ID: 1006377896

View in Genome Browser
Species Human (GRCh38)
Location 6:33681840-33681862
Sequence TCCAGGGCAATGAGGGTGAT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 209
Summary {0: 1, 1: 0, 2: 2, 3: 12, 4: 194}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1006377887_1006377896 -6 Left 1006377887 6:33681823-33681845 CCCCATCCTTGATCAGCTCCAGG 0: 1
1: 0
2: 1
3: 36
4: 231
Right 1006377896 6:33681840-33681862 TCCAGGGCAATGAGGGTGATGGG 0: 1
1: 0
2: 2
3: 12
4: 194
1006377889_1006377896 -7 Left 1006377889 6:33681824-33681846 CCCATCCTTGATCAGCTCCAGGG 0: 1
1: 0
2: 0
3: 15
4: 159
Right 1006377896 6:33681840-33681862 TCCAGGGCAATGAGGGTGATGGG 0: 1
1: 0
2: 2
3: 12
4: 194
1006377891_1006377896 -8 Left 1006377891 6:33681825-33681847 CCATCCTTGATCAGCTCCAGGGC 0: 1
1: 0
2: 1
3: 19
4: 225
Right 1006377896 6:33681840-33681862 TCCAGGGCAATGAGGGTGATGGG 0: 1
1: 0
2: 2
3: 12
4: 194

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1006377896 Original CRISPR TCCAGGGCAATGAGGGTGAT GGG Intronic
900389733 1:2428750-2428772 TCCAGGGCCCTGAGGCTGAGGGG + Intronic
903031808 1:20469073-20469095 TACATGGCAATGATGGTGCTGGG + Intergenic
903286209 1:22278336-22278358 TACAGGGCAGTGAGAGTGAGAGG - Intergenic
904328982 1:29745601-29745623 TCCAGGGGAAGGAGGGTGGCCGG + Intergenic
904647932 1:31982276-31982298 TCCAGGGCAAAGAGGGTGTGGGG + Intergenic
907802332 1:57782264-57782286 ACCAGTGTAATGAGGTTGATTGG - Intronic
908508236 1:64827365-64827387 CCCAGGGGCATGAGGGTGAGGGG + Intronic
911629560 1:100167054-100167076 TCTAGGGGAATGAGACTGATTGG - Intronic
914806491 1:150995804-150995826 TCCTGGAGAATGAGGGTGAGGGG - Intergenic
916120763 1:161525983-161526005 TCCAGGTGTATGAGGGTGAGAGG + Exonic
916792794 1:168138013-168138035 CCCAGAGCAATGTGGGTGTTTGG - Intergenic
918263074 1:182814103-182814125 TCCAGGTCAATCATGGTGCTGGG - Intronic
920136218 1:203771343-203771365 TGCAAGGCAATGAGAGAGATGGG - Intronic
921579748 1:216882176-216882198 TCCAAGGTTATGTGGGTGATGGG + Intronic
923289679 1:232532133-232532155 TCCAGGCAAGAGAGGGTGATGGG + Intronic
923924069 1:238603350-238603372 TCTGGGGTAGTGAGGGTGATGGG + Intergenic
1062873471 10:927116-927138 ACCAGGGCAATGGGGTTGATGGG + Intronic
1063654476 10:7974232-7974254 TCAAGGGTCATGAGGGGGATGGG - Intronic
1063726939 10:8647711-8647733 TCCAGGGCAGTGTGAGCGATGGG + Intergenic
1063916256 10:10885871-10885893 TGCAGGAGAATGAGGGTCATAGG - Intergenic
1067655491 10:48188505-48188527 TCCAAGGCACTGAGGGTAAAGGG + Intronic
1067720581 10:48724916-48724938 TACTGGGCAATGATGGTGACAGG + Intronic
1068777301 10:60881834-60881856 TTGAGGGCATTGAGGGTGTTTGG - Intronic
1069117395 10:64525115-64525137 TACAGGGCAAAGAGTGTGAGGGG - Intergenic
1071248417 10:83790720-83790742 TCCTGGGACATGGGGGTGATAGG - Intergenic
1074155905 10:110799240-110799262 TCCAGGGAAATGTGGGTTAGTGG + Intronic
1074471395 10:113730201-113730223 CCCAGGGCTATGAGGATAATGGG + Exonic
1075686699 10:124369337-124369359 CCCAGGGCAGTGAGGGGGATTGG + Intergenic
1076507609 10:130988131-130988153 TCCAGGGCCGGGAGGGTGGTAGG - Intergenic
1076572361 10:131441104-131441126 GGCAGGGCAATGAGGGTGGGAGG - Intergenic
1076623798 10:131809402-131809424 TCCTGGGCACTGGGGGTGAATGG - Intergenic
1077028845 11:454283-454305 CCCAGGGCCAGGAGGGTGCTGGG + Intronic
1077316204 11:1920471-1920493 TCCAGGGCAGGGAGGGTGGGTGG - Intronic
1077760863 11:5095787-5095809 TCCAGGGGAGAGAGGATGATGGG - Intergenic
1078534234 11:12160434-12160456 TCCAGGCCAAGGAGGGGGACTGG - Intronic
1078893347 11:15577144-15577166 TCCAGGACTATGAGGGTCAGAGG - Intergenic
1078931521 11:15915591-15915613 TCCAGGGAAATGAGGGTTCAGGG + Intergenic
1080580048 11:33634862-33634884 TCCAGGGCTATGAGGATGTGAGG - Intronic
1082932608 11:58624320-58624342 TCCCCCGCAATGAGGCTGATGGG + Exonic
1085011868 11:73146910-73146932 TGCAGGGCCAGGAGGGTCATAGG + Intergenic
1085056052 11:73404699-73404721 TCTAGGCCAAGGAGGCTGATGGG + Intronic
1085332338 11:75664023-75664045 GCCAGGGCAATGGGGTTGACTGG + Intronic
1086984632 11:93234462-93234484 TCCAGGGCAATGGGAGGGGTGGG + Intergenic
1087094268 11:94305168-94305190 TCCTGGGCTATGAAGGTGAGGGG + Intergenic
1087893972 11:103567041-103567063 TCCAGGGCAATGTGCCTGAATGG + Intergenic
1089744237 11:120605878-120605900 GCCAGGTCAATGAGGCTGGTGGG + Intronic
1090652835 11:128822686-128822708 GCCATGGCAATGAGGGAGACAGG + Intergenic
1092280940 12:7097130-7097152 TTCTGGGCAATGGGGGTGACTGG + Exonic
1098385063 12:69909777-69909799 TCCAGGGGAAGGAGGGTGGCTGG + Intronic
1100287919 12:93184887-93184909 TCAAGAGCAATGAAGGTCATAGG - Intergenic
1101269273 12:103126019-103126041 TCCAGGGCAGTGAGTGCAATTGG + Intergenic
1101826460 12:108224255-108224277 CCCAGGGCAATGAGAGGGAGAGG + Intronic
1102814950 12:115858224-115858246 AGCAGGACAAGGAGGGTGATGGG - Intergenic
1103882092 12:124173972-124173994 TCTAGGACATAGAGGGTGATCGG + Intronic
1104265907 12:127232249-127232271 TCCAGGGCTTCGAGGGTGGTGGG + Intergenic
1104807341 12:131598115-131598137 TCCTGGGCGATTAGGGTGACTGG - Intergenic
1104963372 12:132498496-132498518 TCCAGGGAAATGAGGAGGATGGG + Intronic
1106296937 13:28422956-28422978 TCCATGGCAAGGAGGTTGGTTGG - Intronic
1106577878 13:30992723-30992745 TCCAGAGAAATGAGGGAGACTGG + Intergenic
1108100480 13:46948831-46948853 TCCTGAGCAATAAGGGAGATAGG + Intergenic
1108775558 13:53761340-53761362 TCCAGGGCAATGGGTGTCACTGG - Intergenic
1109035960 13:57260573-57260595 TCCAGAGGACTGGGGGTGATAGG - Intergenic
1109352441 13:61202105-61202127 TCCAAGGCTATGAGTGTGTTGGG + Intergenic
1109964678 13:69676530-69676552 CCCTGGACATTGAGGGTGATAGG - Intergenic
1110130280 13:72000816-72000838 TCCAAGGCAAGCAGGGTGATGGG + Intergenic
1112428116 13:99323477-99323499 ACCAAAGCCATGAGGGTGATGGG + Intronic
1113876437 13:113597593-113597615 TACAGGGCAGTGAGGGAGAAAGG + Intronic
1117427238 14:55613341-55613363 TCCAGGGAAAGGGGGTTGATAGG + Intronic
1119615193 14:76094376-76094398 TCCAAGGCAATGGGGGTGAGGGG + Intergenic
1120850489 14:89164810-89164832 TCAAGGCCCATGAGGGTGACAGG - Intronic
1121175475 14:91887686-91887708 TCCAAGTCAGTGAGGGTGAGGGG - Intronic
1121667481 14:95684315-95684337 ACCTGGCCAAAGAGGGTGATCGG + Intergenic
1121956721 14:98220040-98220062 TCCAGGGCACTGACTGTGACCGG + Intergenic
1128157910 15:65403382-65403404 TCCAGGGGACTGAGGGTGGGAGG + Intronic
1129206952 15:74043046-74043068 TCCAGGACCCTGAGGGTGCTGGG - Exonic
1130037176 15:80371461-80371483 TCCATGGCAATGAAAGTGCTTGG + Intronic
1131032178 15:89195497-89195519 TCCAGGTCACTGAGGGAGATGGG - Exonic
1131040566 15:89261687-89261709 GCCAGGGCAGTGAGAATGATAGG - Exonic
1131850040 15:96530662-96530684 TCAAGGGCAATGAGAGTGGGAGG + Intergenic
1132351159 15:101140577-101140599 TCCAGGGCAATGAGCTGGTTGGG + Intergenic
1133872364 16:9701322-9701344 TCCAGGCCAATGAGGGTCATAGG + Intergenic
1133921180 16:10154520-10154542 TTCAGGGCACTGAGGATGCTGGG - Intronic
1135100082 16:19597493-19597515 TGCAGGGCAGTGAGGTGGATGGG + Intronic
1136242915 16:28955550-28955572 TCCAGTGAAATGGGGGTTATTGG + Intronic
1136862787 16:33713102-33713124 GCCAGGGCCATCAGGGTCATTGG - Intergenic
1137671630 16:50282660-50282682 GCCAGCCCCATGAGGGTGATAGG + Intronic
1137692477 16:50438637-50438659 TACGGTCCAATGAGGGTGATGGG + Intergenic
1138455282 16:57117388-57117410 TCCAGGGCTAGGAGGGGGAAGGG - Intronic
1139570717 16:67810219-67810241 GCCAGGGTTATGAGGGTGAAAGG - Intronic
1140467817 16:75196417-75196439 TGCTGGGCAGTGAGGGTGCTGGG - Intergenic
1141021031 16:80496768-80496790 TCCTGAGCAATCAGGGTGCTAGG + Intergenic
1141743818 16:85912817-85912839 TCCAGGGCGTTGAGGGCAATTGG + Intronic
1142327152 16:89423140-89423162 TCCTGGGCTCTGAGGGTGTTGGG - Intronic
1142713992 17:1738119-1738141 TCCAGGGCACTGATGGTGCTTGG + Exonic
1143543185 17:7581527-7581549 CCCAGGGCACTGAGGGGGTTGGG + Exonic
1144628070 17:16855379-16855401 CCCAAAGCAATGAGGGTGTTAGG + Intergenic
1145159662 17:20565963-20565985 CCCAAAGCAATGAGGGTGTTAGG + Intergenic
1146403493 17:32518721-32518743 TCCAGGACAAAGAGGGTTCTGGG + Intronic
1147523463 17:41197273-41197295 CCCAGGGGAAGGAGTGTGATGGG - Intronic
1147744312 17:42685844-42685866 CCCAGGGCAATCAGGGAGAGTGG - Intronic
1148153335 17:45409313-45409335 CCCAGGCCAGTGAGGCTGATGGG + Intronic
1148975316 17:51522517-51522539 TTCAAGGCAAAGAGGGCGATGGG + Intergenic
1151895888 17:76980722-76980744 TACAGGGCCATGTAGGTGATGGG - Intergenic
1152885512 17:82846833-82846855 TCCCAGGCAATGAGGGTGGGTGG - Intronic
1154121942 18:11659262-11659284 GCCAGGGCAACAAGGGTGACTGG - Intergenic
1157060266 18:44279916-44279938 TAGAGGGCAATGAGGGAGAAAGG + Intergenic
1157582429 18:48781364-48781386 TCTAGGGCAAAGAGGGTGCGGGG + Intronic
1158488897 18:57892651-57892673 TCCTGAGCAATGGGGGTGCTAGG + Intergenic
1159582983 18:70253668-70253690 TCCAGGGTGCTGAGGGTGAAGGG - Intergenic
1159888757 18:73935408-73935430 ACCAGGACAATGAGGGTAAGGGG + Intergenic
1160939764 19:1614757-1614779 CCCTGGGAAATGGGGGTGATAGG + Intronic
1161440756 19:4290426-4290448 TCCTGGGCGATGAGGGAGAAAGG - Exonic
1165861509 19:38911723-38911745 TTGAGGGCAATGAGGATCATGGG + Intronic
1167223130 19:48216654-48216676 TGCAGGGAAAGGAAGGTGATGGG + Intronic
1167348636 19:48962072-48962094 TCACGGGAAACGAGGGTGATAGG + Intergenic
924981360 2:224656-224678 TTTAAGGTAATGAGGGTGATAGG - Intronic
926323102 2:11762589-11762611 TCCAGAGCAATAAAGGTGAAAGG - Intronic
926694727 2:15763305-15763327 ACCAGGGCACTGAGGGAAATAGG + Intergenic
927244660 2:20947767-20947789 GCCAGGGGAATGGGGGTGAGAGG - Intergenic
927662275 2:25003067-25003089 TCCAGGGATATGAGGGGGTTGGG - Intergenic
929825363 2:45305698-45305720 TCTAGGGGTATGAGGGAGATGGG - Intergenic
931256144 2:60574842-60574864 TCCAGGGCATGGAGCATGATTGG + Intergenic
932105318 2:68936495-68936517 TCCAGGGCTTTGAGGGTTACAGG - Intergenic
933271353 2:80236420-80236442 TGCAGTGCAGTGAGGGAGATGGG + Intronic
936758286 2:115741030-115741052 GCTAGAGTAATGAGGGTGATGGG - Intronic
937227465 2:120377979-120378001 TCCAGGGCATCAAGGGTTATCGG + Intergenic
938041937 2:128083237-128083259 TTTAGGGCAATGATGGTGCTGGG - Intergenic
940987625 2:160064141-160064163 TCCAGGGCAGTGAGAGTAAAGGG + Intergenic
943792524 2:191949841-191949863 TCAAGGGAAATGATGGTTATTGG - Intronic
944198288 2:197078406-197078428 TCCATGGCAATGCTGGTGTTAGG + Intronic
946076878 2:217081440-217081462 TCCAGGGAAATCAGGATGTTAGG + Intergenic
947958052 2:234212371-234212393 TCCAGAGCAAAGAGGTTCATAGG + Intergenic
948027554 2:234790157-234790179 TGCAGGGCACTGAGGGTGATAGG + Intergenic
948273086 2:236688756-236688778 TCCAGGGCGATGTGTGTGCTGGG + Intergenic
1170358249 20:15516534-15516556 CCCAGGGCAGTGCGGGTGCTGGG + Intronic
1176377687 21:6094550-6094572 TCCAGGGGAGTGGGGGTGACTGG + Intergenic
1177045112 21:16159714-16159736 TCCAGAGCAATTATGGTGGTTGG + Intergenic
1177275724 21:18910793-18910815 TCCTGAGTAATGAGGGTGACAGG + Intergenic
1179399377 21:41069987-41070009 TCCTGGGTAGGGAGGGTGATGGG + Intergenic
1179560952 21:42215815-42215837 TGCAGAGCAGTCAGGGTGATAGG + Intronic
1179745787 21:43443694-43443716 TCCAGGGGAGTGGGGGTGACTGG - Intergenic
1181046094 22:20215014-20215036 TCAAGGGCAAGGCGGGTGGTGGG + Intergenic
1182516590 22:30862346-30862368 TCCAGGGCCATGGGGGTGGCAGG + Intronic
1184110241 22:42389895-42389917 TCCTGGGCATTGGGGGTGATGGG + Intronic
952217801 3:31295136-31295158 GCCAGAGCCATGAGGGTGGTGGG - Intergenic
956084926 3:65598274-65598296 CACAGGGCCATGCGGGTGATGGG - Intronic
963702450 3:148643472-148643494 TCCAGGGAACAGAGGGTGCTGGG + Intergenic
966837291 3:184059027-184059049 TTCAGGGCAATTAGGTAGATGGG - Intronic
972557954 4:40199368-40199390 TCCAGGGAAAGTAGGGTGACAGG + Intronic
974554813 4:63432417-63432439 TCCAGGCCAATGAGCTGGATTGG + Intergenic
975447371 4:74481518-74481540 TGGAAGGCAATGAGGGTGAGAGG + Intergenic
976305746 4:83557854-83557876 TAAAGGGCAATGAAGTTGATTGG + Intronic
977772909 4:100880746-100880768 TTCATAGCAATGAGGGTGATGGG + Intergenic
977889559 4:102292742-102292764 TCCTGAGAAGTGAGGGTGATGGG - Intronic
984811802 4:183801859-183801881 TCCATGCCAGTGAGGGTGAAGGG + Intergenic
986580211 5:9257922-9257944 TAAAGGGCAAGGAGGGTGTTAGG + Intronic
986974280 5:13377660-13377682 TCCAGGAAAAAGAGAGTGATAGG + Intergenic
988629120 5:32910310-32910332 TGCTGGGCATAGAGGGTGATGGG + Intergenic
992203199 5:74404018-74404040 TCCCTGGCCATGAGGCTGATAGG + Intergenic
993383713 5:87238330-87238352 TCCAGAGCAATGATGATTATTGG + Intergenic
997301277 5:132807483-132807505 TCCAGGGACTTGAGGGGGATGGG - Intergenic
998895064 5:146790236-146790258 TCCACAGAAATGAGGGTAATTGG - Intronic
999205533 5:149845334-149845356 TCCAGGGAAATGGGAATGATAGG + Intronic
1000037279 5:157459063-157459085 TCCTGGGCAGTGAGGGTGTGGGG - Intronic
1001784642 5:174401594-174401616 TCCAGGGCAAACAGAATGATTGG + Intergenic
1002164926 5:177338238-177338260 ACCAGGCCAATGAGGGTGTAGGG + Intronic
1002193253 5:177489706-177489728 TCCAGGGGCATGGGGGTGGTGGG - Intronic
1003425089 6:5993838-5993860 GCCTGGGCACTGAGGGGGATGGG + Intergenic
1005182904 6:23126536-23126558 TCCATAACAATGAGGGTCATAGG - Intergenic
1006377896 6:33681840-33681862 TCCAGGGCAATGAGGGTGATGGG + Intronic
1009751602 6:67884111-67884133 TCCAGAGGACTGAGGGTGATAGG + Intergenic
1013122617 6:107154557-107154579 TCCTAGGGAATGAGGTTGATTGG - Exonic
1017436121 6:154417462-154417484 TCCTGGGCAAGGCTGGTGATGGG - Intronic
1017992973 6:159506327-159506349 TCTAGGGCAATGAGGAAGACAGG + Intergenic
1018082328 6:160269467-160269489 TCCTGGGCAATAGGGGTGCTAGG + Intronic
1021492180 7:21231250-21231272 TCCATGAGACTGAGGGTGATGGG - Intergenic
1024103503 7:46058074-46058096 TCCAAGGCAAAGAGGGTCTTGGG - Intergenic
1024706774 7:51969991-51970013 TCCTGAGCAATGAGGGTAGTAGG + Intergenic
1025818601 7:64942977-64942999 TCCAGGGGAATGAGGAGGAGCGG + Intergenic
1028097866 7:86784708-86784730 TCCAGGGGAATGGAGGTGAATGG - Intronic
1032076399 7:128838177-128838199 GCCAGGCCAAGGAGGGTGAGAGG - Intronic
1032185587 7:129722575-129722597 TCCAATGCAATGGGGGTGACAGG - Intronic
1032947903 7:136872475-136872497 TTCTGGGCAATGAAGGCGATAGG - Intronic
1033567271 7:142591412-142591434 TTCAGGACAATGAGAGTTATGGG - Intergenic
1034987199 7:155523645-155523667 TCCAAGTCCATGAGGCTGATGGG - Intronic
1037315685 8:17596949-17596971 TCCAGGGCTATGACAGTGTTGGG + Intronic
1037658095 8:20904537-20904559 TCCAAGGCAAAGATGGTGCTTGG - Intergenic
1037772417 8:21810356-21810378 TCCAGGTCAGTGAGGGGGGTGGG - Intronic
1038269726 8:26065448-26065470 TCCATAGCAATGGGGGTGATAGG - Intergenic
1047436722 8:124840774-124840796 TTCAGAGCCATGTGGGTGATAGG + Intergenic
1047518136 8:125572978-125573000 TCCAAGGTAATGCAGGTGATTGG - Intergenic
1047920248 8:129628165-129628187 ACCAGAGCCATGAGGGTGAGAGG + Intergenic
1048125762 8:131634367-131634389 TCTAGGTCAGTGAGGGCGATTGG - Intergenic
1048538727 8:135322959-135322981 TAAAGGGCAATTATGGTGATGGG - Intergenic
1052429069 9:28343180-28343202 CTCAGGGCAATCAGGGTAATGGG + Intronic
1052819245 9:33125835-33125857 TCCAGGGAAGGCAGGGTGATTGG - Intronic
1056213836 9:84390092-84390114 TTCAGGGGAAGGAGGGTGGTTGG + Intergenic
1056549773 9:87642601-87642623 TTCAGGGCTAAGAAGGTGATGGG + Intronic
1056731070 9:89167129-89167151 GGGAGGGCAATGAGGGTGACAGG + Intronic
1058344093 9:103938822-103938844 TTCAGGGCTATCAGGGTGAAAGG + Intergenic
1061834261 9:133318410-133318432 TCCAGGGTCGTGAGGGTCATGGG - Intergenic
1062238068 9:135522122-135522144 TCCAGGGTCGTGAGGGTCATGGG - Exonic
1185707192 X:2276696-2276718 TCCAGAGAAAGGAGAGTGATGGG + Intronic
1187217190 X:17288598-17288620 TCCAGGGAAATGAGGAATATAGG - Intergenic
1187672476 X:21682167-21682189 TCCAGGGTAATGAGGGAGGCTGG + Intergenic
1190066070 X:47242553-47242575 TCCAGGGCAAGGAGGCAGAAGGG + Intronic
1194434695 X:93855947-93855969 ACCAGAGCACTGAGGGGGATTGG - Intergenic
1199807805 X:151318013-151318035 GCCAGGACAATGGGGGAGATGGG + Intergenic
1200171882 X:154082879-154082901 TCCAGAGCCATGAGGGAGAAGGG - Intronic