ID: 1006378745

View in Genome Browser
Species Human (GRCh38)
Location 6:33685688-33685710
Sequence CGCTGGGCCCCAGCCTGCGC CGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 343
Summary {0: 1, 1: 0, 2: 2, 3: 44, 4: 296}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1006378733_1006378745 29 Left 1006378733 6:33685636-33685658 CCCACAGGCCGCGTGGCCTCCTT 0: 1
1: 0
2: 0
3: 12
4: 114
Right 1006378745 6:33685688-33685710 CGCTGGGCCCCAGCCTGCGCCGG 0: 1
1: 0
2: 2
3: 44
4: 296
1006378738_1006378745 10 Left 1006378738 6:33685655-33685677 CCTTCTCGATACCTGGCTCCTCA 0: 1
1: 0
2: 2
3: 14
4: 160
Right 1006378745 6:33685688-33685710 CGCTGGGCCCCAGCCTGCGCCGG 0: 1
1: 0
2: 2
3: 44
4: 296
1006378739_1006378745 -1 Left 1006378739 6:33685666-33685688 CCTGGCTCCTCATCCCGCTACTC 0: 1
1: 0
2: 1
3: 12
4: 274
Right 1006378745 6:33685688-33685710 CGCTGGGCCCCAGCCTGCGCCGG 0: 1
1: 0
2: 2
3: 44
4: 296
1006378742_1006378745 -8 Left 1006378742 6:33685673-33685695 CCTCATCCCGCTACTCGCTGGGC 0: 1
1: 0
2: 0
3: 8
4: 82
Right 1006378745 6:33685688-33685710 CGCTGGGCCCCAGCCTGCGCCGG 0: 1
1: 0
2: 2
3: 44
4: 296
1006378735_1006378745 21 Left 1006378735 6:33685644-33685666 CCGCGTGGCCTCCTTCTCGATAC 0: 1
1: 0
2: 0
3: 4
4: 73
Right 1006378745 6:33685688-33685710 CGCTGGGCCCCAGCCTGCGCCGG 0: 1
1: 0
2: 2
3: 44
4: 296
1006378737_1006378745 13 Left 1006378737 6:33685652-33685674 CCTCCTTCTCGATACCTGGCTCC 0: 1
1: 0
2: 0
3: 5
4: 171
Right 1006378745 6:33685688-33685710 CGCTGGGCCCCAGCCTGCGCCGG 0: 1
1: 0
2: 2
3: 44
4: 296
1006378734_1006378745 28 Left 1006378734 6:33685637-33685659 CCACAGGCCGCGTGGCCTCCTTC 0: 1
1: 0
2: 0
3: 18
4: 194
Right 1006378745 6:33685688-33685710 CGCTGGGCCCCAGCCTGCGCCGG 0: 1
1: 0
2: 2
3: 44
4: 296

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1006378745 Original CRISPR CGCTGGGCCCCAGCCTGCGC CGG Exonic