ID: 1006375753

View in Genome Browser
Species Human (GRCh38)
Location 6:33670916-33670938
Sequence CTGGGGACACAGAAGGAAGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 625
Summary {0: 1, 1: 0, 2: 4, 3: 65, 4: 555}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1006375753_1006375769 25 Left 1006375753 6:33670916-33670938 CCCACTTCCTTCTGTGTCCCCAG 0: 1
1: 0
2: 4
3: 65
4: 555
Right 1006375769 6:33670964-33670986 GCTGGGATTCTCCAAGAGGCAGG 0: 1
1: 0
2: 4
3: 26
4: 207
1006375753_1006375765 7 Left 1006375753 6:33670916-33670938 CCCACTTCCTTCTGTGTCCCCAG 0: 1
1: 0
2: 4
3: 65
4: 555
Right 1006375765 6:33670946-33670968 AGGGGGACCGCATAGAAGGCTGG 0: 1
1: 0
2: 1
3: 4
4: 89
1006375753_1006375768 21 Left 1006375753 6:33670916-33670938 CCCACTTCCTTCTGTGTCCCCAG 0: 1
1: 0
2: 4
3: 65
4: 555
Right 1006375768 6:33670960-33670982 GAAGGCTGGGATTCTCCAAGAGG 0: 1
1: 0
2: 1
3: 14
4: 164
1006375753_1006375759 -10 Left 1006375753 6:33670916-33670938 CCCACTTCCTTCTGTGTCCCCAG 0: 1
1: 0
2: 4
3: 65
4: 555
Right 1006375759 6:33670929-33670951 GTGTCCCCAGCCAGTGCAGGGGG 0: 1
1: 0
2: 1
3: 31
4: 262
1006375753_1006375766 8 Left 1006375753 6:33670916-33670938 CCCACTTCCTTCTGTGTCCCCAG 0: 1
1: 0
2: 4
3: 65
4: 555
Right 1006375766 6:33670947-33670969 GGGGGACCGCATAGAAGGCTGGG 0: 1
1: 0
2: 0
3: 2
4: 78
1006375753_1006375764 3 Left 1006375753 6:33670916-33670938 CCCACTTCCTTCTGTGTCCCCAG 0: 1
1: 0
2: 4
3: 65
4: 555
Right 1006375764 6:33670942-33670964 GTGCAGGGGGACCGCATAGAAGG 0: 1
1: 0
2: 0
3: 6
4: 77

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1006375753 Original CRISPR CTGGGGACACAGAAGGAAGT GGG (reversed) Intronic
900293940 1:1939312-1939334 CTGGGGCCACACAAGGTAGCTGG - Intronic
900298677 1:1965697-1965719 CTGGGGACACCCAAGGGAGAAGG - Intronic
900333044 1:2146091-2146113 CCGAGGAGACAGATGGAAGTAGG + Exonic
900934207 1:5755210-5755232 CTTGGGACACCCAGGGAAGTGGG + Intergenic
900998221 1:6134260-6134282 CTGCAGACACAGCAGGAGGTGGG + Intronic
901059387 1:6465158-6465180 TTGGGGACACACAAGGCAGGTGG + Exonic
901220808 1:7582838-7582860 CTGAGGAACCAGAAGGAAATGGG + Intronic
902713351 1:18255697-18255719 ATGGGGAAACAGTAGGAAGGGGG - Intronic
903186056 1:21629610-21629632 ATGGGGACAGAGAAGGAAACTGG + Intronic
904696421 1:32334310-32334332 GTGGGGACAGGGAAGGAGGTAGG + Exonic
904889665 1:33770439-33770461 CTGGGTACTCAGTAGGGAGTGGG + Intronic
904903199 1:33874027-33874049 ATGGGAACACACAAGGGAGTTGG - Intronic
905037041 1:34925192-34925214 CTTGGGACATAGAGGGAAGGTGG - Intronic
905304118 1:37005851-37005873 CTGGGGACACAGAGGTAGATGGG + Intronic
905344545 1:37302481-37302503 GTTGGGAGACAGAAGGAAGCTGG + Intergenic
906754844 1:48301578-48301600 CTGAGCAAACAGAACGAAGTTGG + Intronic
906811802 1:48834591-48834613 CTGAGGACACAGCAAGAAGGAGG + Intronic
907111008 1:51926265-51926287 CTGGGGACACAGAGGTGAATGGG - Intronic
907271928 1:53296367-53296389 CTGGGTGCACAGAAGGGACTTGG + Intronic
907403241 1:54238549-54238571 CAGGGGACACAGGAGGAAGTGGG + Intronic
907639400 1:56170932-56170954 CTGGAGGCACAGAAGGATGGAGG + Intergenic
907938431 1:59063873-59063895 CTGCTGACAAAGAAGGAATTTGG + Intergenic
908426876 1:64016021-64016043 CTTGGGAAACAGAAGGGAGTTGG - Intronic
908896255 1:68903651-68903673 CTAAGGACACAGAAAGAAGCAGG - Intergenic
908965553 1:69757788-69757810 CTGTGGATACAGAAGCAAATGGG + Intronic
909700607 1:78517676-78517698 TTGAGGACACAGAAGAAGGTAGG + Intronic
910194226 1:84624048-84624070 GTGGGGACACAGAAGCAGCTGGG + Intergenic
910455095 1:87389394-87389416 CAGGGAAGACAGAAAGAAGTGGG + Intergenic
910687152 1:89929081-89929103 CATAGGACAAAGAAGGAAGTGGG + Intronic
910866846 1:91796626-91796648 CAGAGGACACAGGAGGAAATGGG + Intronic
911430636 1:97782340-97782362 CTGGGGCCACAGAAGAAAATGGG - Intronic
911506364 1:98757399-98757421 CTGAGGACACAGCAGGAAGGTGG - Intronic
911593284 1:99772085-99772107 TTTGGGACACAGAGGCAAGTGGG + Intergenic
913498479 1:119449500-119449522 CTGAGGGCAAAGAAGGAAGAAGG - Intergenic
913705137 1:121413495-121413517 ATGGGGATAGAGAAGGAAATGGG + Intergenic
915076281 1:153310618-153310640 CTGGAGACCCAGAATGAAGAAGG + Exonic
915128931 1:153683890-153683912 GTGGGGACCCAGAGGGAAGAGGG + Intronic
915218038 1:154352932-154352954 CTGGGAGCACAGATGGAAGCGGG - Intergenic
915938559 1:160103623-160103645 CTAGGGAAACAGGAGGAAGAAGG - Intergenic
916167689 1:161978368-161978390 CTGGGGATACAGAAGGCAGAGGG - Intergenic
916849575 1:168689820-168689842 CTGGAGAAACAGAAGGCATTAGG - Intergenic
917141157 1:171837569-171837591 GTGAGGACACAGCAGGAAGGTGG - Intergenic
917478318 1:175387750-175387772 CTGGAGACAGAGTAGGAGGTGGG - Intronic
918060131 1:181053791-181053813 CTGGGATCACAGAAGGACCTGGG + Intronic
918809284 1:189094445-189094467 CTGGGGAGCCAGAAGGGAGATGG - Intergenic
919020496 1:192098799-192098821 CTGGGGACAGAGAAGGCAAATGG + Intergenic
919046350 1:192457519-192457541 CTGAGGACACAGCAAGAAGGTGG - Intergenic
919920056 1:202162133-202162155 CTGGGGACACAGGAGGGGGCAGG + Intergenic
920156140 1:203953242-203953264 GTGAGGACACAGCAAGAAGTTGG - Intergenic
921395477 1:214664775-214664797 ATGGGGACACAGAATGTAGGAGG - Intergenic
921707057 1:218334460-218334482 ATGGAGACATAGAAGGAAATGGG - Exonic
921801464 1:219407873-219407895 GTGAGGACACAGCAAGAAGTTGG - Intergenic
921878731 1:220229412-220229434 ATGGGGTCAGAGAAGCAAGTAGG - Intronic
921991798 1:221374779-221374801 CTGTTGGCACAGAAGGAAGTGGG - Intergenic
922015121 1:221637496-221637518 CTGGAGAAATAGTAGGAAGTGGG - Intergenic
922353009 1:224750286-224750308 CATGGGAGACAGAAGGAAGAGGG - Intergenic
922533942 1:226365913-226365935 GGCAGGACACAGAAGGAAGTGGG + Intronic
923087291 1:230711296-230711318 GTGGGGACACAGAGAGAAGACGG + Intronic
923315118 1:232772970-232772992 GAGGGGACACAGTGGGAAGTCGG - Intergenic
924119249 1:240779506-240779528 GTGAGGACACAGTAGGAAGATGG + Intronic
924309370 1:242724188-242724210 TGGGGGACAGAGAAGGAAGAAGG - Intergenic
924445622 1:244127784-244127806 CTGGGGATACAGAGGAAGGTGGG - Intergenic
1063016108 10:2079361-2079383 ATGAAGACACAGAAGGAAGGGGG - Intergenic
1063962514 10:11318768-11318790 CTGTGTACAGAGAAGGGAGTTGG + Intronic
1064020086 10:11801977-11801999 CTGGAGACTCAGAAGGAGGGAGG + Intergenic
1064277742 10:13922070-13922092 CTGAGGACACAGCAAGAAGGTGG + Intronic
1065708733 10:28495208-28495230 CTGGGAAGACAGAGGGAAGGAGG + Intergenic
1067200398 10:44166259-44166281 GTGAGGACACAGCAAGAAGTTGG + Intergenic
1067514705 10:46928566-46928588 CTGGGGGCTCAGAGGGAAGCAGG - Intronic
1067522541 10:47019223-47019245 CTGGGGAAAAAGAAGGAGATTGG + Intergenic
1067647551 10:48123247-48123269 CTGGGGGCTCAGAGGGAAGCAGG + Intergenic
1067699530 10:48558827-48558849 CTAGGGACACTAAAGGAAGGTGG + Intronic
1067825825 10:49572224-49572246 CTGGGCCCACAGAAGAATGTTGG + Intergenic
1068068873 10:52170186-52170208 CTGAGGACAAAGAAGAAAGAAGG + Intronic
1068221458 10:54051329-54051351 CTAGGAAGACAGAAAGAAGTGGG + Intronic
1068253579 10:54476977-54476999 CTGGAGGCAAAGAAGGAAGTTGG - Intronic
1069696926 10:70393419-70393441 GTGAGGACACAGAAAGAAGGTGG - Intergenic
1069887976 10:71635896-71635918 GTGGGGACACAGTGGGAAGCAGG - Intronic
1070505844 10:77112010-77112032 CTGGGGACAAGGTTGGAAGTTGG - Intronic
1071906294 10:90177897-90177919 CTGGGGACAGAGGAAGGAGTTGG + Intergenic
1071936314 10:90534767-90534789 CTGGGGACTCATATGGCAGTTGG - Intergenic
1072434673 10:95404179-95404201 CTGGGGCCAGAGAATGAGGTGGG + Intronic
1072694777 10:97595074-97595096 CTGGGGACACATAAGCAACATGG - Intronic
1072894327 10:99353245-99353267 CTGAGGAAACAGAAGTAAATAGG + Intronic
1073496806 10:103899113-103899135 CTGGGCACTCACAAGGAAGGAGG - Intronic
1073608591 10:104920967-104920989 CTGGGCTCCCATAAGGAAGTTGG - Intronic
1073895773 10:108155503-108155525 CTATGGACACAAAAGAAAGTCGG - Intergenic
1074210448 10:111328269-111328291 CTGGAGACTCCGAAGGGAGTGGG + Intergenic
1074544702 10:114393579-114393601 CTGGGGACAGGGAGGGAAGTTGG + Intronic
1074862842 10:117525319-117525341 CTGGGGACAGAGAAGCAAGGAGG - Intergenic
1074955873 10:118388636-118388658 GTGAGGACACAGGAGGAAGGTGG + Intergenic
1075093709 10:119457608-119457630 CTGGGGACTCAGTAGGGAGAAGG - Intronic
1075210746 10:120489048-120489070 CTGGAGGGACAAAAGGAAGTAGG - Intronic
1075579905 10:123609535-123609557 CTGGGGCCACAGACAGAAGGGGG - Intergenic
1075705226 10:124496641-124496663 CAGGGGACCCAGAAGGCAGACGG - Intronic
1076079391 10:127565116-127565138 CTGGGGACAGGGAGGAAAGTCGG - Intergenic
1076764872 10:132627541-132627563 CTGGGGACACAGAGGGAGTCGGG - Intronic
1077478582 11:2802583-2802605 CTGGGGACCCAGGAGGCACTAGG - Intronic
1077890295 11:6413436-6413458 CTGAGAACACAGAGGGAAGGGGG - Intronic
1077929599 11:6717239-6717261 CTGTGGACACAGAAGGACTTCGG - Intergenic
1078087875 11:8245005-8245027 CCAGGCACACAGAAGGTAGTTGG - Intronic
1078756770 11:14218479-14218501 CTGGGGACACAGAAATCATTAGG - Intronic
1079164331 11:18024830-18024852 CTGGGGAAACAGCAAGAAGCTGG - Intronic
1079837248 11:25350345-25350367 CTGGGGGCTCACAAGGAAGGAGG + Intergenic
1080499315 11:32853469-32853491 CTGGGCACACAAAAGGATTTAGG + Exonic
1080620186 11:33980803-33980825 CAGTTGTCACAGAAGGAAGTTGG - Intergenic
1080646026 11:34188308-34188330 CTGAGGACACAGCAGGAACAGGG + Intronic
1082114309 11:48311575-48311597 GTGAGGACACAGAAAGAAGACGG - Intergenic
1083002023 11:59301212-59301234 CTCAAGAAACAGAAGGAAGTGGG + Intergenic
1083167959 11:60903069-60903091 CTGGGCACACAGACAGGAGTGGG + Intronic
1083869352 11:65477456-65477478 CTGGGGACACGGCAGGAAGAAGG + Intergenic
1083900295 11:65640354-65640376 CCAGGGACCCTGAAGGAAGTGGG + Intronic
1084013517 11:66365712-66365734 CTGGGGACACAGAGGTCAGCTGG + Intronic
1084096586 11:66915443-66915465 CTGGAGACACAGCAGGGAGAAGG - Intronic
1084560834 11:69904760-69904782 CTGGGGACACTGTGGGAATTGGG - Intergenic
1084691706 11:70731222-70731244 GTGGGGACACAGTAAGAAGGTGG + Intronic
1084724253 11:70930330-70930352 CCTGGGACACAGAAGAAACTGGG + Intronic
1084941073 11:72613652-72613674 CTGGAGACACAGGAGTAGGTGGG - Intronic
1085094560 11:73749347-73749369 TTGGGGACTCACAGGGAAGTGGG + Intronic
1085129770 11:74028356-74028378 CTGGGGAGGCAAAAAGAAGTTGG + Exonic
1085171626 11:74454466-74454488 CTGGGGAGACAGCAGGAAGCAGG - Intergenic
1085751702 11:79167816-79167838 CTGTGGACACAGAAGGAGCCTGG - Intronic
1086206167 11:84260583-84260605 CTTGGCACACAGTAGGTAGTTGG - Intronic
1086209187 11:84297721-84297743 CTGGGGGCATGGAAGGAAGTCGG - Intronic
1088175057 11:107044077-107044099 CTGTGCACAAAGCAGGAAGTGGG - Intergenic
1088279852 11:108124713-108124735 CTGAGGCCACAGAACTAAGTAGG - Intronic
1088693875 11:112349819-112349841 CTGGGGACAGGAAAGGAAGGGGG + Intergenic
1089125431 11:116173155-116173177 CTGGGGACAGAGAAGGCTCTAGG + Intergenic
1089230678 11:116972453-116972475 CTGGGGATGAAGAAAGAAGTTGG - Intronic
1089453745 11:118613793-118613815 CTAGGGACACAGCAGAAAGGTGG - Intronic
1089849363 11:121482953-121482975 CAGGAGACCAAGAAGGAAGTGGG - Intronic
1090136359 11:124203564-124203586 CTGGGGAGTCAGAAGAAAGGAGG + Intergenic
1090667759 11:128926111-128926133 CTTGGGACACAGAAGGGGCTTGG - Intergenic
1090927564 11:131262026-131262048 CTGGGGATACAGAATGAATAAGG + Intergenic
1091265772 11:134270040-134270062 CAGGGGCCAGAGAATGAAGTGGG + Intergenic
1092279549 12:7089205-7089227 CAGGGGATCCAGGAGGAAGTTGG + Intronic
1094322101 12:29195858-29195880 ATGGGGACTCAGAAGGACGAGGG - Intronic
1095184613 12:39187047-39187069 CTGGGGACCCAGAAGGGAGATGG - Intergenic
1095772027 12:45970371-45970393 CTGGTTACACAGAAAGAAGAGGG + Intronic
1095840466 12:46686086-46686108 ATGGGAACACAGAAGGCTGTGGG - Intergenic
1096444150 12:51673556-51673578 CTGGGCACCCAGAAGAAAGTTGG + Intronic
1097226490 12:57479443-57479465 CTGGAGACCCAGAAGGGAATAGG + Intronic
1098579901 12:72087386-72087408 CTGAAGACACAGAAGAAAGATGG + Intronic
1099188117 12:79537906-79537928 AATGAGACACAGAAGGAAGTGGG + Intergenic
1100286582 12:93172630-93172652 TTGGAGGGACAGAAGGAAGTGGG - Intergenic
1100288324 12:93188924-93188946 GTGGACACACACAAGGAAGTGGG - Intergenic
1100580905 12:95939621-95939643 ATGGAGACAGAGAAGGCAGTGGG + Intronic
1101561454 12:105861574-105861596 GTGGGCACACAGTAGGAACTGGG - Intergenic
1101649143 12:106659040-106659062 CAGGGGTCAGGGAAGGAAGTGGG - Intronic
1101731716 12:107432265-107432287 CTGAGGACACTGATGGAATTGGG + Intronic
1101759881 12:107649812-107649834 CTGGGGAGAGTGAAGGAAGCAGG - Intronic
1102305222 12:111799700-111799722 CGGGGCGCACAGGAGGAAGTTGG + Intronic
1102438918 12:112946703-112946725 CAGGGGACTCAGAAGGAAGAAGG - Intronic
1102440892 12:112963290-112963312 CTGGGGGCACAGCAGGAAGGTGG - Intronic
1102878604 12:116466964-116466986 GTGGGGACAGGGAAGGAATTTGG + Intergenic
1103014478 12:117483024-117483046 CTGGGGAGTCAGAGGGAAGAAGG + Intronic
1103064813 12:117888617-117888639 GTGAGGACACAGAAAGAAGGTGG + Intronic
1103841385 12:123868075-123868097 CTGTTGACACAGAAGGAGTTTGG + Exonic
1104710567 12:130982839-130982861 CTGGGGACACAGAAGGACTCAGG + Intronic
1105964912 13:25374777-25374799 CTGGGGACACTGATGGAAACAGG + Intronic
1106229190 13:27808621-27808643 GTGGGGACACACCGGGAAGTTGG + Intergenic
1107282500 13:38752918-38752940 CTGGCGCCACAAAAGGAATTAGG + Intronic
1108240014 13:48454509-48454531 CTGGGAATACAGAAGTAAGATGG + Intronic
1108825246 13:54405976-54405998 ATGGGGACACAGGAGGTATTAGG - Intergenic
1109961164 13:69633965-69633987 ATGGGGAAAGAGAAGGAAGTGGG - Intergenic
1111908942 13:94288417-94288439 CTGGGGACATGGAGGGAGGTGGG - Intronic
1112655638 13:101449951-101449973 CTGGGGACACAGCAGTAGGTTGG - Intergenic
1112688935 13:101867003-101867025 CTGGAGAATCAGAAGGAAGAAGG + Intronic
1113099965 13:106706866-106706888 CTGGGGACCCTGAATGTAGTAGG - Intergenic
1113196872 13:107818396-107818418 TTGGAGACACTGGAGGAAGTAGG + Intronic
1113972450 13:114200302-114200324 CTGGGGACAGAGAAGGAGGCTGG - Intergenic
1114080774 14:19200273-19200295 CAGAGGACACAGAAGGAGGGAGG + Intergenic
1114570438 14:23663648-23663670 ATGGGACCACAGAAGAAAGTAGG + Intergenic
1115748300 14:36460942-36460964 CTGGGGATACAGAAATAAATAGG + Intergenic
1117313472 14:54551267-54551289 CTGGGGAAACAAAGTGAAGTTGG - Intergenic
1119771748 14:77224485-77224507 CTGGGATCCCAGAAGGAAGCAGG + Intronic
1120299476 14:82688166-82688188 CTGGTGAGACAGAATGAAGAAGG + Intergenic
1121467085 14:94122813-94122835 GTGGGGACAGAGAAGAGAGTGGG + Intergenic
1123223451 14:106878032-106878054 CTGAGCACACAGAAGGCAGCAGG + Intergenic
1124154085 15:27209871-27209893 GTGAGGACACAGCAGGAAGGTGG - Intronic
1124362069 15:29044961-29044983 GTGTGGACACAGAAAGAAGATGG - Intronic
1124372186 15:29110223-29110245 CTGGGGACAGTGGAGGAAGCTGG + Intronic
1124700750 15:31909886-31909908 CTGGGTACCCAGAAGGCAGGGGG + Intergenic
1125190441 15:36986518-36986540 CTGGGAGCACTGAAGGAAGCTGG - Intronic
1127467311 15:59256851-59256873 CTGGGGCCTCAGAGGGAATTAGG + Intronic
1127693279 15:61418864-61418886 CAAGGGACACAGAAAGGAGTTGG + Intergenic
1127714545 15:61636719-61636741 TTGGGGACTCAGAAGGGAGGTGG + Intergenic
1127966341 15:63925437-63925459 GTGGGGTCAAAGAAGGAAATAGG - Intronic
1128368018 15:67018433-67018455 CTGGGAACACAGATGGAAGAAGG - Intergenic
1128480289 15:68031551-68031573 CTGGAGGCAGAGAGGGAAGTTGG - Intergenic
1128511540 15:68316613-68316635 CTGGGGAAAGAGAAAGAAATGGG - Intronic
1128664837 15:69530544-69530566 GCTGAGACACAGAAGGAAGTGGG + Intergenic
1128775239 15:70315509-70315531 AAGAGGACACAGAAGGATGTAGG - Intergenic
1129224150 15:74156684-74156706 CAGGAGACAGAGAAGGAAGCTGG + Intergenic
1129903024 15:79166222-79166244 CTGGGGACAGAGTAGGTTGTGGG + Intergenic
1130423155 15:83768566-83768588 CTGGGAACGTAGAAGGAACTAGG + Intronic
1130825469 15:87540572-87540594 CTGGAGACTCAGAAGGTAGGAGG + Intergenic
1130884461 15:88081641-88081663 CTGGGGGCTCAGAAGGAAGGGGG - Intronic
1131299718 15:91186696-91186718 CTGGAGACTCAGAAGGCTGTGGG + Intronic
1131653146 15:94423988-94424010 CTGGGGACAAAGCAGGAAGGAGG - Intronic
1132322237 15:100934427-100934449 CTGGGGACACAGCAGGAGTGTGG + Intronic
1132720538 16:1313601-1313623 CTGGGGCCCCAGATGGATGTGGG - Intronic
1132730956 16:1361849-1361871 CTGGGGACACAGATGGCATGAGG - Intronic
1132942798 16:2516530-2516552 CTGGGGACACAGCTGGAGGTTGG - Intronic
1133202111 16:4210041-4210063 CTGGGAACACAGAATTAAATTGG - Intronic
1133258699 16:4534644-4534666 CTGGGGAAGCAGGAGGAAATGGG - Intronic
1133441298 16:5823163-5823185 CTGGGCACATAGAGGGCAGTCGG + Intergenic
1133776836 16:8903200-8903222 CTAGTGACACGGAAGGAAGGTGG + Intronic
1134247634 16:12551841-12551863 CTGGGGACACAGGAGCAGGCAGG + Intronic
1134294127 16:12930139-12930161 CTGGGAATACAGTAGGGAGTGGG - Intronic
1135200129 16:20430030-20430052 TTGGAGACTCAGAAGGAAGAAGG + Intronic
1135253655 16:20922864-20922886 CTGGAGACCCAGAAGAAAGCTGG + Intronic
1135264389 16:21010139-21010161 CTGGGCACACAGAAGGCACTTGG + Intronic
1135346808 16:21695737-21695759 TTGGGGAAAATGAAGGAAGTGGG - Intronic
1135893991 16:26381929-26381951 CTGAGGACACAGGAGGAAGCAGG - Intergenic
1138639763 16:58375508-58375530 CTGGGGCCAAAGAAGGAGGGAGG - Intronic
1138681452 16:58686240-58686262 GTGAGGACACAGCAGGAAGATGG - Intergenic
1139090255 16:63637564-63637586 GTGGGGACATAGAGGGATGTGGG + Intergenic
1139532457 16:67549057-67549079 CTGAGGGGACAGATGGAAGTGGG + Intergenic
1140536083 16:75711352-75711374 CTGGGCACACTGAAATAAGTTGG + Intronic
1140820709 16:78660362-78660384 TTGGGGAAACAGAAGGAAATTGG + Intronic
1141461370 16:84180345-84180367 CTGGGGCCCGAGAAGGAAGGGGG + Intronic
1141780679 16:86158439-86158461 CTGGGGACACAGCATGAGGATGG + Intergenic
1143141110 17:4742308-4742330 CTGGGGACACAGCGGGTGGTGGG - Intronic
1143175237 17:4951345-4951367 CTGGGAACACCGAAGGATCTAGG + Intronic
1143443773 17:6995705-6995727 CTGGGGAGCCAGGAGGAAGTAGG - Intronic
1144249715 17:13403486-13403508 CTGGGGTACCAGAAGGAAGGTGG - Intergenic
1144274857 17:13656463-13656485 GTGGGGACACAGAGGGAAGGGGG + Intergenic
1144316054 17:14062625-14062647 CTGGGGAAACAAAAAGAAGTTGG - Intergenic
1144824529 17:18098346-18098368 CTGGGGTCATTGAAGTAAGTGGG + Exonic
1146030717 17:29363883-29363905 GTGAGGACACAGCTGGAAGTTGG - Intergenic
1147160924 17:38569064-38569086 CTGGGGGCAGTGAAGGGAGTTGG + Intronic
1147595991 17:41717805-41717827 CCGGGGATACAGAAGGGAGGAGG - Intronic
1147833731 17:43315365-43315387 CCGGGGCCACAGAGAGAAGTCGG - Intergenic
1147892485 17:43727147-43727169 CTGGGGACTCAGAATCAAGGAGG - Intergenic
1147925290 17:43942015-43942037 TGGGGGACACAGAATGAACTCGG + Intronic
1148063281 17:44851070-44851092 CAGAGGCCACAGAAGGAAGCAGG + Exonic
1148264569 17:46215275-46215297 CAGGGTTCACAGAAGGAACTGGG + Intronic
1148552403 17:48558332-48558354 CTCGGGCTACAGAAGGCAGTGGG + Intronic
1148779982 17:50115907-50115929 GTGGGGAGGCAGCAGGAAGTGGG + Intronic
1149009179 17:51836987-51837009 CTGGGGAGAAAGAAGGATGTGGG + Intronic
1149535702 17:57431817-57431839 CTGGGGGCAGAGAGTGAAGTGGG - Intronic
1150619339 17:66797693-66797715 GTGGGGACACAGAGGGGAGAAGG - Intronic
1151324163 17:73368594-73368616 CTGTGGGAACAGAAGGATGTGGG + Intronic
1151437201 17:74105139-74105161 CTGGGGACACAGTAAGGAATGGG + Intergenic
1151881095 17:76895008-76895030 CTGGCTGCACAGCAGGAAGTGGG + Intronic
1152158099 17:78648104-78648126 CTGTGGAGTCAGAAGGAAGCCGG + Intergenic
1152260454 17:79263953-79263975 CTTGAGACACACAAGGAAGAAGG + Intronic
1152348945 17:79772501-79772523 CTGGGGACAGGGAAGGAGGAAGG + Intergenic
1152551652 17:81033375-81033397 CAGGGAACACAGCAGGAAGCTGG + Intergenic
1154311019 18:13266220-13266242 CTGGGTCCACAGGAAGAAGTCGG - Intronic
1157308172 18:46531992-46532014 CTGGTGACAAAAAAGGAAGATGG + Intronic
1157626381 18:49054689-49054711 CTGGCGACACAGAGGGACTTGGG + Intronic
1158348569 18:56540743-56540765 GTGGGGACATGGCAGGAAGTGGG + Intergenic
1158432338 18:57400703-57400725 CTGGGGACACAGAATCATATAGG - Intergenic
1158554289 18:58462397-58462419 TTGGAGACTCAGAAGGAAGGTGG - Intergenic
1158627107 18:59081106-59081128 TTGGGGGCACAGCAGGAAGGTGG - Intergenic
1158768151 18:60481096-60481118 TTGGAGACTCAGAAGGAAGGAGG - Intergenic
1158808396 18:61002596-61002618 CTGAGGACACAGCAAGAAGAAGG + Intergenic
1159199692 18:65167912-65167934 CTGGGAAAACGGAAGCAAGTTGG + Intergenic
1159579427 18:70218612-70218634 CTGAGGACACAGAGAGAAGATGG - Intergenic
1160331623 18:77998081-77998103 GAGGCGACACAGAAGGAAGAAGG + Intergenic
1160495453 18:79371738-79371760 CAGGGGACACAGAAGACAGCAGG - Intronic
1160743566 19:699292-699314 ATGGGGACACAGTAGGGAGAGGG + Intergenic
1160822877 19:1066598-1066620 GTGGGGACCCAGACGGACGTGGG + Intronic
1160911195 19:1474542-1474564 CCCGGGGCCCAGAAGGAAGTGGG + Exonic
1161495448 19:4583790-4583812 CTGGGGATACAGAAACCAGTGGG + Intergenic
1161719707 19:5896046-5896068 CAAGGCACACAGAAGGAAGGCGG + Intronic
1162947788 19:14054278-14054300 CTGGGAACAGAGAGGGAAGGAGG - Exonic
1163132464 19:15283832-15283854 CTGGGGACACAAAAGGGAACAGG + Intronic
1163354438 19:16800682-16800704 CTGGGGACACATCAAGAAGATGG - Intronic
1163469376 19:17487633-17487655 CTGGGGACAGAGAGGGCAGCTGG + Intronic
1164648648 19:29876377-29876399 CAGGAGACACAGAAGGAGGCTGG - Intergenic
1164727515 19:30476184-30476206 CTGGGGCCACAGAGGGAAGAAGG - Intronic
1165141747 19:33704000-33704022 CTGGGGTCCCAGAGGGAAGTCGG + Intronic
1165412877 19:35673209-35673231 CTGGGGAGACAGAGGGAGGACGG - Intronic
1165843262 19:38802158-38802180 CTGGGGACAGAGAGGGATGGGGG + Intronic
1165846060 19:38818398-38818420 CTGGGGACACAGGTGGAAACAGG - Intronic
1166179072 19:41094477-41094499 CTGGGGACACAGAGAGAGGCTGG - Intronic
1166342340 19:42146222-42146244 CTGGAGACACAGATGGAACCAGG + Intronic
1166343301 19:42151133-42151155 CTGGGGACCCAGATGGGAGGAGG + Intronic
1166541831 19:43610843-43610865 CTGGGGACCCAGCAGGAGGGTGG - Intronic
1166552526 19:43675777-43675799 CTGGGGATAGAGATGGAGGTGGG + Intergenic
1166714897 19:44960723-44960745 CTGGAGCCTCAGAGGGAAGTGGG + Intronic
1167109203 19:47448923-47448945 CTGGGGACACAGCAGTAACCAGG + Intronic
1167366756 19:49058556-49058578 CTGGGGACCCAGAAAGATGGGGG - Exonic
1168277978 19:55287518-55287540 CTGGGGACACGGTAGGAGGATGG - Intronic
1168497894 19:56869516-56869538 CTGGGGAAATGAAAGGAAGTGGG - Intergenic
1168559096 19:57368530-57368552 CAGGGGACCCTGAAGGAAGAGGG - Exonic
925032394 2:661013-661035 GTGGGTACACAGCAGGGAGTGGG - Intergenic
925637112 2:5951165-5951187 CTGGGGAGAGAGAAGGAGGAAGG - Intergenic
926001708 2:9338729-9338751 GTGGGGACAGAGAAGCAATTGGG + Intronic
926238748 2:11069182-11069204 CTTGGCACAGAGAAGGAAGCGGG - Intergenic
926270727 2:11364166-11364188 CTGGGGATACAGAAGCAAGTAGG + Intergenic
926302769 2:11616451-11616473 CTGAGGAGACAGGAGGGAGTGGG - Intronic
926702837 2:15815308-15815330 CTGAGGAAACAGAAGGAAGGAGG - Intergenic
926990082 2:18669671-18669693 CTGGAGACTCAGAAGGGAGGAGG - Intergenic
926995626 2:18732422-18732444 CTGGAGACACAGAAGGATTGGGG + Intergenic
927195366 2:20542844-20542866 CTGGGGGCACAGATGGGAGGTGG + Intergenic
927258496 2:21061890-21061912 CTGGAGAAACAATAGGAAGTGGG - Intergenic
927399013 2:22689298-22689320 TTGGGGACACAGAATGGAGTAGG - Intergenic
927517400 2:23680349-23680371 CTGGGCATGCAGGAGGAAGTGGG + Intronic
927712096 2:25332382-25332404 CAGGGCTCAGAGAAGGAAGTCGG - Intronic
927932689 2:27055329-27055351 CTGGGAACACAGAAGCCAGAAGG - Intronic
928113107 2:28526158-28526180 CTGGGCAAACAGAAGCCAGTGGG + Intronic
928589923 2:32803519-32803541 CTGGGGAGACAGAAGTGGGTTGG - Intronic
930138660 2:47929212-47929234 CTGGGGACACAAAAATGAGTAGG - Intergenic
930932552 2:56904747-56904769 CTGGTGTCACAGAATGAATTAGG + Intergenic
931210199 2:60186476-60186498 GTGAGGACACAGAAGAAAGGTGG - Intergenic
931464845 2:62477015-62477037 CTGGGGAGAGAGAGGGAAGGAGG + Intergenic
931973461 2:67616174-67616196 CTGGGAACTCAGAAGGAACTAGG + Intergenic
933315222 2:80706815-80706837 CGGGGGAGCCAGAAGGAAGATGG - Intergenic
935720009 2:105971715-105971737 CTGGGGACAGAGGAGAAAGGGGG - Intergenic
936072787 2:109382518-109382540 CTGGGGACACAGCTGCAAGACGG - Intronic
936461324 2:112715545-112715567 CTGGGGGCTCAGAAGAAGGTGGG + Intergenic
936881942 2:117263918-117263940 CTTGCAAGACAGAAGGAAGTGGG - Intergenic
938666024 2:133538598-133538620 CTCTGGACACAGAAGTCAGTAGG - Intronic
938849413 2:135245298-135245320 CTGGGCAATCAGCAGGAAGTTGG + Intronic
939101538 2:137899983-137900005 CTTGGGGCAAAGATGGAAGTTGG + Intergenic
939545566 2:143548217-143548239 CAGGGGCAAAAGAAGGAAGTGGG + Intronic
939553129 2:143640284-143640306 ATGGGGAATCAGAAGGAAGAGGG + Intronic
943473809 2:188329700-188329722 ATGGGGACAAAGATGGAAGCAGG + Intronic
943790621 2:191928312-191928334 CTGTGGCTACAGAAGGAAGTTGG - Intergenic
943802785 2:192083266-192083288 CTGGGGACAGACTAGGAAGGGGG - Intronic
944401544 2:199332365-199332387 CAGTGGAAAAAGAAGGAAGTTGG + Intronic
945212100 2:207394437-207394459 CTGAGGTTACAGAAGGAAGGAGG + Intergenic
945406480 2:209454985-209455007 GTGGGGACACAGCAAGAAGATGG - Intronic
945837882 2:214853944-214853966 GTGAGGACACAGCAGGAAGATGG + Intergenic
946056768 2:216909778-216909800 ATGGGGAAACAGAAGGGAGATGG - Intergenic
946074739 2:217064500-217064522 CTGGGAACAGAGGAGCAAGTAGG + Intergenic
946152421 2:217785504-217785526 CCGGGGACACAGGAGGCAGAGGG - Intergenic
946593977 2:221285521-221285543 CAGGGGAGAGAGAAGGGAGTTGG - Intergenic
948167510 2:235874385-235874407 CTGGTGATGTAGAAGGAAGTTGG + Intronic
948363055 2:237436330-237436352 CTGGTGACAAAGCAGGAATTCGG - Intergenic
948687438 2:239677847-239677869 CTGAGAGCACAGAAGGCAGTGGG - Intergenic
948815503 2:240508165-240508187 CTGGGCACACAGCAGGGAGAAGG - Intronic
1169373018 20:5043179-5043201 CTGGGGAGCCAGAAGGAAGCTGG - Intergenic
1170458348 20:16554093-16554115 CTGGGTAGAAAGAAGGAGGTGGG + Intronic
1170882900 20:20313214-20313236 GTGAGGACACAGCAGGAAGGTGG + Intronic
1171247697 20:23625912-23625934 CTGGGGGCACAGAATGAGGCTGG - Intergenic
1172162020 20:32875403-32875425 CAGGGGGCACAGAAGGGAGATGG - Intronic
1172489191 20:35320719-35320741 ATGGGAAAACAGAAGAAAGTTGG + Intronic
1173518069 20:43679094-43679116 TGGGGAACACAGAAGGAAGCAGG + Intronic
1173522404 20:43709784-43709806 CGGGGGAAACAGAAGGGAGAGGG - Intronic
1173786799 20:45799758-45799780 CTGTGGACACAGCAGTAACTAGG - Intronic
1174149532 20:48476361-48476383 CTGGAGACCCAGAAAGGAGTTGG - Intergenic
1174175293 20:48640791-48640813 GTGGGCACACAGATGGAAGGAGG + Intronic
1174357112 20:50005845-50005867 CTGTGGGGACTGAAGGAAGTGGG + Intergenic
1174362910 20:50039769-50039791 CTGGGGACACAAAAGTGAGTGGG + Intergenic
1174531627 20:51219146-51219168 CTGGGGACTCAGAAGTAACCTGG - Intergenic
1174921978 20:54713098-54713120 ATGGGGACACAGAAAGAAGGTGG + Intergenic
1175178443 20:57128014-57128036 CTGGGCAGACAGAAGGGAGCAGG - Intergenic
1175248918 20:57597280-57597302 CTGGGGCCACAGCTGGAAGCCGG + Intergenic
1175272257 20:57742558-57742580 CTGGGGCCACTGGAGGAAGGAGG + Intergenic
1175482828 20:59323479-59323501 CTGGGGACATAGCAGGAACAAGG + Intronic
1175902123 20:62364072-62364094 CTGGGGACACAGCGGGAATAAGG - Intronic
1175943090 20:62546859-62546881 CTGGGGACAGACAAGGATGTAGG + Intergenic
1176155351 20:63617335-63617357 ATGAGGACACAGCAAGAAGTCGG + Intronic
1176263334 20:64194750-64194772 CTGGGGGCAAAGGTGGAAGTTGG + Intronic
1176453411 21:6884670-6884692 CTCGGGGCAAAGATGGAAGTTGG + Intergenic
1176831586 21:13749718-13749740 CTCGGGGCAAAGATGGAAGTTGG + Intergenic
1177735763 21:25086703-25086725 CTGAGGACACAGGAAGAAGAGGG + Intergenic
1177882414 21:26709846-26709868 CTGGGGACACAGGATACAGTGGG - Intergenic
1178096171 21:29218056-29218078 CTGGGGAGACTGGAGGAAGTGGG - Intronic
1178231459 21:30789759-30789781 GTGGGGACACAGCAAGAAGATGG + Intergenic
1178304621 21:31481158-31481180 GTGAGGACACAGAAAGAAGGTGG - Intronic
1179167168 21:38944242-38944264 CTGGAGTCACAGAGGGCAGTGGG - Intergenic
1179897996 21:44373917-44373939 GTGAGGGCTCAGAAGGAAGTGGG - Intronic
1180499999 22:15922412-15922434 CAGAGGACACAGAAGGAGGGAGG - Intergenic
1180764391 22:18235073-18235095 CTGGGGTCCAAGAATGAAGTAGG - Intergenic
1180771249 22:18389468-18389490 CTGGGGTCCAAGAATGAAGTAGG + Intergenic
1180802635 22:18639083-18639105 CTGGGGTCCAAGAATGAAGTAGG + Intergenic
1180853875 22:19034639-19034661 CTGGGGTCCAAGAATGAAGTAGG + Intergenic
1180958853 22:19753673-19753695 CTGGGGCCACAGAAGGGAAGGGG + Intergenic
1181219086 22:21356178-21356200 CTGGGGTCCAAGAATGAAGTAGG - Intergenic
1181349491 22:22244923-22244945 CTGGTGACACAGATGCATGTGGG - Intronic
1181535075 22:23537620-23537642 CTGGGGACCCAGAGAGAAGGAGG + Intergenic
1181584674 22:23846621-23846643 CAGCGGCCACAGCAGGAAGTGGG - Intergenic
1181907415 22:26210322-26210344 CTGGGGGCAGAGAAGGAAACAGG - Intronic
1183050331 22:35255733-35255755 CTGGGGAAACACATGGAAATGGG + Intergenic
1183778541 22:39983796-39983818 GTGGAGACCGAGAAGGAAGTGGG - Intergenic
1183951285 22:41354481-41354503 CTGGGGACACGGTGGGGAGTAGG + Intronic
1184806337 22:46796963-46796985 GTGGGGACACAGCAGGAACCAGG - Intronic
1185097525 22:48819538-48819560 CTGGGAACACAGATTGCAGTGGG - Intronic
1185391392 22:50563187-50563209 CTGGGGACACAGCAGGCAAACGG - Intergenic
949135311 3:557984-558006 CTGGGGAGACAGAAAGAATGAGG + Intergenic
949588183 3:5464238-5464260 CTGGGGGAGTAGAAGGAAGTGGG + Intergenic
949910003 3:8895724-8895746 ATGGGAACAAAGGAGGAAGTGGG - Intronic
950019981 3:9780282-9780304 CTGTGCCCAAAGAAGGAAGTGGG + Exonic
950635599 3:14312187-14312209 GTGGGGGCACACAAGGGAGTAGG + Intergenic
950847726 3:16031163-16031185 CAGGGGACACAGAGTCAAGTAGG - Intergenic
950885579 3:16359563-16359585 GTGAGGACACAGCAGGAAGGTGG + Intronic
951685611 3:25340730-25340752 CTGGAGAACAAGAAGGAAGTAGG + Intronic
952520049 3:34147560-34147582 CTGGGGTGAGAGCAGGAAGTGGG + Intergenic
952552955 3:34499698-34499720 TTAGGGACATGGAAGGAAGTTGG + Intergenic
952821793 3:37492304-37492326 CCTGGGACACACATGGAAGTCGG - Intronic
953228970 3:41046404-41046426 CTGGGGAAACTGGAGGAAGGGGG - Intergenic
953235698 3:41104197-41104219 CTGGGGACACAGAAAGGGGCGGG + Intergenic
954349096 3:50027498-50027520 CTGGGGGTAGAGAAGGAAGTAGG - Intronic
954966350 3:54614586-54614608 CTGGGGAATGAGAAGGAAGGAGG - Intronic
955514535 3:59713655-59713677 CAGGAGACAGAGAGGGAAGTAGG + Intergenic
956055051 3:65289928-65289950 CTGGGGACACAAGAGGAAATGGG - Intergenic
959167142 3:102794566-102794588 CTGGAAACACAGAAGGGAGAAGG - Intergenic
959605878 3:108241652-108241674 CTGGTGACCCAGATGGAATTGGG + Intergenic
959911365 3:111767249-111767271 CTTGGTACACAGAAGGATTTGGG + Intronic
960029392 3:113042112-113042134 ATGAGGACACTAAAGGAAGTGGG - Intergenic
960844248 3:121992504-121992526 AGGGGAACACAGAAGGAAGTAGG - Intronic
961506642 3:127374741-127374763 CTGGGGACACAGCAGGTCCTGGG - Intergenic
961609311 3:128123929-128123951 CCGGAGACACAGACGGAAGTGGG - Intronic
961647414 3:128400076-128400098 GTGGGGAGACAGAAAGAAGGGGG - Intronic
961673658 3:128551869-128551891 TCTGGGACACAGAAGGAGGTGGG - Intergenic
961683273 3:128613051-128613073 CTGGGGATACAGTCGGGAGTGGG - Intergenic
961928705 3:130510957-130510979 CCAGGGACAGAGAAAGAAGTGGG - Intergenic
962342737 3:134598757-134598779 CTGGGGACCCAGGAGGAGTTGGG + Intronic
962387541 3:134944120-134944142 CTGGGGCCATAGAGGGAAATGGG - Intronic
962602987 3:137009370-137009392 CTGGGGCCACTGAAAGAAGATGG + Intronic
962751325 3:138436327-138436349 ATTAGGACACAGAAGGAAGACGG - Intronic
963060002 3:141217771-141217793 AAGGGGACAGAGTAGGAAGTGGG - Intergenic
963067002 3:141271928-141271950 CTGTCGCCACAGAAGGAAGTGGG + Intronic
963777551 3:149454317-149454339 CTGGAAACATAGAAGGAAATAGG - Intergenic
964967710 3:162518284-162518306 CTAGGGGTACAGAAGGAAGCTGG - Intergenic
965682479 3:171265746-171265768 CTGGGGAAACAGAGGGAAAGTGG + Intronic
965962449 3:174444270-174444292 GTGGGGGCACAGATGGAGGTGGG + Intronic
966008459 3:175047012-175047034 CTGAGGACACAGTAAGAAGATGG - Intronic
966648183 3:182270087-182270109 CTGGGGGCACAGACGTGAGTAGG + Intergenic
968646536 4:1743962-1743984 CTGGGGGCACTGCAGGAAGAAGG + Intronic
969629933 4:8330117-8330139 CAGGGGACTGAGAGGGAAGTGGG + Intergenic
970209876 4:13698069-13698091 GTGAGGACACAGCAAGAAGTTGG - Intergenic
970815377 4:20150094-20150116 GTGGGGACACAAAAGGAGGAAGG - Intergenic
971676425 4:29635354-29635376 CTGGAGACCCAGAAGGATGAGGG + Intergenic
972349721 4:38225531-38225553 CAGGGGACCCAGAAGGCAGAAGG - Intergenic
972368071 4:38394500-38394522 CAGGGGACAAAGAAGGAAAGGGG + Intergenic
972369950 4:38413746-38413768 CTGGGGAGGAAGGAGGAAGTTGG - Intergenic
974218756 4:58936912-58936934 CTGAGGAAAGAGAAAGAAGTAGG + Intergenic
974425473 4:61737466-61737488 CTTGGGAGTCAGAAGGACGTGGG + Intronic
975049782 4:69847667-69847689 CTGGGAACACATAAGCAACTTGG - Intronic
975157778 4:71090851-71090873 CCAGGGATGCAGAAGGAAGTTGG + Intergenic
975224054 4:71849045-71849067 CTGAAGAGACAGAAGGGAGTGGG - Intergenic
977303332 4:95293686-95293708 CTGGGTACAAAGAAGGGAGGAGG - Intronic
978010323 4:103674406-103674428 CTGTGGAAATAGATGGAAGTAGG + Intronic
978655557 4:111061676-111061698 CTGGGGACAAAGAATGAGGATGG + Intergenic
980766550 4:137313710-137313732 CTGGGGAGACATAATGAACTTGG + Intergenic
981889768 4:149721447-149721469 CTGGAGACTCAGAAGGGAGGAGG - Intergenic
982610919 4:157574272-157574294 CTGCTGACTCAGAAGGGAGTGGG - Intergenic
985096406 4:186416933-186416955 CAGGAGACAGAGAAGGAAGCTGG + Intergenic
985505654 5:278820-278842 CTGGGGACACAGGAGGGTGCTGG + Intronic
987397988 5:17443576-17443598 CAGGGGAGACAGAAGGGAGATGG - Intergenic
989112745 5:37922969-37922991 CTGAGAACTCAGAAGGAAGAAGG - Intergenic
989246805 5:39264290-39264312 GTGAGGACACAGCAAGAAGTTGG + Intronic
989304834 5:39941767-39941789 CTGAGAACACAGCAAGAAGTTGG - Intergenic
989973639 5:50555403-50555425 ATGGGGATAGAGAAGGAAGTGGG - Intergenic
991996425 5:72391521-72391543 ATGAGGACACAGAAAGAAGGTGG + Intergenic
991998004 5:72407439-72407461 CTGTGGAGACAGAATAAAGTAGG + Intergenic
992426472 5:76662889-76662911 TTGGGGTGACAGAAGTAAGTGGG + Intronic
993691570 5:91007404-91007426 CAGGGGAGAGAAAAGGAAGTAGG - Intronic
994016738 5:94975429-94975451 CTGAGCACACAGCAGGAAGGTGG + Intronic
994984991 5:106921105-106921127 GTGAGGACACAGAAAGAAGGTGG - Intergenic
995992782 5:118263191-118263213 TTGGGGACACAGGGAGAAGTTGG - Intergenic
996182894 5:120441797-120441819 TTGTTGAGACAGAAGGAAGTAGG - Intergenic
996486598 5:124042268-124042290 CTGGGGAGCCAGAAGGGAGATGG - Intergenic
997892761 5:137689658-137689680 CTGGGGACTCCAAAGGGAGTGGG + Intronic
998158955 5:139802288-139802310 CTGGGCAGACAGAAGGGAGGAGG + Intronic
998504482 5:142660907-142660929 CTGGAGCCAGAGAAGGAAGGAGG - Intronic
998679883 5:144455236-144455258 ATGTGGAAGCAGAAGGAAGTTGG - Intronic
999327893 5:150654698-150654720 ATGGAGATACAAAAGGAAGTCGG - Intronic
999571851 5:152927556-152927578 CAGGTGACACAGAAGGAGTTAGG + Intergenic
1000197306 5:158972182-158972204 CTGGGGACACAGATTGAGGTGGG - Intronic
1002059147 5:176616159-176616181 GTGGGCACACAGTAGGAGGTAGG + Intergenic
1002180261 5:177427473-177427495 TAGCGGACACAGAAAGAAGTGGG + Intronic
1002205248 5:177558325-177558347 CTGGGGAGAGAGGAAGAAGTAGG - Intergenic
1002439286 5:179256021-179256043 CTGGGGACAGAGAAGGAGACTGG - Intronic
1003240372 6:4340347-4340369 CTGGGGACACAGAATAAACTGGG + Intergenic
1003311191 6:4971215-4971237 GTGAGGACACAGCAGGAAGGTGG - Intergenic
1004013756 6:11713371-11713393 GTGTGGACACTGAAGGAAATTGG - Intronic
1004288929 6:14348971-14348993 GTGAGGACACAGCAGGAAGGCGG - Intergenic
1004475602 6:15968322-15968344 CTGGGGCTGCAGAAGGAAGATGG + Intergenic
1004829521 6:19462407-19462429 CTGGTGACATAGGAGGAATTAGG - Intergenic
1005609399 6:27509226-27509248 TTTGGGAGACAGAAGGGAGTTGG + Intergenic
1006083699 6:31581743-31581765 CTGGGGACGCAGCAGGGAGCTGG + Intronic
1006375753 6:33670916-33670938 CTGGGGACACAGAAGGAAGTGGG - Intronic
1006634263 6:35451168-35451190 CTGAGGTCACAGAAAGGAGTTGG - Intergenic
1006646968 6:35521528-35521550 CTGTTAACACAGAGGGAAGTAGG - Intergenic
1007428545 6:41762894-41762916 CTGGGGACAGAGCAGCAAGGAGG - Intergenic
1008503589 6:52207677-52207699 GTGGGGACACAGGAGGAAATTGG + Intergenic
1008541436 6:52549703-52549725 CTGGGGCAAGAGAAGGAAATGGG + Intronic
1009288336 6:61851583-61851605 CTAAGGACACAGCAGGAAGATGG + Intronic
1009323345 6:62318304-62318326 GTGAGGACACAGCAGGAAGATGG + Intergenic
1010017121 6:71117898-71117920 GGAGGGACACAGTAGGAAGTAGG + Intergenic
1013376014 6:109515005-109515027 GTGGGGACACAGATAGAAGGTGG + Intronic
1013380629 6:109566704-109566726 CTGGAGACTCAGAAGGGAGCAGG + Intronic
1013822150 6:114167373-114167395 CTGTAGACACAGTAGTAAGTAGG + Intronic
1013895116 6:115078717-115078739 CTGGAGCCAGAGAAGGGAGTGGG + Intergenic
1014069661 6:117166891-117166913 CTGGAGACACAGAAGAGAGGTGG - Intergenic
1014074211 6:117218164-117218186 GTAAGGACACAGAAGGAAGGTGG - Intergenic
1014688636 6:124533870-124533892 GTGAGGACACAGAGGGAAGATGG - Intronic
1014707205 6:124762222-124762244 ATGAGGACACAGAAAGAAGGTGG - Intronic
1014813041 6:125906666-125906688 CTGGGGAGAGAGGAGGAAGAGGG + Intronic
1015330889 6:131977890-131977912 CTGGGGGCTCAGAAGGAAGAGGG - Intergenic
1015587533 6:134790771-134790793 ATGGGGAGACAGAACAAAGTTGG + Intergenic
1015935235 6:138402300-138402322 CTGGGGACAGGGAAGGAGGCAGG + Intergenic
1016385572 6:143527611-143527633 CTGGGCACACAGAAGTGAATAGG - Intergenic
1017743520 6:157427168-157427190 CTGGGAGCACAGGAGGAAGGAGG + Intronic
1018596102 6:165482344-165482366 CTGGGGATAGAGAAGGAAGAGGG + Intronic
1019558349 7:1643576-1643598 CTGGGGACTCAGAGGGAATGGGG + Intergenic
1019819680 7:3233258-3233280 CGGGGGACACAAAAGCAAGTGGG - Intergenic
1020241196 7:6396419-6396441 CTGGGGACGAAGAAGGAACAAGG + Intronic
1020762270 7:12283299-12283321 CAGAGGACACAGGAAGAAGTTGG - Intergenic
1020777627 7:12474188-12474210 GAGGGGCCAGAGAAGGAAGTGGG + Intergenic
1021121113 7:16796830-16796852 TGGGGGACAGAGAAGGAAGTGGG + Intronic
1021274725 7:18636265-18636287 CAGGGGACACAGCAGTAAGAGGG - Intronic
1021678118 7:23101580-23101602 CTGGGGACACAAAGAGAAATGGG - Intergenic
1023238374 7:38115093-38115115 CTGGGTATACAGAAGGGATTAGG - Intergenic
1024480833 7:49860849-49860871 GTGAGGCCACAGAAGGAAGGTGG + Intronic
1024932683 7:54680391-54680413 CTGGGGACACAGAAGGTGGTGGG - Intergenic
1024962624 7:54993727-54993749 CTGGAGAGACAGAAGAATGTGGG - Intergenic
1024979719 7:55147080-55147102 CTGGAGACTCAGAAGCATGTAGG - Intronic
1025635805 7:63318164-63318186 GTGGGGACACTGCAGGAAGCCGG - Intergenic
1025646891 7:63430016-63430038 GTGGGGACACTGCAGGAAGCCGG + Intergenic
1026116793 7:67502599-67502621 ATGAGGACACAGCAGGAAGGTGG - Intergenic
1026289083 7:68989791-68989813 ATGGAGACACAGATGGAAGAAGG - Intergenic
1027343747 7:77236742-77236764 CTGAGGACACAGAATGTACTGGG + Intronic
1028417330 7:90595195-90595217 CAGGGGAGAGAGAAGGAAGGTGG - Intronic
1029435764 7:100563248-100563270 TTCGGGACACAGAAGGGACTGGG - Intronic
1029712884 7:102309126-102309148 CTGGGGACCTGGAAGGAAGTTGG + Intronic
1030658725 7:112196323-112196345 TTGGTGACAGAGAAGGAGGTAGG - Intronic
1030675919 7:112385166-112385188 CTGGGCATAAAGAAGGGAGTGGG - Intergenic
1032543166 7:132721148-132721170 CTGGTGATTCAGAAGGAAGCAGG - Intronic
1032762453 7:134956506-134956528 ATGAGGACACAGCAGGAAGGTGG + Intronic
1032990263 7:137386686-137386708 CTGGGGACACAGAAAAGGGTAGG + Intronic
1034356288 7:150453010-150453032 CTGGGGACACAGAACAAAACAGG + Intronic
1034405865 7:150902105-150902127 CAGGACACACAGAAGGAAGGAGG + Intergenic
1034590250 7:152132312-152132334 CTGAGGACACAGGAGCAAGCAGG + Intergenic
1034741705 7:153479487-153479509 CTGGGGACAGAGACGTAAGGTGG - Intergenic
1034748618 7:153547083-153547105 CTGGTGAGACAGAAGGAAGGAGG - Intergenic
1034827067 7:154275292-154275314 GAGGGGACACAGAGGGAAGGAGG - Intronic
1035219521 7:157397571-157397593 ATGGGGACACAGGAGGAAATCGG - Intronic
1035892500 8:3360483-3360505 CTGGGGAAACAGCAAGAAGGAGG - Intronic
1035954901 8:4066224-4066246 CAGGAGACAAAGAAGGAAGGAGG - Intronic
1036410644 8:8496948-8496970 GAGGTGACACAGAAAGAAGTAGG + Intergenic
1036727098 8:11230117-11230139 CTGGTGCTTCAGAAGGAAGTGGG + Intergenic
1036814300 8:11889689-11889711 TTGGGCAGACAGTAGGAAGTGGG - Intergenic
1037250992 8:16894065-16894087 CTGGAGACTCAGAAGGGAGGAGG - Intergenic
1037422949 8:18723592-18723614 CTGGAGATACAGAAGGAACAGGG - Intronic
1037531996 8:19785806-19785828 CGGGGGACACAGCAGAGAGTTGG - Intergenic
1037734711 8:21556710-21556732 CTGGGGCCACAGAAGCAGATGGG - Intergenic
1038214870 8:25552299-25552321 CTGAGGGGTCAGAAGGAAGTGGG + Intergenic
1038286840 8:26212819-26212841 CTGAGGACACAGTAAGAAGACGG + Intergenic
1038346296 8:26735440-26735462 CTGTGGACAAAGTAGGATGTGGG + Intergenic
1039178064 8:34832017-34832039 CTGCTGAGACAGAAAGAAGTGGG - Intergenic
1039438947 8:37581394-37581416 CTGGGGGCACAGAAGGAACATGG - Intergenic
1039740600 8:40379391-40379413 ATGGGGAGACAGCAGGCAGTGGG + Intergenic
1039921660 8:41897466-41897488 CTTGGGACAGAAAAGGAAGTAGG + Intergenic
1041277492 8:56177884-56177906 CTGGGGACACAGAAGCAGTACGG - Intronic
1041970953 8:63742172-63742194 CTGAGGACACAGCACGAAGGTGG + Intergenic
1042533366 8:69835707-69835729 CTGCGGGCACAGAAGTGAGTTGG + Intergenic
1043769278 8:84177489-84177511 CAGGGGAAAAAGAAGGAATTTGG + Intergenic
1044086204 8:87945125-87945147 CTGGAAACACAGAAGAAACTTGG + Intergenic
1044378085 8:91499953-91499975 CTGGGGACAAGGATGGCAGTGGG - Intergenic
1044627190 8:94245578-94245600 GAGGGGACACAGAGGGAAGAAGG - Intergenic
1045054901 8:98360381-98360403 ATGGAGACACAGAGGGAAGAAGG - Intergenic
1045355920 8:101388996-101389018 ATGGGGACAGAGAAGGAGGATGG - Intergenic
1045646942 8:104308454-104308476 GTGAGGACACAGCAGGAAGGCGG + Intergenic
1045705728 8:104920375-104920397 CTGGGGTCCCAGAAGGATGTGGG + Intronic
1046264049 8:111807778-111807800 GTGAGGACACAGAGAGAAGTTGG - Intergenic
1046843315 8:118885707-118885729 CTGAGAACAAAGAAGGTAGTTGG + Intergenic
1047068488 8:121314849-121314871 CTAGGAACAAAGAAGAAAGTTGG - Intergenic
1047106078 8:121731900-121731922 TTGGAGACTCAGAAGGAAGAGGG - Intergenic
1047893787 8:129342995-129343017 ATGGAGACACAGTAGGAAGGAGG + Intergenic
1048334052 8:133490094-133490116 CTTTGGGCAGAGAAGGAAGTTGG + Intronic
1048879166 8:138859016-138859038 CTGGGGACCGAGAAGGGAGATGG - Intronic
1048952666 8:139509217-139509239 TTGAGGACACAGAAGGAATAGGG + Intergenic
1048968304 8:139629728-139629750 CTGGGGACACAGCAGGAAGGTGG - Intronic
1048982864 8:139712472-139712494 CTGGGGACCCAGAAGGTACGTGG - Intergenic
1049427976 8:142545721-142545743 CTGGAGACACAGAGGGAAGCAGG - Intergenic
1049983225 9:923938-923960 CTTGGAACAGAGAAGTAAGTGGG + Intronic
1051740627 9:20248487-20248509 GTGAGGACACAGCAGGAAGATGG - Intergenic
1052081925 9:24216838-24216860 CTGGAAAAAAAGAAGGAAGTTGG - Intergenic
1053018157 9:34675837-34675859 CTGGGGTGTCAGAGGGAAGTAGG + Intergenic
1053039930 9:34862046-34862068 GTGAGGACACAGCAAGAAGTTGG - Intergenic
1053282954 9:36832923-36832945 CTGGGGACACAGAAGTGAACAGG - Intergenic
1054988871 9:71297750-71297772 CTGGGGCAACTGAAGGAACTTGG - Intronic
1055359171 9:75470861-75470883 CTGGGCACATAGTAGGAACTTGG - Intergenic
1055520954 9:77080687-77080709 GTGGGAACACAGAAAGAAGATGG - Intergenic
1055644000 9:78345915-78345937 TAGGGGACACAGGAAGAAGTGGG + Intergenic
1055803755 9:80069598-80069620 GTGAGGACACAGCAAGAAGTTGG + Intergenic
1056818313 9:89817661-89817683 ATGTGGAAACAGAAGGAAGGAGG + Intergenic
1056906142 9:90649547-90649569 ATGAGGACACAGCAGGAAGGTGG + Intergenic
1057164634 9:92916087-92916109 CTGGCTACACAGAATGATGTTGG - Intergenic
1057221235 9:93259083-93259105 CTGGGGACGCAGGGGGGAGTGGG - Exonic
1057718780 9:97516285-97516307 CTGGGAACACAGAGAGATGTGGG + Intronic
1057974748 9:99593534-99593556 CTGTGAACACAGAAAGAATTAGG + Intergenic
1058587462 9:106525602-106525624 CTGGAGACTCAGAAGGGGGTGGG + Intergenic
1058892316 9:109371481-109371503 TTGAGGACACAGCAGGAAGATGG + Intergenic
1059529573 9:115023498-115023520 CTGAGGTCACAGAGTGAAGTTGG - Intronic
1059591978 9:115671714-115671736 CTGGAGACAGAGAAAGCAGTTGG + Intergenic
1059668445 9:116471571-116471593 AGAGGGACAGAGAAGGAAGTTGG + Intronic
1059740216 9:117142854-117142876 CTGGAGACACAGATGGAGGGAGG - Intronic
1059985033 9:119813383-119813405 ATGGGGACACGGCAGGCAGTGGG - Intergenic
1060494164 9:124105718-124105740 AAGGGGACACAGAGGGAAGGAGG - Intergenic
1060751061 9:126169860-126169882 CTGGGGACAGAGGAGGAACCTGG + Intergenic
1061249062 9:129415999-129416021 CTGGGGACACAGCTGGAAGATGG + Intergenic
1062075887 9:134589816-134589838 CTGAGGAGACAGCAGGAGGTGGG - Intergenic
1062277282 9:135736932-135736954 CTGGAGACACGGCAGGAAGCAGG - Intronic
1062305187 9:135902013-135902035 CTGTGGACACAGCAGTAAGTGGG + Intronic
1187257894 X:17657889-17657911 CTATGAACACAGTAGGAAGTTGG - Intronic
1187723024 X:22171567-22171589 CTAGGGTCACAGAAGGGAGGAGG - Intronic
1187723100 X:22172455-22172477 CTAGGGTCACAGAAGGGAGGAGG + Intronic
1187877536 X:23816565-23816587 CTGGGGACACAGCAGTGAGGAGG + Intergenic
1188303982 X:28539840-28539862 ATGCAGACACAGAAGGAAGATGG + Intergenic
1189775943 X:44470245-44470267 GTGAGGACACAGCAAGAAGTTGG + Intergenic
1190149138 X:47927935-47927957 CTGGGCTCACAGAATGAATTGGG + Intronic
1191764488 X:64682365-64682387 CAGGGGACACAGGAGGAAGGGGG + Intergenic
1192542969 X:71990641-71990663 CTGGAGGCACAGAAAGTAGTAGG - Intergenic
1193669934 X:84372111-84372133 CTGTTGAGACAGAAAGAAGTGGG + Intronic
1194077222 X:89411154-89411176 TTAGGGAAAGAGAAGGAAGTTGG - Intergenic
1194695109 X:97038013-97038035 CTGGAGACTCAGAAGGGGGTAGG - Intronic
1196006540 X:110843316-110843338 CAGAGGAAACAGTAGGAAGTGGG - Intergenic
1198174176 X:134138907-134138929 GTAGGTACACAGAAGGAAATTGG + Intergenic
1198507266 X:137313025-137313047 CTTGGGGCACACAAGGATGTAGG + Intergenic
1198527668 X:137518520-137518542 CTGGGGAGACTGAAAGTAGTAGG + Intergenic
1198530548 X:137547018-137547040 CTGGGGACAGAGGAGGTGGTAGG + Intergenic
1200429868 Y:3066699-3066721 TTAGGGAAAGAGAAGGAAGTTGG - Intergenic
1200592778 Y:5097643-5097665 TTGGGGAAAGAGAAGGAAGGTGG + Intronic
1200910060 Y:8523971-8523993 ATGGGGAGCCAGAAGGAAGATGG - Intergenic
1202111115 Y:21421701-21421723 ATGGGGACCCAGAAGGCAGATGG + Intergenic