ID: 1006378745

View in Genome Browser
Species Human (GRCh38)
Location 6:33685688-33685710
Sequence CGCTGGGCCCCAGCCTGCGC CGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 343
Summary {0: 1, 1: 0, 2: 2, 3: 44, 4: 296}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1006378737_1006378745 13 Left 1006378737 6:33685652-33685674 CCTCCTTCTCGATACCTGGCTCC 0: 1
1: 0
2: 0
3: 5
4: 171
Right 1006378745 6:33685688-33685710 CGCTGGGCCCCAGCCTGCGCCGG 0: 1
1: 0
2: 2
3: 44
4: 296
1006378733_1006378745 29 Left 1006378733 6:33685636-33685658 CCCACAGGCCGCGTGGCCTCCTT 0: 1
1: 0
2: 0
3: 12
4: 114
Right 1006378745 6:33685688-33685710 CGCTGGGCCCCAGCCTGCGCCGG 0: 1
1: 0
2: 2
3: 44
4: 296
1006378738_1006378745 10 Left 1006378738 6:33685655-33685677 CCTTCTCGATACCTGGCTCCTCA 0: 1
1: 0
2: 2
3: 14
4: 160
Right 1006378745 6:33685688-33685710 CGCTGGGCCCCAGCCTGCGCCGG 0: 1
1: 0
2: 2
3: 44
4: 296
1006378734_1006378745 28 Left 1006378734 6:33685637-33685659 CCACAGGCCGCGTGGCCTCCTTC 0: 1
1: 0
2: 0
3: 18
4: 194
Right 1006378745 6:33685688-33685710 CGCTGGGCCCCAGCCTGCGCCGG 0: 1
1: 0
2: 2
3: 44
4: 296
1006378739_1006378745 -1 Left 1006378739 6:33685666-33685688 CCTGGCTCCTCATCCCGCTACTC 0: 1
1: 0
2: 1
3: 12
4: 274
Right 1006378745 6:33685688-33685710 CGCTGGGCCCCAGCCTGCGCCGG 0: 1
1: 0
2: 2
3: 44
4: 296
1006378735_1006378745 21 Left 1006378735 6:33685644-33685666 CCGCGTGGCCTCCTTCTCGATAC 0: 1
1: 0
2: 0
3: 4
4: 73
Right 1006378745 6:33685688-33685710 CGCTGGGCCCCAGCCTGCGCCGG 0: 1
1: 0
2: 2
3: 44
4: 296
1006378742_1006378745 -8 Left 1006378742 6:33685673-33685695 CCTCATCCCGCTACTCGCTGGGC 0: 1
1: 0
2: 0
3: 8
4: 82
Right 1006378745 6:33685688-33685710 CGCTGGGCCCCAGCCTGCGCCGG 0: 1
1: 0
2: 2
3: 44
4: 296

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1006378745 Original CRISPR CGCTGGGCCCCAGCCTGCGC CGG Exonic
900116640 1:1031970-1031992 CCCTGGGTCACACCCTGCGCTGG + Intronic
900214086 1:1471954-1471976 CCCTCGGCCCCGGGCTGCGCGGG - Exonic
900221635 1:1512338-1512360 CCCTCGGCCCCGGGCTGCGCGGG - Exonic
900384558 1:2404143-2404165 TCCTGGGCCCCGGGCTGCGCAGG + Exonic
900399590 1:2467525-2467547 CCCTGAGCCCCAGCCCGAGCAGG - Intronic
900475379 1:2873991-2874013 GGATGGGCCCCTGCCTGCCCTGG - Intergenic
900658411 1:3771553-3771575 AGCTGGGCCCCGGCCTCTGCTGG - Exonic
901089937 1:6634492-6634514 CGGGGGGCCCCAAGCTGCGCCGG - Exonic
901196743 1:7444503-7444525 CCCTGGGCACCAGGCTGGGCTGG + Intronic
901602170 1:10430752-10430774 GGCTGGACCCTGGCCTGCGCTGG + Intronic
901709022 1:11099587-11099609 CGCGGGGCCCCTGTCCGCGCTGG - Intronic
902600974 1:17539964-17539986 CGCGGGGGCCCTGCCTCCGCGGG + Intronic
902824298 1:18962460-18962482 TGCTGGGCCTCAGCCTTCACAGG + Intergenic
903343651 1:22670908-22670930 CGCCGGGCCCCAGCCCCAGCTGG + Intergenic
903750294 1:25617082-25617104 CCCCGGGCCCCAGACAGCGCAGG - Intergenic
905918074 1:41699633-41699655 CCCGGGGCCCCATCCTGCGTTGG - Intronic
906062337 1:42957380-42957402 CGCTGGGCCGCACCCTCGGCAGG - Intronic
906076629 1:43056663-43056685 CTTTGGGCCCCACCCTGCCCAGG + Intergenic
910935939 1:92484715-92484737 CGCTAGGCTCCAGCCGGCTCCGG + Intronic
914376876 1:147079850-147079872 CGCGGGGCCCTAGTCTGCGGTGG + Intergenic
914741659 1:150471021-150471043 CGCTGGACCCCAAACTGCTCAGG - Exonic
915473168 1:156137759-156137781 CGCTGAGGCCGAGCCTGCACTGG + Intronic
915475653 1:156151304-156151326 GGCAGGGCCCCAGCCAGTGCTGG - Intronic
915558367 1:156672836-156672858 CGCTGGCCCCCAGGCTCCTCTGG + Exonic
919808679 1:201396013-201396035 CCCTGGGCCCCAGCCTGTCCTGG - Intronic
922988541 1:229885748-229885770 CTCTGGGCCCCAGAGTCCGCTGG - Intergenic
923055815 1:230425638-230425660 CGCTGCGCTCCAGCCCGCGCCGG + Intronic
924351542 1:243119299-243119321 CACTGGACTCCAGCCTGGGCTGG - Intergenic
1064096230 10:12426585-12426607 CACTGCACCCCAGCCTGGGCTGG - Intronic
1066064221 10:31750521-31750543 CGCTGGGCCCCGGCCAGCTCAGG + Intergenic
1067083746 10:43227555-43227577 CCCTGGGCCCCAGCCTTCCCAGG - Intronic
1067432105 10:46251611-46251633 CCCTGGGCCCCATGCTGGGCTGG - Intergenic
1067441125 10:46309730-46309752 CCCTGGGCCCCATACTGGGCTGG + Intronic
1067477982 10:46578875-46578897 CGCAGGGCTCCAGCCAGGGCGGG - Intronic
1067577771 10:47418996-47419018 CCCTGGGCCCCATGCTGGGCTGG + Intergenic
1067616757 10:47762912-47762934 CGCAGGGCTCCAGCCAGGGCGGG + Intergenic
1069902914 10:71716128-71716150 CGCTGGACCCGAGCCGCCGCAGG - Exonic
1070793702 10:79204663-79204685 AGCTGGGCCCCACTCTGAGCTGG - Intronic
1071518309 10:86313749-86313771 AGCTGGGCTGCACCCTGCGCTGG + Intronic
1072656546 10:97334238-97334260 CGCAGGGCCCCAGAGGGCGCCGG + Exonic
1073076312 10:100827438-100827460 CGCTGGACCCCAGCCAGGGGAGG + Intronic
1073104403 10:101023986-101024008 GGCTGGGCTTCAGCGTGCGCGGG - Exonic
1075578668 10:123599490-123599512 GGCTGGGGCCCAGGCTGGGCTGG - Intergenic
1075713406 10:124542659-124542681 GGCTGGGCCCCAGGGTGCACAGG - Intronic
1075729829 10:124629516-124629538 AGCTGGTCCCCAGCCTGGCCTGG + Intronic
1075730977 10:124636679-124636701 GGCCGGGCCCCATCCTGCGGAGG + Intronic
1076137701 10:128056456-128056478 CGCTGGGCCCCAGGCAGCCCAGG - Intronic
1076266113 10:129111033-129111055 GGCAGGGTCCCAGCCTGGGCAGG - Intergenic
1076626854 10:131826397-131826419 CTCCCGGCCCCAGCCTGTGCTGG + Intergenic
1076718897 10:132384061-132384083 CCCTGGGCCTCAGCCTGGGCAGG + Intergenic
1076749770 10:132537000-132537022 CGCTGAGACCCAGCCTGGCCCGG + Intergenic
1077016366 11:400704-400726 AGGTGGGCACCAGCCTGAGCGGG + Exonic
1077093869 11:791249-791271 ATCTGGGCCCCAGCCTGGGGTGG + Exonic
1077436161 11:2540183-2540205 CGCTGGGCAGCAGCCTGGGGAGG + Intronic
1077495921 11:2886354-2886376 AGCTCGGCCCTGGCCTGCGCCGG + Intergenic
1078541696 11:12218260-12218282 CCCTGGGCCCCTGCCTCTGCTGG + Intronic
1079130488 11:17744363-17744385 TGCTGGGCTCCTGCCTGCTCTGG - Intronic
1080451358 11:32381360-32381382 TGCTGGGCCCCGGCCTGCACTGG - Intergenic
1081847985 11:46254203-46254225 GGCCGGGCCGCAGCCTGCGAGGG - Intergenic
1081854396 11:46294863-46294885 CTGTGGGCCCCAGCCTGCGGGGG + Intronic
1084004999 11:66317880-66317902 CCCAGGGCCCCAGGCTGAGCTGG - Intergenic
1084118758 11:67056840-67056862 CGCAGAGACCCAGACTGCGCGGG - Exonic
1085263779 11:75224440-75224462 CTCTGAGCCACAGCCTGTGCTGG + Intergenic
1085505780 11:77058086-77058108 CTCTGGGCCCCAGATTGCACAGG + Intergenic
1088315893 11:108506437-108506459 CTTTGGGGCCCAGACTGCGCTGG - Exonic
1089262426 11:117232206-117232228 CGCACGGCCCCTGCCTGCGTAGG - Exonic
1089302299 11:117505916-117505938 CAGTGGGTCCCAGCCTGGGCGGG - Intronic
1089640198 11:119842980-119843002 GGCTGAGACCCAGCCTGCTCAGG - Intergenic
1090030025 11:123198198-123198220 TGCTGGGCCCCACTCTGGGCTGG + Intergenic
1091221417 11:133931847-133931869 AGCTGGGACCCAGCCTGGGATGG - Intronic
1091282773 11:134391392-134391414 CTCTGGGCCCCAGTCTGAGACGG + Exonic
1091624835 12:2113912-2113934 CCCAGGGCTCCAACCTGCGCAGG - Intronic
1092670141 12:10853288-10853310 GGCTGGGCACCAGCATGCACAGG - Intronic
1095960147 12:47829155-47829177 AGCTGGGGCCCAGTCTGCGTGGG - Intronic
1095968868 12:47887749-47887771 TGCTGGGGCCCAGCCTCCTCTGG - Intronic
1096389514 12:51217833-51217855 CCCAGGCCCCCAGCCTGGGCTGG + Intergenic
1100325812 12:93538947-93538969 CGCTGCACTCCAGCCTGAGCAGG + Intergenic
1101970606 12:109309725-109309747 CGCTGCGCGCCAGCCCGCGCGGG - Intergenic
1103930049 12:124445273-124445295 GGATGGGCCCCACCCTGGGCAGG - Intronic
1104021212 12:124993722-124993744 CGCTGGGCCGCAGCGGGCTCCGG - Exonic
1104896034 12:132164059-132164081 CGCTGGGCTCCCGGCTGCTCAGG + Intergenic
1105475064 13:20721775-20721797 CGCCGCACCCCCGCCTGCGCCGG + Exonic
1105614474 13:21999826-21999848 CGCTGAGGCCAAGCCTGCTCTGG + Intergenic
1107141069 13:36999193-36999215 CGGTAAGCCCCGGCCTGCGCGGG + Intronic
1110224794 13:73108863-73108885 CACTGCGCTCCAGCCTGGGCTGG - Intergenic
1110648836 13:77919463-77919485 AGCTGGGTTCCAGCCTGCTCTGG + Exonic
1113848322 13:113404549-113404571 CCCTGGGCCCCACCCTGAGCTGG + Intergenic
1119322205 14:73738901-73738923 GGCTGGCACCCAGCCTGGGCAGG - Exonic
1119502370 14:75140667-75140689 CGCTGCACTCCAGCCTGGGCTGG + Intronic
1120924976 14:89788578-89788600 CACTGCGCTCCAGCCTGGGCAGG + Intergenic
1121410094 14:93743776-93743798 CGCTGGTCCTCAGCGTGTGCAGG + Intronic
1121589024 14:95085317-95085339 TGCTGGGTCCCAGCCAGCTCAGG - Intergenic
1122248917 14:100424571-100424593 CCCTGGGCCCCAGACTCCACAGG - Intronic
1122632510 14:103113486-103113508 TGCTGGGCCCCAGCCTGAGCTGG - Intergenic
1122740469 14:103869016-103869038 CCCTGAGCCCCAGCTTGCCCAGG - Intergenic
1122826392 14:104372881-104372903 CCCTGGTCCCCAGACTGCACCGG + Intergenic
1122884792 14:104706211-104706233 CTCAGGGCCACAGCCTGCCCTGG - Intronic
1123691118 15:22838864-22838886 CGCGGTGCCCAAGGCTGCGCCGG + Exonic
1124005425 15:25792301-25792323 CTCTGGGCTCCACCCTGAGCAGG - Intronic
1124393880 15:29283568-29283590 AGCTGGGCCCAAACCAGCGCTGG + Intronic
1124427098 15:29571092-29571114 CGCTGGGCCCCAGCTGGGGCGGG + Intergenic
1124999401 15:34754858-34754880 CCCTGGCCCCCAACCTGCGGCGG - Exonic
1125506806 15:40272003-40272025 CGCAGGGCACCAGGCTGGGCAGG - Intronic
1125593378 15:40869594-40869616 CTCTGGCCCCAAGCCTGTGCAGG - Intergenic
1125745146 15:41992698-41992720 TCCTGGGCCCCACCCTGCCCTGG - Intronic
1126099640 15:45111633-45111655 CGCCGGGCCCCGGCCTTCCCTGG - Intronic
1127457754 15:59170510-59170532 GGCTGGGTCCCAACCTGAGCGGG - Intronic
1128242653 15:66111572-66111594 CCCTGGCTCCCAGCCTGCGCTGG - Intronic
1128496359 15:68200690-68200712 CCCTGAGCCCCAGCCTGGGAGGG - Intronic
1128862295 15:71084030-71084052 CACTGTGCCCCAGCCTGAGCTGG + Intergenic
1129673858 15:77621948-77621970 CCCTGGGCCCCAGCCTTCGTGGG - Intronic
1130656495 15:85795035-85795057 GGGTGGGCCCCAGGCCGCGCCGG + Intergenic
1131254805 15:90855070-90855092 CGCTGGTCCCCAGTCTGGACAGG - Intergenic
1132604212 16:787006-787028 CGGTGGGTCCCTGCCTGCCCAGG + Intronic
1132689328 16:1175463-1175485 TGCTGGGCCCTGGCCTGGGCTGG + Intronic
1132864140 16:2085362-2085384 AGCTGGGCCTCAGCCTGCAGTGG + Intronic
1132907116 16:2288356-2288378 CGCTGGGCCCCAAGCGGTGCCGG - Intronic
1132937060 16:2486524-2486546 GCCTGGGCCCCATCCTGCCCTGG - Intronic
1133103182 16:3491406-3491428 CGCTGAGCCCTAGCCTGACCCGG + Intergenic
1133157126 16:3883084-3883106 GGGTGGGCCCCAGCCTGAGGTGG + Intergenic
1136466204 16:30445581-30445603 CGTTGGGCCTCAGCCCGAGCTGG - Exonic
1137567501 16:49542702-49542724 GGCTGGGCCCCAGCCCACCCTGG + Intronic
1137614545 16:49838861-49838883 CGCTGGGCCGCCCCCCGCGCGGG - Intronic
1139349648 16:66327160-66327182 TGCTGGGCCCGAGCTGGCGCTGG - Intergenic
1142119062 16:88377014-88377036 AGCTGAGAGCCAGCCTGCGCTGG - Intergenic
1142192466 16:88724162-88724184 CTCTGCACCCCAGCCCGCGCTGG - Intronic
1142425756 16:90001471-90001493 TGCAGGGCCCCAGCCGGCTCAGG + Intergenic
1142758770 17:2030909-2030931 CTCAGGGCCCCAGCCTCCGCTGG + Intronic
1143095339 17:4475873-4475895 CGCTAGGACCCAGCATGCACTGG + Intronic
1143163399 17:4885680-4885702 CTCTGTTCCCCAGCCTGCTCAGG - Intronic
1143598394 17:7929230-7929252 CGGAGGGCCCCAGCGGGCGCTGG + Exonic
1143747228 17:9003452-9003474 CGGCGAGCCCCAGCCTGCTCCGG + Intergenic
1143780733 17:9228021-9228043 CTGTGGGCCCCATCCTGCCCTGG + Intronic
1144655793 17:17035672-17035694 GGCTGGGCCCCACCCTTCCCTGG - Intergenic
1144851395 17:18245872-18245894 CCCAGGGCCCCTGCCTGCCCTGG + Intronic
1144945628 17:18968190-18968212 CACAGGGCCCCAGCCTTCTCAGG + Intronic
1145933210 17:28700537-28700559 CTATGGGCCCCACCCTGCACAGG - Intronic
1147240017 17:39084709-39084731 AGCTGGGGCCCAGCCTGGGCAGG + Intronic
1147382386 17:40063307-40063329 CGCTGGGCCCCGGGGTTCGCAGG + Intronic
1147665656 17:42145844-42145866 CACTGTGCTCCAGCCTGGGCTGG - Intronic
1147919567 17:43907508-43907530 CGCTGAGCGCCCGGCTGCGCTGG - Intronic
1148318478 17:46726315-46726337 AGCTAGTCCCCAGCCTGCCCAGG + Intronic
1148568175 17:48646251-48646273 CGCAGGGCCTCAGGCTGGGCGGG + Intergenic
1148695433 17:49555662-49555684 CGCTGGGGCCCGGCCAGCTCTGG + Intergenic
1149993690 17:61396369-61396391 CAGTTGGCCCCACCCTGCGCGGG + Intergenic
1150134787 17:62689781-62689803 CCCTGGGCCCCAGCCTTGCCCGG + Intronic
1150675731 17:67245011-67245033 CCCAGGCCCCCAGCCTGCCCCGG + Intronic
1150789220 17:68187021-68187043 CACTGCTCCCCAGCCTGGGCCGG + Intergenic
1151242793 17:72771310-72771332 CGCTGCACTCCAGCCTGAGCTGG + Intronic
1151660030 17:75514237-75514259 TGCTGGGCCACAGCCTGCAAGGG + Intronic
1152291170 17:79440991-79441013 CCCTGGGCCCAAGCCAGCTCTGG - Intronic
1152303011 17:79506433-79506455 AGCTGGGCCAGAGGCTGCGCTGG + Intronic
1152515279 17:80819958-80819980 TGTTGGGCCCCACCCTGCCCTGG + Intronic
1152702202 17:81824691-81824713 GGCTGGACCCCAGCCTGTGGGGG - Exonic
1154501656 18:15000547-15000569 CCCTGGGCCTCAGCCTTAGCCGG + Intergenic
1156488562 18:37482539-37482561 CCCTGGGAACCAGCCTGAGCAGG - Intronic
1157324106 18:46656880-46656902 TGCGGGGTCCCAGCCTGCGGGGG - Intronic
1157529659 18:48409926-48409948 CGGCGGTCCCAAGCCTGCGCTGG - Intronic
1158710472 18:59832614-59832636 CTCTGGGCCCCACCCTTCACAGG + Intergenic
1159663538 18:71129674-71129696 CGCTGCGCTCCAGCCTGGGCTGG - Intergenic
1160719909 19:592473-592495 AGCGGGGCCACAGCCTGCCCAGG - Intronic
1160809432 19:1007090-1007112 CGCTGGGCCCCAACCTGGGTAGG + Intronic
1160871843 19:1281337-1281359 CACTGGACTCCAGCCTGGGCGGG - Intergenic
1160904729 19:1446719-1446741 CCCAGGCCCCCACCCTGCGCAGG - Intronic
1161072916 19:2271250-2271272 GGGTGGGCCCCTGCCTGGGCGGG + Intronic
1161085759 19:2334176-2334198 ACCTGGCCCCCAGCCTGGGCGGG - Intronic
1161226461 19:3148784-3148806 CCCTGGGCCCCTGCCTGCCCTGG - Intronic
1161226469 19:3148801-3148823 CCCTGGGCCCCTGCCTGCCCTGG - Intronic
1161285740 19:3467434-3467456 CCCAGGGCCCCACCCTGGGCTGG + Intronic
1161381412 19:3967003-3967025 TGCTGTGCCCCCACCTGCGCTGG - Intronic
1161394640 19:4038582-4038604 CCCTGGGCCCCCGCCTTCCCCGG - Exonic
1161577968 19:5065211-5065233 CACAGGGCCCCAGCCTGAGGCGG - Intronic
1161594114 19:5142523-5142545 TGCTGGGCACCAGCCTGCCCCGG + Intronic
1162327613 19:10008150-10008172 CCCTGGGCCCCAGGCTGAGATGG - Intronic
1162344394 19:10111081-10111103 CTCTGGGCCCCCGCCTGGCCTGG - Exonic
1162536031 19:11262992-11263014 CGCTGGGACCCAGGCTGGGTAGG + Intergenic
1163368754 19:16890264-16890286 CGCTGGCCGCCAGCGTGTGCAGG - Exonic
1163424893 19:17235892-17235914 CGCTGAGCCCTACCCTGCGGCGG - Exonic
1163436858 19:17301207-17301229 CGCTTGGCCCCCGGCAGCGCAGG - Exonic
1164442603 19:28291038-28291060 CCCTGAGCCACAGCCTGCCCTGG + Intergenic
1165080207 19:33302449-33302471 CGGCGGCCTCCAGCCTGCGCGGG + Exonic
1165435095 19:35791015-35791037 ACCTGGGCCGCAGCCAGCGCTGG + Intergenic
1165939425 19:39407801-39407823 CGAGGAGCCCCAGCCTGGGCTGG - Exonic
1166080623 19:40441936-40441958 CTCGGGGGCCCAGGCTGCGCTGG + Exonic
1166104596 19:40591031-40591053 CGCCGGGCCTCAGCCTGCGGGGG - Exonic
1166546885 19:43639492-43639514 CGCCGGGATCCAGCCTGCGCGGG + Intronic
1167045363 19:47046107-47046129 TGCTGGCCGCCAGCCTGCTCTGG - Exonic
1167096017 19:47375492-47375514 GGCTGGGGCCCAGGCCGCGCAGG + Exonic
1167121622 19:47520795-47520817 CGCTGGGCCCCTCCCTGGGGCGG - Exonic
1167304981 19:48703117-48703139 CACTGGGACCCAGCCAGCTCAGG + Exonic
1167492869 19:49802100-49802122 GGGTGGGCCCCAGGCTGGGCTGG - Exonic
925087250 2:1117747-1117769 TTGTGGGCCCCAGGCTGCGCTGG + Intronic
925274221 2:2637428-2637450 CCCTGAGCCCCACCCTGCTCAGG + Intergenic
925309883 2:2874988-2875010 CCCTGGGCCTCACCCTGAGCTGG - Intergenic
925979297 2:9164190-9164212 CCCTGGGGCCCAGCCTGAGGAGG + Intergenic
926303283 2:11618886-11618908 CGCTGAGCAGCAGCCTGCGGGGG - Exonic
927216362 2:20669854-20669876 CGCCGAGCCCCAGCCTGCATGGG + Intronic
927483925 2:23475916-23475938 CACTGCGCTCCAGCCTGGGCTGG - Intronic
927637050 2:24824283-24824305 CGCTGGGCCCAGGCCTTCTCAGG - Intronic
928362689 2:30678576-30678598 GGCTGGTTCCCAGGCTGCGCTGG - Intergenic
928904523 2:36355930-36355952 CGCTCGGCTCCAGCCCGGGCCGG - Exonic
929925167 2:46201575-46201597 TGCTAGGTCCCAGCCTGGGCAGG - Intergenic
931516698 2:63054345-63054367 CGCTGGGCCCCAGCCAGGAAAGG + Intronic
932435855 2:71702271-71702293 GGCTGGGGCCCTGCCTGCCCGGG + Intergenic
932440422 2:71731285-71731307 CGCTGGGCCCCAGGCTCCCCTGG - Intergenic
932506067 2:72233389-72233411 AGCTGGGCCCCAGCCTGTCTGGG + Intronic
938322058 2:130372321-130372343 CGCGGGGCTCCAGCGGGCGCCGG + Exonic
938500180 2:131828275-131828297 CGCTCGCCCCCAGCCTCCGCCGG - Intergenic
938500838 2:131830714-131830736 CCCTGGGCCTCAGCCTTAGCCGG + Intergenic
942097573 2:172548103-172548125 GGCTGGGGCCCAGCCTGGGTGGG + Intergenic
945879640 2:215312296-215312318 GGCCGGGCCGCAGCCTGCGTGGG + Intronic
946177090 2:217928603-217928625 TTCTGGGTCCCAGCCTGTGCTGG - Intronic
946360886 2:219218780-219218802 CGCTGGGCGCCAAGCTGCGGGGG + Exonic
946370688 2:219279615-219279637 CTCTTGGCCCCGGCCTGCGGGGG + Intronic
947871905 2:233443907-233443929 CGCTGGGCCCCTGCCGCCTCGGG + Intronic
948046892 2:234951998-234952020 CGCTGGGCCCCCGCCTCGGCGGG - Intronic
948328854 2:237149663-237149685 TGCTGGGCCCCACCCTTTGCTGG + Intergenic
948403512 2:237701388-237701410 CGCATGGCCTCAGCCTGCGCTGG - Intronic
948656160 2:239477765-239477787 GGCTGGGCTCCAGCCTGCATGGG + Intergenic
948811806 2:240482209-240482231 AGAAGGGCCCCAGCCTGCCCAGG - Exonic
948869344 2:240790425-240790447 CGCTGGCCCCCAGCCCACGCTGG - Intronic
1169144780 20:3245094-3245116 CGCTGGTCCCCATCCTGCTCAGG + Intergenic
1169210269 20:3762421-3762443 AGCTGGACTCCAGCCTGGGCTGG - Intronic
1170585037 20:17728162-17728184 GGCTGAGCCCCAGCCTGGGGTGG - Intronic
1170819044 20:19740235-19740257 CGCTGGGCCCCAGCCTGGAAAGG + Intergenic
1172114732 20:32566991-32567013 TGGTGGGCCCCAGGCTGCACAGG + Intronic
1172186262 20:33032889-33032911 CACTGTGCCCCACCCTGGGCTGG - Intronic
1173548454 20:43916095-43916117 CGCTTGGCTCCAGCCGGCCCGGG - Intronic
1174450431 20:50616792-50616814 AGCTGGGCCCCAGCTTGGGAGGG - Intronic
1175891291 20:62317188-62317210 CTCTGGGCCCCAGCTTGCCGTGG + Intronic
1176004168 20:62850724-62850746 CACCAGGCCCCAGCCTGCCCCGG + Intronic
1176069115 20:63216817-63216839 CTCTGTGCCCCAGCCTAGGCCGG + Intergenic
1179830671 21:43994190-43994212 CTCCCAGCCCCAGCCTGCGCTGG + Intergenic
1179896670 21:44367046-44367068 GGCTGTGCCCCAGCCTGAGTCGG + Intronic
1180179198 21:46110517-46110539 CCCTGGGCCCCAGGCTGAGCAGG + Intronic
1180933961 22:19611784-19611806 TGCTGGGCTCCATCCTGCACAGG + Intergenic
1181015063 22:20063961-20063983 CCCTGGGAACCAGCCTGTGCTGG + Intronic
1182711470 22:32325903-32325925 TGCTGCTCCCCAGCCTGCCCAGG - Intergenic
1184032473 22:41903113-41903135 AGCTGTGTGCCAGCCTGCGCAGG - Exonic
1184251059 22:43260639-43260661 CGCTGGGCAGCTGCCTGTGCAGG + Intronic
1184353973 22:43965875-43965897 CACTGGACTCCAGCCTGAGCAGG - Intronic
1184712825 22:46263136-46263158 CGCTGGGCCGCAGACTGAGGAGG + Exonic
1184876891 22:47282015-47282037 GGCTGGGCCTCAGCCTGGTCGGG - Intergenic
1185085976 22:48741249-48741271 CGCTGGGTCCCACCCTGCGAAGG + Intronic
1185213656 22:49586328-49586350 GGCTGGGCCTGAGCCTGCCCTGG - Intronic
1185375732 22:50481912-50481934 CGCTGTCCCGCAGCCTGGGCGGG + Exonic
950530389 3:13549442-13549464 CCCTGGCCCCCACCCCGCGCCGG - Intronic
950578466 3:13847156-13847178 CCCTCCGCCCCAGCCTGGGCTGG + Intronic
950676065 3:14555162-14555184 TGCTGAGCCCCAGCCTGTGCCGG - Intergenic
953399521 3:42600754-42600776 GGCTGGCCTCCAGCCTGAGCGGG - Exonic
953905768 3:46867618-46867640 CCCTGGGCCGCAGTCTCCGCAGG + Intronic
954034980 3:47846589-47846611 AACTGGGCCCCTCCCTGCGCCGG + Exonic
954416349 3:50395333-50395355 CTCCGGGGCCCAGCCTGAGCCGG - Intronic
954481896 3:50807012-50807034 CTCTGGGCCCCAGTCTGATCTGG + Intronic
954643099 3:52114067-52114089 GGCTGGGACCCAGCCTGAGGTGG - Intronic
954661912 3:52230916-52230938 CGCTGGGCCTCAGGCTGCAGGGG + Exonic
956675146 3:71725613-71725635 CGCTGGGCCCGCGCCTGAGCGGG - Intronic
956747090 3:72318821-72318843 CGCTGGGGGCCAGGCTGGGCTGG - Intergenic
961567328 3:127773075-127773097 AGCTGGGCTCCAGCCTGGGCTGG + Intronic
967885701 3:194332124-194332146 GGCTGGGCCCCACCCTGGGGAGG + Intergenic
968648738 4:1752156-1752178 AGCTGGGCCCCAGCGTGGGAGGG + Intergenic
969134512 4:5019537-5019559 GGATGGACCGCAGCCTGCGCTGG - Intergenic
969299825 4:6291381-6291403 CCCTGGGCACCAGCCTTCCCTGG + Intronic
969428755 4:7140814-7140836 TGCTGTGCCCCAGCCTGCGTGGG + Intergenic
969522450 4:7686554-7686576 CCCAGGGCCACAGCCTGCCCCGG + Intronic
969609565 4:8219428-8219450 CGCAGGTGCCCAGCCTGCCCTGG + Exonic
979250400 4:118561236-118561258 CACTGGACTCCAGCCTGGGCTGG + Intergenic
983649734 4:170026299-170026321 CGCTGCGCCGCACTCTGCGCCGG + Exonic
985494839 5:198619-198641 CGTTGGTCCCCAGCCTCTGCTGG - Exonic
985966231 5:3340613-3340635 TGCTGGGCCCCAGCCTGGACAGG + Intergenic
989579674 5:43020135-43020157 CGCTGGGACTCAGCAAGCGCCGG - Intergenic
992807495 5:80351867-80351889 CGCTGCGCTCCAGCGTGAGCAGG - Intergenic
997297469 5:132777075-132777097 CGCTGGGCCACGGCGCGCGCGGG - Intronic
997694494 5:135850537-135850559 CCCTGGTCCCCAGCCTGTGGGGG - Intronic
999360962 5:150986562-150986584 AGCTGGTCCCCAACCTCCGCAGG - Intergenic
999738954 5:154534660-154534682 CGCGGGTCCCCAGCCTCCCCTGG - Intergenic
1001706972 5:173748569-173748591 AGCTGGGCTCCAGCCTGCTGGGG + Intergenic
1002405091 5:179024111-179024133 TCCTGGGCCGCAGCCTGGGCCGG + Intronic
1002929322 6:1622564-1622586 GGCCGGGCCTCAGCCTGGGCGGG - Intergenic
1003034957 6:2634162-2634184 CTCTGGGGCCCGGCCTTCGCGGG + Intronic
1003963295 6:11229361-11229383 CGCTGAGCCCCCGCCCGGGCTGG + Intronic
1004268622 6:14173338-14173360 CACTGGACTCCAGCCTGGGCAGG + Intergenic
1004864296 6:19837976-19837998 TGGTGGGCACCAGCCTCCGCAGG - Exonic
1006378745 6:33685688-33685710 CGCTGGGCCCCAGCCTGCGCCGG + Exonic
1007772305 6:44201545-44201567 CGAGGGGCCACAGCCTCCGCAGG + Intergenic
1010952926 6:82058269-82058291 TGCTCAGCCCCAGCCTGCTCAGG + Intergenic
1014131945 6:117845534-117845556 AGCTGGGCACCAGCCTGCCTGGG + Intergenic
1015376084 6:132512646-132512668 AGCTGGGCCCCAGCCGGCTCTGG + Intronic
1015799363 6:137044776-137044798 CGCTTGGCCCCAGCGGGCGTGGG - Exonic
1018645042 6:165940523-165940545 CGCAGAGCGCCAGGCTGCGCCGG - Intronic
1019338375 7:495649-495671 AGCTGGGGCCCAGCCTTTGCTGG - Intergenic
1019598493 7:1869429-1869451 CGCTGTGCCCAACCCTGGGCTGG - Intronic
1020138340 7:5598864-5598886 CCCTGGGCCCTGGCCTGTGCCGG - Intronic
1020283645 7:6664120-6664142 CGCTGAGCCCAAGCCTCCGCGGG - Intergenic
1022506647 7:30911834-30911856 AGCTGAGCCACAGCCTGGGCTGG - Exonic
1022833375 7:34090554-34090576 CGTTGTGCCCCAGGCTGCCCAGG - Intronic
1023349975 7:39310771-39310793 CGCTGGGTCGCAGCCTCCCCTGG - Intronic
1024024456 7:45399296-45399318 CCCAGGTCCCCAGCCTGGGCTGG - Intergenic
1026000432 7:66556562-66556584 GGCTGGTCCCCAGGCTGGGCCGG - Intergenic
1026360867 7:69599731-69599753 CGCCGGCCCCCAGCCCGCCCCGG - Exonic
1026998593 7:74635912-74635934 CCCTGCGCCCCGGCCAGCGCTGG + Intergenic
1027361502 7:77415556-77415578 CGCGCAGCCCCAGCCTGCACAGG + Intronic
1028310482 7:89327096-89327118 AGCTGGGCCCCAGGCCTCGCTGG - Intronic
1028622200 7:92836687-92836709 CGCTGGGCTCCGGCCGGCGCTGG + Intergenic
1031511043 7:122649946-122649968 CACTGCACTCCAGCCTGCGCTGG - Intronic
1031980637 7:128122165-128122187 CCATGAGCCCCAGCCTGCCCTGG - Intergenic
1031990667 7:128196921-128196943 CACTGGGTCACAGCCTGCACAGG - Intergenic
1033323288 7:140359302-140359324 CACTGCACTCCAGCCTGCGCGGG + Intronic
1034203408 7:149296140-149296162 CACTGGGCCACAGCCAGCCCAGG - Intronic
1034223039 7:149460299-149460321 CGTCGGGCCCCGGCCTGCTCGGG + Intronic
1034459037 7:151187797-151187819 TGCTGGGCCCCACCCAGCTCGGG - Intronic
1034472816 7:151264701-151264723 AGCTGGGCCCAAGCCTCTGCTGG + Intronic
1035324006 7:158052996-158053018 CGATGGGGGCCAGCCTGGGCAGG - Intronic
1037594629 8:20344681-20344703 CTCTGGGCCCCAACTTGTGCTGG - Intergenic
1039949056 8:42153427-42153449 CTCTGGGCCGGGGCCTGCGCAGG + Intronic
1041454088 8:58039141-58039163 CGCCGGGTGCCAGCCTGGGCTGG + Intronic
1043929041 8:86069561-86069583 TGCTTGGCCCAAGCCAGCGCTGG + Exonic
1044973873 8:97644714-97644736 GGCTGGGCCGCGGCTTGCGCCGG + Exonic
1045098941 8:98825879-98825901 CGCCGGCCGCCAGCCTGCGGCGG + Intronic
1046712034 8:117520924-117520946 CGCCGGGCCCCAGGCTCAGCAGG + Exonic
1046923949 8:119766793-119766815 CGCTGTACTCCAGCCTGGGCAGG + Intronic
1048395616 8:134011327-134011349 CTCTGGGGCCCAGCCTGCGTGGG + Intergenic
1049149025 8:141022482-141022504 AGCTGGGCCACACCCTGAGCTGG - Intergenic
1049362126 8:142216838-142216860 CCCTGGGCCCCACACTGGGCTGG + Intronic
1049593263 8:143472112-143472134 CCCTGGACCCCTGCCTGCCCTGG + Intronic
1049690849 8:143958202-143958224 CACTGAGCCCCACCCTGCGCAGG - Intronic
1052033774 9:23657445-23657467 CACTGCACCCCAGCCTGGGCGGG + Intergenic
1052959651 9:34284229-34284251 CACTGGACTCCAGCCTGGGCTGG + Intronic
1053139860 9:35675778-35675800 CGGGTGTCCCCAGCCTGCGCGGG + Exonic
1053161201 9:35814683-35814705 CTCGGCGCCCCGGCCTGCGCAGG + Intronic
1057278049 9:93686689-93686711 GGCTGGGCCCCAGGCTGCGCAGG + Intergenic
1057488924 9:95507336-95507358 CGCCGGGGAGCAGCCTGCGCCGG - Intronic
1060114360 9:120928868-120928890 CGCTGGGAGCCAGGCAGCGCCGG + Intronic
1060927875 9:127467894-127467916 TGCTGTTCCCCAGCCTGGGCTGG - Intronic
1061654678 9:132079755-132079777 CGCTGCGCTCCAGCGTGAGCAGG - Exonic
1061914512 9:133742453-133742475 CGTAGGGCCCCAGTCTGCACTGG + Intergenic
1062498835 9:136843799-136843821 CCCTGGGCCTCAGCCTTAGCCGG - Intronic
1062579734 9:137223911-137223933 CGCTGCACCCCTGCCTGCGCCGG + Intergenic
1186399122 X:9240746-9240768 CGCTGCACCCCAGCCTGCAGGGG - Intergenic
1186426418 X:9466322-9466344 CGCTGGAGGCCCGCCTGCGCTGG + Intronic
1189325255 X:40107717-40107739 CGCTGCGCCCGAGCCGGCGCGGG + Intronic
1190354298 X:49589965-49589987 CGCCAGGCCCCAGCCTTCCCAGG - Intronic
1200081429 X:153578657-153578679 CGCTGTGCCCCAGACTCCCCCGG - Intronic