCAACCTGGG + Exonic
1165022177 19:32934244-32934266 AAGATGAGGAGAGGCAGGCTTGG + Intronic
1165355582 19:35301907-35301929 GAGGTGGGCAGAGCCAGCCGTGG - Intronic
1165371388 19:35408572-35408594 GAGATTAGAGGCGCCAGCTTGGG + Intergenic
1165387517 19:35519530-35519552 GAGATGGGTGGAGCCAGGCTAGG - Intergenic
1166198332 19:41220605-41220627 GAGATGGGAAGAGTTAGCTTAGG - Intronic
1167234311 19:48304260-48304282 CAGATGGGCAGGGCCAGCCTGGG + Intronic
925009390 2:470846-470868 GAGAAGAAAACAGGCAGCCTCGG + Intergenic
925293878 2:2765464-2765486 GAGAGGAGCGGAGGCAGCCTGGG - Intergenic
925305525 2:2845867-2845889 AAGATGGCAAGACCCAGCCTGGG + Intergenic
926225061 2:10961420-10961442 GAGGTGAGAAGGGCCAGCCGAGG - Intergenic
926756213 2:16238182-16238204 GTGATGAAAAAAGCCAGCGTGGG + Intergenic
926948039 2:18210106-18210128 GAACTGTGAAGAACCAGCCTTGG + Intronic
927391392 2:22599362-22599384 TAGAAGCCAAGAGCCAGCCTCGG - Intergenic
927690273 2:25203296-25203318 GAGAGGACAGGAGCCAGCCATGG + Intergenic
927779614 2:25928906-25928928 CAGATGAGATGAGCCAGGGTTGG + Exonic
928614497 2:33023601-33023623 GAGATGAGAAGAGATGGCCTTGG + Intronic
930107835 2:47653955-47653977 GAGGGGAAAAGAGCCAGGCTGGG + Intergenic
931228062 2:60351237-60351259 AAGATGAGAAGAACGAGGCTTGG - Intergenic
931851405 2:66254902-66254924 GAGATGGGAAGACCAAGCCTGGG - Intergenic
932305859 2:70703977-70703999 GGGCTGAGAGGAGCCAGCCAGGG - Intronic
932586897 2:73036148-73036170 CAGATGAGCAGGGCCAGCCTGGG + Intronic
932616562 2:73235057-73235079 GAGGTGGGAAGACCCAGGCTCGG + Intronic
932869938 2:75388744-75388766 GAAATTACAAAAGCCAGCCTTGG - Intergenic
934088762 2:88532483-88532505 TTGATGAGAAGAGCCAGGCACGG - Intergenic
935243380 2:101197280-101197302 GAGAGGAGAAGAACCAGCCTTGG + Intronic
935553960 2:104486548-104486570 GAGGAGAGGAGAGACAGCCTGGG - Intergenic
935729474 2:106053596-106053618 GAGATGAGAATGGGCATCCTAGG - Intergenic
935870571 2:107444084-107444106 GAGATGAGAAAAGGCAGGCTGGG - Intergenic
937366829 2:121268662-121268684 GAGAAGAGAAGAACCAGACTGGG + Intronic
938111948 2:128573761-128573783 GAGAGGAGCTCAGCCAGCCTTGG + Intergenic
938323430 2:130381019-130381041 GAGATGAGTAGACCCAGACGTGG + Intergenic
938696633 2:133840930-133840952 CACATGAGAAGAACCAGCGTTGG + Intergenic
940548122 2:155115945-155115967 GAGATGGAAAGAGCCCTCCTGGG + Intergenic
945907847 2:215614877-215614899 CAGAAGAGAAGAGCCATCCACGG - Intergenic
946002350 2:216493175-216493197 GAGCTGAGGTGAGCCATCCTGGG - Intergenic
946047245 2:216831434-216831456 CAGATTGGAGGAGCCAGCCTGGG + Intergenic
946843426 2:223838934-223838956 GAGCTGAGATCATCCAGCCTAGG + Intergenic
947526032 2:230877281-230877303 GACATCAGAAGGGCCAGCCCAGG + Intronic
947641282 2:231709056-231709078 GGGAGGAGAAGAGCCTGGCTGGG + Intronic
947690531 2:232132084-232132106 GAGCTGAGTAGAGGCAGCCCTGG + Intronic
948109456 2:235442954-235442976 CAGAAGAGAACAGCCAGGCTGGG - Intergenic
948386376 2:237583621-237583643 GAGAGGAGAACAGCCAGATTAGG - Intronic
948589004 2:239037655-239037677 GACATGGGAAGAGCCATTCTTGG - Intergenic
1169314189 20:4574530-4574552 AAGATGAGGAGACCGAGCCTTGG - Intergenic
1171968679 20:31549751-31549773 GAGAGGGGAAGAGGCTGCCTGGG - Intronic
1172505413 20:35457896-35457918 GAGATGAGAAAAGGCAGCAAAGG + Intronic
1173401462 20:42729807-42729829 GAGAAGAGAAGAGGTAGCCATGG - Intronic
1173460109 20:43236401-43236423 CAGGTGTGAAGAGCCAGCCTCGG + Intergenic
1173620097 20:44430026-44430048 GAGAGGAGAAGCACCAGGCTAGG - Exonic
1173872079 20:46348459-46348481 GATGTGGGAAGAGCCAGCCAAGG - Intronic
1174134242 20:48367950-48367972 GAGCTGGGCAGAGCCCGCCTCGG - Intergenic
1174160418 20:48546537-48546559 CAGATGAACAGAGCCAGGCTGGG + Intergenic
1174789812 20:53467036-53467058 TTGATGAGAAGAGAGAGCCTTGG - Intronic
1175979595 20:62731009-62731031 GAGAAGACAAGATACAGCCTAGG - Intronic
1176989521 21:15478429-15478451 GAGATGAGGATAACCAGCTTGGG + Intergenic
1177621226 21:23597126-23597148 GTGGTGAGAAGAGACATCCTTGG - Intergenic
1179662894 21:42889394-42889416 GAAATGTGTAGAGCCAGCCTGGG - Intronic
1180594224 22:16963070-16963092 GAGATGAGAAGTGCTGGCCAGGG - Intronic
1180717617 22:17882433-17882455 GAGATGCGGAGGGCCAGCCATGG + Intronic
1183628421 22:39018641-39018663 GAGATGGGAAAAGCCAGGTTAGG - Exonic
1183641014 22:39092361-39092383 GAGATGGAAGGAGCCAGGCTAGG - Intergenic
1183929469 22:41227756-41227778 GAGATGAGAAGAGGGTCCCTGGG - Intronic
1184566726 22:45296519-45296541 CAGATGAGAAGACCGAGACTAGG - Intergenic
1184995141 22:48199842-48199864 GAGAGGTGAGAAGCCAGCCTGGG - Intergenic
1185067725 22:48640439-48640461 CAGCTGAGATAAGCCAGCCTTGG - Intronic
1185162301 22:49237260-49237282 CAAAGTAGAAGAGCCAGCCTGGG - Intergenic
950140665 3:10612950-10612972 GAGATGAGATGAGTCAGGATGGG + Intronic
951547653 3:23844624-23844646 GAGATGAGTACAGCCATTCTGGG - Intronic
952819438 3:37473324-37473346 AAGAGGAGAAGAGCCAGACTTGG - Intronic
953608046 3:44424621-44424643 GAGAGGAGAAAAGCCTGCTTGGG - Intergenic
954326824 3:49868555-49868577 GATATGTGAACAGCCAGCCTAGG + Intronic
954418302 3:50405058-50405080 GAGCTGAGAAGGGCCCGCTTAGG - Intronic
955245478 3:57220912-57220934 GACAGGAGAAGAGCAAGCCAGGG - Intronic
955769322 3:62372877-62372899 GAGCTGAGCCGAGCCAGGCTGGG + Exonic
956444013 3:69307997-69308019 GAGATGAGAGGTGACATCCTAGG - Intronic
956638095 3:71386411-71386433 GAGATGAGAAGACTGAGTCTTGG - Intronic
957082376 3:75647553-75647575 AAGATAAGAAGATCCAGCATGGG - Intergenic
957191068 3:77010660-77010682 GCGCTGAGAGGAGCCAGCCATGG - Intronic
960418889 3:117418970-117418992 GAGATGAGAAAATCAGGCCTAGG + Intergenic
960445840 3:117747601-117747623 GAGACGAGAAGAGGTTGCCTTGG - Intergenic
960556686 3:119037674-119037696 GGGTTGAGGAGAGCCTGCCTAGG - Intronic
961828625 3:129611954-129611976 GAGATGAGAGGAACCACCCTGGG - Intergenic
962809596 3:138949216-138949238 GAGACGCAGAGAGCCAGCCTGGG - Intronic
964894205 3:161575201-161575223 GAGAGGAGAGGAGGCAGCCATGG - Intergenic
967622768 3:191652873-191652895 GAAATTAGAAGAGCCATCCCAGG + Intergenic
968758011 4:2426852-2426874 CAGATGAGAAGGGTCAGCCCTGG + Intronic
969314543 4:6373679-6373701 GAGATGGGAGGTGACAGCCTCGG + Intronic
969515827 4:7647797-7647819 CAGATCAGAAGAACCAGCCGAGG - Intronic
969629330 4:8326451-8326473 GAGATGTGTGAAGCCAGCCTTGG + Intergenic
970603808 4:17660946-17660968 GAGGTGAGAAGGCCCAGGCTGGG + Intronic
977817593 4:101432915-101432937 GAGATTAAAAGAGCCAGGTTAGG - Intronic
977918011 4:102614766-102614788 GAGTGTAGAAGAGCCAGCCAGGG - Intronic
978631603 4:110753410-110753432 AAGGTGAGCAGAGCCAGCATGGG + Intergenic
978803387 4:112776030-112776052 GTTCTGAGAAGCGCCAGCCTAGG + Intergenic
981787398 4:148497206-148497228 AAGAGGAGAGGAGCCAGCCTTGG + Intergenic
984028501 4:174573892-174573914 GAGATGGTAAAATCCAGCCTTGG + Intergenic
984839361 4:184053557-184053579 GACCTGTGAAGAGCCAGCCTTGG - Intergenic
985373793 4:189313605-189313627 TAGGTGAGAAGAACCTGCCTTGG - Intergenic
985381028 4:189395041-189395063 GAGATGAGAAGAGCTAGGCATGG - Intergenic
989707077 5:44347404-44347426 GAGGTGGGCAGAGCCAGACTAGG - Intronic
990650793 5:57897413-57897435 GAGTAGAGAAAATCCAGCCTTGG - Intergenic
991198612 5:63962634-63962656 GAGATGAGAAAAGGAAGCATAGG + Intergenic
991429842 5:66532840-66532862 GAGATGAAAAGAGTCAGAGTGGG - Intergenic
992645326 5:78806459-78806481 CAGATGAGAAGTGCCAGTCCAGG - Intronic
993712356 5:91238751-91238773 GACATGAAAAGAACCAGCATTGG + Intergenic
994312871 5:98296682-98296704 GTGATGAGAAGAGGCAGGCAAGG - Intergenic
995526618 5:113055306-113055328 GAGATGAGGAGGGCAGGCCTGGG - Intronic
997206855 5:132055240-132055262 GAGAGGGGAAGGGCCGGCCTGGG - Intergenic
997389784 5:133504658-133504680 GAGCTGAGAAGAGCCAGCATGGG - Intronic
998229436 5:140350620-140350642 GGGGTGAGAGAAGCCAGCCTGGG - Intergenic
998781503 5:145661948-145661970 GAGATGAGCAGAGCCTGAATTGG + Intronic
999373098 5:151068167-151068189 GAGATCAGAGGAGCCACCCCTGG + Intronic
999837753 5:155392729-155392751 GAGAGGAGAAGGACCTGCCTTGG - Intergenic
1000280766 5:159780043-159780065 GAGATGAAGATAGCCATCCTAGG - Intergenic
1001041806 5:168341599-168341621 GAGATGAAAAATGCCATCCTGGG - Intronic
1001481641 5:172092871-172092893 GAGAAGTGAGGAGCCAGCCCAGG - Intronic
1001648479 5:173299026-173299048 GAGATGCCAGGAGCCAGCCAGGG - Intergenic
1001712010 5:173786561-173786583 GAGAGGAGAAGAGCAAGCCAAGG - Intergenic
1001878421 5:175220991-175221013 GGGATGAGAAGAAACAGCCCAGG + Intergenic
1001934873 5:175696757-175696779 GAGGTTAGAAGAGCCAGCAAGGG - Intergenic
1004191815 6:13470713-13470735 GAGATAAGAAGAGCCTGCCAGGG + Intronic
1004572640 6:16862873-16862895 AATAGGAGAAGAGCTAGCCTTGG + Intergenic
1005270031 6:24153732-24153754 GAGCTGAGAGCAGCCAGCATGGG + Intronic
1005382702 6:25253173-25253195 GATATGACAAGCGCTAGCCTAGG - Intergenic
1005886787 6:30103137-30103159 GAGAGGAGCAACGCCAGCCTGGG - Exonic
1006147854 6:31970007-31970029 GAGAAGAGATGAACGAGCCTGGG + Exonic
1006375582 6:33670022-33670044 GAGATGAGAAGAGCCAGCCTTGG - Intronic
1006393776 6:33773788-33773810 GAGATGAGAAGAACTGGCCTGGG - Intronic
1006440234 6:34049373-34049395 AAGCTGAGAAGGGGCAGCCTGGG - Intronic
1010274863 6:73957586-73957608 GATGTGTGAAGAGCCAGCCAGGG - Intergenic
1011351768 6:86432009-86432031 GAGAAGAGATGAGACAGCCCAGG + Intergenic
1012946262 6:105469208-105469230 GAACTGAGAAGAGGCTGCCTGGG + Intergenic
1013345314 6:109254403-109254425 GGGATCAGCAGAGGCAGCCTTGG - Intergenic
1013677890 6:112487500-112487522 GAAGGGTGAAGAGCCAGCCTTGG - Intergenic
1014638580 6:123880093-123880115 GAGCTGAGAAGAGTCAGTCAGGG + Intronic
1014984286 6:127982846-127982868 GAGATGTGAAGAGTTAGTCTGGG + Exonic
1015509434 6:134023269-134023291 GAGATGATAAGAGGTAGCATAGG + Intronic
1017484388 6:154889598-154889620 GAGATCAGAAGCCACAGCCTTGG + Intronic
1017992694 6:159504956-159504978 GAGATGAGGGGAAACAGCCTGGG - Intergenic
1018058441 6:160071437-160071459 GAGATGAGCAGAGTAAGCCTTGG + Intronic
1019060252 6:169252348-169252370 GAGGTGGGAAGAGCCTGCCAAGG - Intronic
1019491415 7:1315216-1315238 GAGATGAGGAGACCGAGGCTGGG - Intergenic
1019600671 7:1882127-1882149 GAGATGAGGAGGGGCAGCCTTGG + Intronic
1020163861 7:5793433-5793455 GAGGTGCCAAGAGCCAGCCAGGG - Intergenic
1022048729 7:26644301-26644323 GGGGTGTGAAGAGGCAGCCTGGG + Intronic
1022333908 7:29405243-29405265 GAGCTGAGAAGAAACAGCCTGGG - Intronic
1023042380 7:36183000-36183022 CAGGTGAGCAGGGCCAGCCTGGG + Intronic
1023963684 7:44949495-44949517 GAAATGACAAGAAACAGCCTAGG - Intergenic
1024361464 7:48473256-48473278 TAGATAAGAAGAGCTAGCCTGGG - Intronic
1025215489 7:57052503-57052525 CAGATGAGAAGAGTGAGGCTTGG + Intergenic
1025655886 7:63518199-63518221 CAGATGAGAAGAGTGAGGCTTGG - Intergenic
1026127932 7:67595846-67595868 GAGGTCAGGAGAGCCATCCTAGG + Intergenic
1028472723 7:91222337-91222359 GAAATGAGATGAGCAAGACTAGG - Intergenic
1028684341 7:93575368-93575390 GAGATGAGAAGAGACACCTTGGG + Intergenic
1029035742 7:97519337-97519359 GAGATAAGTAGAGCCAGTCCAGG + Intergenic
1029176719 7:98669886-98669908 GAGTTGAGCAGACCCAGCCCAGG - Intergenic
1029979203 7:104862471-104862493 GAGATGATAAGTGCTAGCCCAGG + Intronic
1032061238 7:128727120-128727142 GAGATGAGAAGGGCTGGGCTGGG - Intronic
1032156107 7:129469649-129469671 GAGAGGAGAAGGGTCAGCTTGGG - Intronic
1032251476 7:130261626-130261648 AAGGTGAGAAGAGACAACCTGGG - Intergenic
1033477345 7:141703218-141703240 TAGATTAGAAGTGGCAGCCTAGG - Intergenic
1034300035 7:150007255-150007277 AAGATGTGATGAGCAAGCCTTGG - Intergenic
1034806009 7:154090055-154090077 AAGATGTGATGAGCAAGCCTTGG + Intronic
1035395338 7:158531305-158531327 GAGATGTGAACTGACAGCCTTGG - Intronic
1035819047 8:2571906-2571928 GAGAAGAGAAGACCCCCCCTCGG - Intergenic
1035941000 8:3900823-3900845 GAAATGAGAAGAGCAAGCTCTGG - Intronic
1036663914 8:10726444-10726466 GAGAAGAGAAGCGGCAGCCGGGG - Exonic
1037940552 8:22947881-22947903 GAAATGGGAGGAGCCAGCCTAGG + Intronic
1038348842 8:26757982-26758004 AAGATGACAAACGCCAGCCTTGG + Intronic
1038528728 8:28299032-28299054 GATATGAGAAGGGCCAAGCTAGG + Intergenic
1039444403 8:37619484-37619506 GAGAAGACCAAAGCCAGCCTTGG + Intergenic
1041007140 8:53506637-53506659 GAGAAGAGAAAAGCTAACCTTGG - Intergenic
1041632943 8:60108647-60108669 CAGATCAGCAGAGCAAGCCTGGG + Intergenic
1043400196 8:79877073-79877095 GAGAGGACAAGGGCCTGCCTTGG - Intergenic
1044603877 8:94032428-94032450 GAGGTGAGAAGAGCAGTCCTGGG - Intergenic
1046588579 8:116178178-116178200 CAGAGCAGAAGAGTCAGCCTGGG + Intergenic
1046627795 8:116593653-116593675 GACATGTGAAGAGCCAGCCAGGG + Intergenic
1047344945 8:124018539-124018561 GTGCTGAGAAAAGCCAGCATAGG - Intronic
1047370478 8:124252006-124252028 CAGATGACTAGAACCAGCCTTGG - Intergenic
1048298415 8:133233632-133233654 TAGATGAGAAAACCCAGGCTCGG - Intergenic
1048904180 8:139071640-139071662 GAAAAGAGAAGAGTCACCCTGGG + Intergenic
1049253074 8:141599433-141599455 GACGTGAGAAGAGGCAGGCTTGG + Intergenic
1049443026 8:142617791-142617813 GAGATCAGCAGGGCCAGCCTGGG - Intergenic
1050354367 9:4769270-4769292 GAGGTGAGAGTAGCGAGCCTGGG + Intergenic
1052608187 9:30732627-30732649 GAGATGAGTTCAGCCAGGCTAGG - Intergenic
1053011027 9:34633470-34633492 GAGTGGAGAGGAGCCAGCCAGGG + Intergenic
1056462035 9:86817901-86817923 GAAATGACAAGAGACAGACTTGG + Intergenic
1057303375 9:93899175-93899197 GGGCTGAGCAGAGCCAGGCTGGG + Intergenic
1059824259 9:118009493-118009515 GAGATTAGGAGAGAGAGCCTTGG + Intergenic
1061576575 9:131511019-131511041 GAGATGAGAAAACCAAGACTAGG - Intronic
1061615474 9:131776107-131776129 GAGATGAGAACACCCAGCCGTGG + Intergenic
1061917389 9:133762575-133762597 GGGAAGCGAAGAGTCAGCCTTGG - Exonic
1061919646 9:133775897-133775919 GAGATGGCAACAGGCAGCCTGGG + Intronic
1061936633 9:133861329-133861351 GAGATGAAAGGACCCGGCCTTGG + Intronic
1062232610 9:135490457-135490479 GAGATGAGACAAGCGACCCTGGG - Intergenic
1062283131 9:135760681-135760703 GTGAGGAGAAGAGCCAGGCCTGG - Intronic
1062340736 9:136092925-136092947 GAGATGCAGAGAGGCAGCCTGGG + Intronic
1187670246 X:21659021-21659043 AAGGTGAAACGAGCCAGCCTGGG - Intergenic
1196595404 X:117540186-117540208 CAGATGAGAAGAGCCAAACAAGG - Intergenic
1197324397 X:125074342-125074364 TAGGTTAGAAGGGCCAGCCTGGG - Intergenic
1197705351 X:129630796-129630818 GACACTAGAATAGCCAGCCTGGG + Intergenic
1197818924 X:130527181-130527203 GATAAAAGAAGAGCCAGACTTGG - Intergenic
1199163122 X:144637887-144637909 ATAATGAGAAGAGCCAGCATGGG + Intergenic
1199693879 X:150329684-150329706 GAAGGGAGAAGAGCCAGCCAGGG - Intergenic
1199758340 X:150885934-150885956 GAGATGAGACGAGCCATCTGTGG + Intronic
1199794437 X:151180815-151180837 GAGGTGACCAGAGGCAGCCTTGG - Exonic
1200710201 Y:6476389-6476411 GGCATTAGAAGAGCCAGTCTAGG + Intergenic
1200826655 Y:7651636-7651658 GGCATTAGAAGAGCCAGTCTGGG + Intergenic
1200883635 Y:8246130-8246152 GGCATTAGAAGAGCCAGTCTGGG + Intergenic
1200940646 Y:8776581-8776603 GGCATTAGAAGAGTCAGCCTAGG + Intergenic
1201023914 Y:9688319-9688341 GGCATTAGAAGAGCCAGTCTAGG - Intergenic
1202233239 Y:22678234-22678256 GGCATTAGAAGAGCCAGTCTAGG - Intergenic
1202309917 Y:23517924-23517946 GGCATTAGAAGAGCCAGTCTAGG + Intergenic
1202560884 Y:26152669-26152691 GGCATTAGAAGAGCCAGTCTAGG - Intergenic