ID: 1006379773

View in Genome Browser
Species Human (GRCh38)
Location 6:33690789-33690811
Sequence TTCCCAAGGCTCCTCCAGGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 286
Summary {0: 1, 1: 1, 2: 2, 3: 19, 4: 263}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1006379773_1006379779 5 Left 1006379773 6:33690789-33690811 CCTCCCTGGAGGAGCCTTGGGAA 0: 1
1: 1
2: 2
3: 19
4: 263
Right 1006379779 6:33690817-33690839 CTGGAGCCCAGGCAGCCCTCAGG 0: 1
1: 0
2: 1
3: 71
4: 459
1006379773_1006379783 15 Left 1006379773 6:33690789-33690811 CCTCCCTGGAGGAGCCTTGGGAA 0: 1
1: 1
2: 2
3: 19
4: 263
Right 1006379783 6:33690827-33690849 GGCAGCCCTCAGGGTTCCAGTGG 0: 1
1: 0
2: 4
3: 13
4: 237
1006379773_1006379780 6 Left 1006379773 6:33690789-33690811 CCTCCCTGGAGGAGCCTTGGGAA 0: 1
1: 1
2: 2
3: 19
4: 263
Right 1006379780 6:33690818-33690840 TGGAGCCCAGGCAGCCCTCAGGG 0: 1
1: 0
2: 5
3: 47
4: 370
1006379773_1006379778 -6 Left 1006379773 6:33690789-33690811 CCTCCCTGGAGGAGCCTTGGGAA 0: 1
1: 1
2: 2
3: 19
4: 263
Right 1006379778 6:33690806-33690828 TGGGAAACTGTCTGGAGCCCAGG 0: 1
1: 0
2: 1
3: 90
4: 1420

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1006379773 Original CRISPR TTCCCAAGGCTCCTCCAGGG AGG (reversed) Intronic
900094689 1:935528-935550 ACCCCACGGCTGCTCCAGGGAGG - Intronic
900130398 1:1084870-1084892 TGCCTGAGGCTCCTCCCGGGAGG - Intronic
900346514 1:2213002-2213024 TTCCCAGGCCTCATCCAGGCCGG + Intergenic
900636643 1:3669283-3669305 TTTCCAAGCCGCCTCCTGGGAGG - Intronic
900910657 1:5594805-5594827 TCCCCCAGGCCCCACCAGGGAGG + Intergenic
901664639 1:10819444-10819466 TCCCCAGAGCACCTCCAGGGAGG - Intergenic
901894959 1:12303784-12303806 TTCCCAGGGCTTCTTCATGGAGG - Intronic
902272017 1:15311341-15311363 TTCCCTCTGCTCCTCCTGGGTGG - Intronic
902589102 1:17460705-17460727 TTCCCAGGGCTCCTCCAGGGTGG + Intergenic
904003978 1:27353779-27353801 TTCGCACGGCTGCTCCAGGAGGG - Exonic
905126351 1:35718611-35718633 TTCCCTAGTCTCCTCGAAGGAGG + Intronic
905283254 1:36862648-36862670 CTCCCTCAGCTCCTCCAGGGCGG + Intronic
905665112 1:39758914-39758936 TTCCCCAGGCCCCTCCCTGGGGG + Exonic
905886364 1:41494159-41494181 TCCCCAAGGCTGATCCAGAGAGG + Intergenic
907306194 1:53514358-53514380 TTTCCCAGGGTCCTCCAGTGGGG + Intronic
908574462 1:65444360-65444382 TCCTAAAGGCTCCTGCAGGGAGG - Intronic
912761175 1:112368828-112368850 TTCATGAGGCTCCCCCAGGGTGG + Intergenic
918532842 1:185541932-185541954 TTTCCCAGCCTCCTCCAGGAGGG + Intergenic
919258551 1:195158296-195158318 TTCCCAAGGCTCCACCTCAGTGG + Intergenic
919835132 1:201568177-201568199 TTCCCACTGCTCCTCCAGCTTGG + Intergenic
922176349 1:223200848-223200870 TTCCCAAGGCACCTAGAGGAAGG - Intergenic
922706277 1:227792453-227792475 ATCCCAGGGCCCCTGCAGGGGGG - Intergenic
1064200521 10:13280778-13280800 TTCTCAAGCCTCCTGCACGGGGG + Intronic
1064350042 10:14568225-14568247 ATCCCAAGGCACATACAGGGTGG + Intronic
1064593171 10:16915591-16915613 TCCCCAAGTGGCCTCCAGGGTGG + Intronic
1067061959 10:43082200-43082222 TTCCCACAGCTCCTCCTGGCTGG + Intronic
1069531434 10:69222480-69222502 TTCCAAAGGCTCCCCCTTGGGGG - Intronic
1070398591 10:76033544-76033566 TTTCCAAGAGTGCTCCAGGGAGG - Intronic
1070779389 10:79128713-79128735 TCCCCAGGGCACCTCCAGAGTGG + Intronic
1070792927 10:79200382-79200404 GTCCCCAGGCCGCTCCAGGGAGG - Intronic
1070819291 10:79345682-79345704 TTCTCAAGCCTGCTCCTGGGGGG - Intergenic
1070967083 10:80536309-80536331 CTCCCGACGGTCCTCCAGGGTGG + Intergenic
1072761268 10:98058908-98058930 TCCCCAAGGCTCCTTAAGCGTGG - Intergenic
1075088794 10:119431317-119431339 TGCCCCGAGCTCCTCCAGGGCGG - Intronic
1075464177 10:122639066-122639088 TTCCCACAGCTCCACCAGGCTGG + Intronic
1075724903 10:124606153-124606175 TTCCCCAGGCGCCTGCGGGGCGG - Intronic
1076874588 10:133209820-133209842 TGCCTGAGACTCCTCCAGGGTGG + Intronic
1077056559 11:596854-596876 TTCCCAAACCTCCTCAAGTGAGG - Intronic
1078357713 11:10644822-10644844 TTCCCAAGGAGTTTCCAGGGAGG + Intronic
1079332665 11:19546503-19546525 TTCCAAAGCCACCTGCAGGGTGG + Intronic
1080796811 11:35571899-35571921 TTCCCAAGTTTCCCCCAGGGAGG + Intergenic
1083262810 11:61532336-61532358 TTCCCATGGTGCCCCCAGGGGGG - Intronic
1083721065 11:64603761-64603783 TTCCCTTGGCTCCTCCATAGCGG - Intergenic
1083857359 11:65399864-65399886 TGCCCCCAGCTCCTCCAGGGTGG + Intronic
1084919743 11:72459362-72459384 CTCACAGGGCTCCTCCAGAGAGG - Intergenic
1085019050 11:73193576-73193598 CTCCAAAGCCTCCTCCAGAGAGG - Intergenic
1085526862 11:77169263-77169285 TGCCCACGGCTGCCCCAGGGAGG - Intronic
1085650297 11:78261811-78261833 TTCCCAAAGTTCCTCGGGGGAGG - Intronic
1089657911 11:119965116-119965138 TTCCCAAGGCACCTGTGGGGAGG - Intergenic
1089704633 11:120269020-120269042 TTGGAAAGTCTCCTCCAGGGTGG - Intronic
1090843788 11:130514646-130514668 TCCCCAACTCTGCTCCAGGGGGG + Intergenic
1091320414 11:134645607-134645629 CTCCCTAGGCTGCTCCAGCGGGG - Intergenic
1092048738 12:5452740-5452762 TTCCCAAGGCTGCCCTAGGTGGG - Intronic
1092161190 12:6316334-6316356 GGCCCGAGTCTCCTCCAGGGTGG - Exonic
1092564468 12:9649677-9649699 TTCCCAAGGCTCCACCTCAGTGG + Intergenic
1092587354 12:9912791-9912813 TTCCCAAGGCTCCACCTCAGTGG + Intronic
1096966431 12:55631752-55631774 TTCCCAAATCTCCAGCAGGGTGG + Intergenic
1097017328 12:55996918-55996940 TCCCGAGGCCTCCTCCAGGGAGG + Intergenic
1097586844 12:61525692-61525714 TTTCCAAGGCTCTTACACGGAGG - Intergenic
1098514611 12:71359142-71359164 TGCCTAAGGCTCCTCAGGGGAGG + Intronic
1100390621 12:94143417-94143439 TTCCCAGGGCTTCCCCAGGATGG + Intergenic
1102045847 12:109829744-109829766 TTCCCTGAGCTCCTCCAGCGGGG + Intronic
1102974604 12:117197457-117197479 TTCCCAGTGGTCCTCTAGGGTGG + Intergenic
1103134683 12:118497522-118497544 TTCCCAGGGGTCCTCCTGGCTGG - Intergenic
1104897501 12:132171523-132171545 TTCCCAGGGCTGCACCTGGGAGG - Intergenic
1106361947 13:29039067-29039089 TCCCCAAGGCTCCTCCTGGCTGG - Intronic
1106377644 13:29204516-29204538 TTCCCAAGGCTCCTCCTGGCTGG - Intronic
1106435872 13:29722394-29722416 TTCCCTAGGCCCCTCCACAGGGG - Intergenic
1107967916 13:45614153-45614175 TTCTGACGGCTCCTCCAGAGTGG + Intronic
1108573993 13:51776420-51776442 GTCCCAAGGGTCCTCATGGGAGG - Intronic
1109112215 13:58335742-58335764 TTTCAAAGGCTATTCCAGGGAGG - Intergenic
1109156845 13:58921888-58921910 TTCCCAAGGCTTCCCTGGGGTGG - Intergenic
1109526848 13:63586716-63586738 TTCCCAAGGCTCCACCCCAGTGG + Intergenic
1110514149 13:76389059-76389081 TACCCAAGGATTCTCCAAGGAGG + Intergenic
1112309000 13:98301193-98301215 TGCCCAGGGCTCCTCCAGGTGGG - Intronic
1113459674 13:110473038-110473060 CTCCCAGGACTTCTCCAGGGAGG - Exonic
1113472196 13:110555074-110555096 TTCACAAGGCTCCTCCTGGGAGG - Intronic
1116786455 14:49293970-49293992 TTCTCAAGTCTCCTCCAGAGGGG - Intergenic
1119821260 14:77617935-77617957 TTTCTAAAGCTCCTGCAGGGTGG - Intergenic
1122961619 14:105096453-105096475 GTCCCATGGCTGCCCCAGGGAGG + Intergenic
1122983376 14:105201488-105201510 TTTCCCAGGCTCCACCAAGGCGG + Intergenic
1124360988 15:29036329-29036351 TCCCCAGGTCTCCTTCAGGGAGG + Intronic
1126674925 15:51152690-51152712 TTCTCAGGGCTCCTCTGGGGTGG + Intergenic
1129061874 15:72866965-72866987 CTCCCATGACTCCTCCAGAGTGG - Intergenic
1129364901 15:75048273-75048295 TGCCTAAGCCTCCTCCAGGTAGG - Intronic
1130985571 15:88842538-88842560 TGCCCACAGCTCCTCCAGGCTGG + Intronic
1132587469 16:711815-711837 TCCCCAGGCCTCCTCCAGAGAGG - Intronic
1133264600 16:4575665-4575687 TCCCCAAGGCTGGCCCAGGGTGG + Exonic
1136568645 16:31084236-31084258 TTGCCAAGGCCCCGCCAGGCCGG - Exonic
1136626361 16:31464561-31464583 TCCCCAAGGCTCCTCGATGGCGG - Exonic
1136755007 16:32675185-32675207 ATCCCAAGGAGCCTCCAGGTCGG + Intronic
1136813106 16:33195184-33195206 ATCCCAAGGAGCCTCCAGGTCGG - Intronic
1136819582 16:33305264-33305286 ATCCCAAGGAGCCTCCAGGTCGG - Intronic
1136826145 16:33361799-33361821 ATCCCAAGGAGCCTCCAGGTCGG - Intronic
1136831211 16:33460570-33460592 ATCCCAAGGAGCCTCCAGGTCGG - Intronic
1138275468 16:55730952-55730974 GTCCCAACACTCCTCCAGGAAGG - Intergenic
1140730567 16:77852275-77852297 TTCCCAAAGCTTCTCCTAGGAGG - Intronic
1202991682 16_KI270728v1_random:18154-18176 ATCCCAAGGAGCCTCCAGGTCGG - Intergenic
1143121059 17:4607226-4607248 TTCCCAAGGACCCACCAGCGGGG - Intronic
1143582750 17:7836100-7836122 TTCCCAAGGCTTCTCCCGCCCGG + Intergenic
1143586883 17:7854898-7854920 TTCCACAGGCGCCTCCGGGGAGG - Intergenic
1146705052 17:34995209-34995231 TTCCCAATGCTCCAGCAGGAAGG - Intronic
1147326411 17:39671805-39671827 TGCCCAAGGCGCCACCTGGGCGG - Exonic
1149122475 17:53186183-53186205 CTCCCAATGCTCCCCCAGGCTGG + Intergenic
1151277302 17:73045116-73045138 TACCCAAGGCTACCCCAGAGAGG - Intronic
1152321195 17:79609711-79609733 TTCCCAATGCCCCTCCACGCGGG + Intergenic
1152460105 17:80438181-80438203 TCCCCAAGGCTGCTCTGGGGAGG + Intergenic
1152738183 17:82007648-82007670 TTCTGGGGGCTCCTCCAGGGAGG + Intronic
1154034225 18:10783606-10783628 CTCCCAAGGCCCCAGCAGGGAGG - Intronic
1154345783 18:13542582-13542604 TACCGTGGGCTCCTCCAGGGAGG + Intronic
1155593458 18:27454481-27454503 TTCCCAAGGCTCCACCTCAGTGG + Intergenic
1155594585 18:27470250-27470272 CTCCTAAGGCTCCTCAAGGTAGG + Intergenic
1157204108 18:45684060-45684082 TTCCCACGCCTTCTCCAGAGGGG + Intergenic
1157316497 18:46594205-46594227 TTCTCAAGTCTCCTCCAGAAAGG - Intronic
1160090446 18:75821760-75821782 TTCCCTAGGCTCCACTAAGGTGG + Intergenic
1160587757 18:79922107-79922129 GTACCAAGGCTCCTTCAGGGGGG - Intronic
1160710809 19:550202-550224 ATCCCAAGGCTTCTCCCAGGAGG + Intergenic
1161222396 19:3123632-3123654 GTCCCCCGGCTCCCCCAGGGAGG + Exonic
1163321318 19:16576692-16576714 TTCCCCAGACTCCTCCAAGGCGG - Exonic
1164527708 19:29023984-29024006 TTCCCAACCTGCCTCCAGGGAGG + Intergenic
1165724669 19:38104458-38104480 TTCCCAGAGCTCCGCCAGCGTGG + Intronic
1166153603 19:40893666-40893688 TTCCCGAGGATCCTGCAGAGAGG + Intronic
1166524993 19:43504990-43505012 TGGCCAAGACTCCTCCAGGGGGG - Intergenic
1167522112 19:49961154-49961176 TTCCCGAGGCTCCTCCTCTGTGG - Exonic
1167523270 19:49969571-49969593 TTCCCGAGGCTCCTCCTCTGTGG + Intergenic
1167948434 19:53008010-53008032 TTCACAAGCCTCCTGCAGGGAGG - Intergenic
1168238196 19:55076401-55076423 CTCCCAGGGCACCTCCAGGTGGG + Exonic
925720369 2:6821224-6821246 TTCCCCATGCCCCTCCAGAGAGG + Intergenic
926798149 2:16635798-16635820 TTTCAAAGGCTCCTCTGGGGAGG + Intronic
927111894 2:19869446-19869468 ACCCCCAGGCTCCTCCAGGCTGG + Intergenic
927713368 2:25339316-25339338 TTTCCTAGGCTTCTCCAGGAAGG + Intronic
928162181 2:28938863-28938885 CTCCCAAGCCTCCTACAGGCTGG - Intronic
928251507 2:29685353-29685375 TACCGAAAGCACCTCCAGGGAGG - Intronic
929456508 2:42069750-42069772 TTTGCAAGGCTCCTCCAGCCTGG - Intergenic
930147628 2:48023541-48023563 TTCCTAAGGCTTCTCCCTGGAGG - Intergenic
932340014 2:70957674-70957696 TTCCCACGGCTGCTGCAGGGAGG - Intronic
932568587 2:72924759-72924781 CTCCCAAAGCTCCTCACGGGGGG + Intronic
934901028 2:98160063-98160085 TTCTCCAGGCTACACCAGGGAGG - Intronic
939991179 2:148877174-148877196 TTGCCCAGGCTCCTCTAGCGTGG - Intronic
942539545 2:177001428-177001450 TTCCCAAGCCTCAACCATGGGGG + Intergenic
942554946 2:177162350-177162372 TTCCCAAGCCTCCTCCGTGATGG + Intergenic
942585371 2:177470000-177470022 TTACAAAGGCTTCCCCAGGGAGG + Intronic
946302296 2:218831350-218831372 CCCCCAAGGCTGCTCCAGGAAGG + Exonic
946360444 2:219216381-219216403 TTCCTCAAGTTCCTCCAGGGGGG - Exonic
948634796 2:239328184-239328206 GCGCCAGGGCTCCTCCAGGGTGG - Intronic
948687383 2:239677644-239677666 TCCCCACACCTCCTCCAGGGGGG + Intergenic
948749647 2:240124313-240124335 TCCCCCAGGCCCCTCCAGAGTGG + Intergenic
948797432 2:240412145-240412167 TTCTCCCGGATCCTCCAGGGAGG + Intergenic
949036466 2:241817730-241817752 AGCCCAAGCCCCCTCCAGGGTGG - Intergenic
1168951712 20:1806653-1806675 ATCCCAGGGCTTCTCCAGGTGGG + Intergenic
1169028687 20:2391381-2391403 TTCCTAAGGCCCCTCCTGGTTGG - Intronic
1169937232 20:10896669-10896691 ATCCCAAGGCTCCAGGAGGGTGG - Intergenic
1170588036 20:17750341-17750363 TTCCCAGGGCTCACACAGGGTGG + Intergenic
1170735009 20:19006897-19006919 GGCCCAAAGTTCCTCCAGGGTGG + Intergenic
1172097957 20:32469815-32469837 AACCCCAGACTCCTCCAGGGAGG + Intronic
1172359293 20:34301214-34301236 CTCTCAAGGCCCCTCCTGGGAGG + Intronic
1172601369 20:36185821-36185843 TTCCCAACAATCCTACAGGGTGG - Intronic
1173335221 20:42107001-42107023 TCCCCAAGGGTCCTGCTGGGAGG + Intronic
1175166665 20:57048887-57048909 TCCCCCAAGCTCCTCCAGAGGGG - Intergenic
1175221917 20:57422150-57422172 TTCCCAGGGCAGCTCCAGGCAGG - Intergenic
1175726427 20:61321679-61321701 TTCTGCAGGCTACTCCAGGGAGG - Intronic
1175889959 20:62311677-62311699 CCCCCGAGGCTCCTCCTGGGAGG - Exonic
1176135071 20:63519018-63519040 GCCCCACGGCTCCTTCAGGGTGG + Intergenic
1176199525 20:63854209-63854231 TAGCCCAGGCTCCTTCAGGGCGG - Intergenic
1177229482 21:18300897-18300919 TTTCAAATGCTGCTCCAGGGTGG + Intronic
1178627201 21:34228024-34228046 ACCCCGAGGCTCCTCCAGGAAGG + Intergenic
1178881914 21:36456513-36456535 TTCTCTAGGGTCCTACAGGGTGG + Intergenic
1178894639 21:36548566-36548588 CTTCCACGGCTTCTCCAGGGTGG + Intronic
1180201498 21:46227496-46227518 ATCCCAAGGGTGATCCAGGGTGG + Intronic
1180246366 21:46550604-46550626 TGCCCAAGGCTCCTCTCGGAGGG + Exonic
1181474307 22:23159039-23159061 TCCCCATGGCTCCTCCAATGAGG - Intronic
1181960236 22:26617426-26617448 TCCCCCAGCCTCCTCCAGGAAGG + Intronic
1184501588 22:44878025-44878047 TTCCAACAGCTCCTCCAGAGGGG + Intergenic
1184799392 22:46750724-46750746 TACCCAAGGCCTCTCCAGGTTGG - Intergenic
949764632 3:7512742-7512764 TTCCCAAGTGTCCTCCAGGTTGG - Intronic
950555630 3:13694221-13694243 CTCCCAAGACTGCTCCAGGAGGG - Intergenic
951764535 3:26182947-26182969 TTCCCAATTGTCCTCCAAGGTGG - Intergenic
951930430 3:27960641-27960663 TTCTTCAGGCTCCTCCAGTGAGG - Intergenic
952210813 3:31227542-31227564 TTCCCAAGGTTCTTCTTGGGTGG - Intergenic
954621680 3:51999963-51999985 TGCCCAAGTCTACTCCATGGAGG - Intergenic
956610186 3:71114722-71114744 TTCTCGAGGCTCTTCCAGGCAGG - Intronic
957952148 3:87141153-87141175 TTCCCAAGGCTCCACCTCAGTGG - Intergenic
959002727 3:100983047-100983069 TTTCCAAGGGTCCTCCTGAGAGG - Intronic
959112120 3:102134338-102134360 TTCTGAAGGCCCCTGCAGGGTGG + Intronic
959358790 3:105365839-105365861 TTCCCGATGTTCCTCCTGGGAGG + Intergenic
961637814 3:128344035-128344057 TTCCTGAGGCTCCACAAGGGAGG + Intronic
962266395 3:133947413-133947435 TCCCCAAGGCTGCAGCAGGGAGG + Exonic
962342375 3:134596420-134596442 ATCCTCAGCCTCCTCCAGGGTGG + Intergenic
962405422 3:135095891-135095913 TTCCCAAGGCTCTCCCAGAGTGG + Intronic
963209772 3:142675921-142675943 TTCCCAAAGCACTTCCAAGGCGG - Intronic
965858459 3:173117738-173117760 TGCCCAAAACTCCTGCAGGGGGG + Exonic
967171547 3:186826544-186826566 TCCCCAAGGCTGCTCCAGCAGGG + Intergenic
967375685 3:188797855-188797877 TTCCCAAAGCTCCTTCTGGTGGG + Intronic
968107661 3:196013988-196014010 TGCCCAAGCCTCCTCAAGTGTGG + Intergenic
969138291 4:5048793-5048815 TGCCCCAGTCTCCTCCAGAGTGG + Intergenic
971094735 4:23387911-23387933 TCCCCAAGACTGGTCCAGGGTGG - Intergenic
973696363 4:53494659-53494681 TTCCAAAGGATCCTCCAGTGTGG - Intronic
974077750 4:57183051-57183073 TCCCCCAGCCTCATCCAGGGTGG - Intergenic
977564345 4:98566528-98566550 TTCCCATGGCTGCTCCAGCTGGG - Intronic
979895875 4:126156671-126156693 GTCCCTAGGCTGCACCAGGGGGG + Intergenic
980383521 4:132058147-132058169 GTCCCAAGGCTGCACCAGTGGGG - Intergenic
980897894 4:138877166-138877188 CTCCCCTGGCTCCTCCAGAGGGG + Intergenic
983321122 4:166198209-166198231 TTCCCAAGGCTCCACCCCAGTGG - Intergenic
985519576 5:367201-367223 TCCCCCCAGCTCCTCCAGGGTGG - Intronic
987139070 5:14927187-14927209 ATCCAAAGGCTTCTCCATGGAGG - Intergenic
988899538 5:35717747-35717769 TTCCCAAGGCTCCACCTTAGTGG + Intronic
991014446 5:61915946-61915968 TTCCCAAGTCTCCTCCCCAGTGG - Intergenic
992104954 5:73442813-73442835 CTCTCAGGGCTCTTCCAGGGGGG - Intergenic
992533255 5:77672249-77672271 TTCCCTTTGTTCCTCCAGGGTGG + Intergenic
996661514 5:126009098-126009120 TTCCCAAGGCTCCACCTCAGTGG - Intergenic
997505137 5:134411446-134411468 TTTCCAAGGGGCCTCCAGGGTGG + Intronic
997941674 5:138163276-138163298 TTCCTTAGGCTCCTCTAGGCTGG + Exonic
998388158 5:141770234-141770256 TTCCAAAGGCTCCACCTTGGAGG + Intergenic
999553611 5:152717530-152717552 TTCCCAAGGCTCCACCTCAGTGG - Intergenic
1001428368 5:171640101-171640123 TTTCCATGGATCCTCCAAGGGGG + Intergenic
1002073858 5:176696631-176696653 TTCCCCAGGCCCCTCCAGGTTGG - Intergenic
1002091733 5:176810321-176810343 TGCCTGAGGCTCCCCCAGGGAGG - Intergenic
1006075562 6:31529983-31530005 ATCCCAAGGCTCCTGGTGGGTGG - Exonic
1006379773 6:33690789-33690811 TTCCCAAGGCTCCTCCAGGGAGG - Intronic
1007052935 6:38851383-38851405 TTCCCAAGTGTCATCCATGGTGG + Intronic
1007116679 6:39348061-39348083 TTCTCAAGGCTCCTGCTGAGTGG + Intronic
1008048403 6:46874840-46874862 TTGCCAAATGTCCTCCAGGGAGG - Intronic
1009908371 6:69895650-69895672 TTCCCAAGGCTCCACCTCAGTGG + Intronic
1010669743 6:78674032-78674054 TTCCCAAGGCTCCACCCCAGTGG + Intergenic
1016742152 6:147540327-147540349 TTCTCTAGGCTCCTTCTGGGAGG - Intronic
1017720808 6:157241791-157241813 TTTCCAAGGCTCTGCCAGGCTGG - Intergenic
1018047546 6:159978752-159978774 TTCCTGTGACTCCTCCAGGGTGG + Intronic
1018124395 6:160668159-160668181 TCCCCAAGGCCCCATCAGGGAGG - Intergenic
1018573343 6:165233372-165233394 CACCCAAGGCTTCTCCATGGTGG - Intergenic
1018574382 6:165244015-165244037 TCCATAAGGCCCCTCCAGGGAGG + Intergenic
1018776567 6:167022861-167022883 TTGCCAGGGCTGTTCCAGGGTGG + Intronic
1019659443 7:2215819-2215841 ATACCGAGGCTCCTCCAGGCAGG + Intronic
1019683520 7:2366771-2366793 TTCCCACGGCTGCGCCAGGTGGG - Intronic
1019992765 7:4703477-4703499 CCCACAAGGCTCCCCCAGGGTGG + Intronic
1022501008 7:30882397-30882419 TCCCCAAGGAGCCTCCAGGCTGG + Intronic
1023185068 7:37524542-37524564 TTTCCAGGGGTCCTTCAGGGAGG - Intergenic
1023640292 7:42250603-42250625 TTCCCAAGGCTCCAGCAATGAGG - Intergenic
1023919834 7:44619532-44619554 TTTTCAAGGTTCCTCCAGGTTGG + Intronic
1024313787 7:47994599-47994621 CTCCCAAGGCACCTCTAGTGTGG + Intronic
1024791023 7:52964890-52964912 CTCCCAAGGCTCCACGAGGAGGG + Intergenic
1026102269 7:67393080-67393102 TTCCCAGGGGTTCCCCAGGGAGG + Intergenic
1026455809 7:70571694-70571716 TCCCCAAGGCTCCTCCACAGAGG - Intronic
1026467962 7:70670853-70670875 CTACCAAGGCCCCTTCAGGGTGG - Intronic
1028192755 7:87871386-87871408 ATCTCAAGGCTCAACCAGGGAGG - Intronic
1028524604 7:91769611-91769633 TTCCCAAGCCTGCTCCTGGTTGG - Intronic
1029155996 7:98518477-98518499 TTCCCCAGCCTCCACCAGGCTGG + Intergenic
1034522658 7:151632412-151632434 TTCCCACGCTTCCTCCCGGGCGG - Intronic
1034837140 7:154363007-154363029 TTCTGAAAGCTCCTCCAGGTGGG - Intronic
1035206784 7:157298829-157298851 TTGCCCAGGCCCCTCCACGGTGG + Intergenic
1037915311 8:22769345-22769367 TTTTGAAGGCTCCTCCAGAGAGG + Intronic
1038454979 8:27667141-27667163 TGACCAAGGCCCCTCCAGGCCGG - Intronic
1038723746 8:30060788-30060810 TTCTCTTGACTCCTCCAGGGTGG + Intergenic
1041104179 8:54425395-54425417 TCCCCTCGGCCCCTCCAGGGAGG + Intergenic
1042585821 8:70336915-70336937 TTCACATGGCCCCTCCAGAGTGG - Intronic
1042737062 8:72001284-72001306 TGCCCCTGGCTCCTCCAGGAGGG - Intronic
1047022993 8:120796218-120796240 TTCCCAAGGCATCTCCAGCCAGG + Intronic
1047762919 8:127967384-127967406 TGCCCAAGTCTCCTCCTGTGTGG + Intergenic
1048023654 8:130564246-130564268 TTCACAAAGCTCCTCAATGGTGG + Intergenic
1048873809 8:138821075-138821097 CTCCCAAGGCTTCTCCCCGGTGG + Intronic
1049777532 8:144413564-144413586 TACTCAAGGCTCCTCCCAGGTGG - Exonic
1050023028 9:1304705-1304727 TTGCCTAGGCTTCTCCATGGAGG + Intergenic
1050068937 9:1790470-1790492 TTCCAAAGGCTCATCAAGGTAGG + Intergenic
1050790468 9:9462584-9462606 TGCACATGACTCCTCCAGGGTGG + Intronic
1053023041 9:34708950-34708972 ATGCCAAGGTTCCTACAGGGTGG - Intergenic
1056085217 9:83141620-83141642 TTCCCCAGGCTCCTCCAGCTCGG + Intergenic
1056481091 9:87007122-87007144 TTCCCAAGGCTGCTTGAGGATGG + Intergenic
1058079879 9:100690469-100690491 ATCACAAGGGTCCTCCTGGGAGG - Intergenic
1058937940 9:109786298-109786320 TTCCCAAGGATCCCTCAGAGGGG + Intronic
1060656334 9:125374964-125374986 GCCCCAAGGCTCCTCCAGAGAGG - Intergenic
1060730535 9:126034121-126034143 TCCCCGAGGGCCCTCCAGGGTGG - Intergenic
1060970192 9:127733428-127733450 TTTCCTGGGCTCCTCCTGGGTGG - Exonic
1061724661 9:132575482-132575504 TCCCCAAGGCCCTTCCAGGCTGG - Intergenic
1062318207 9:135978395-135978417 GTCCCAGGGCTGCTGCAGGGGGG - Intergenic
1062621526 9:137424342-137424364 TTGCCCAGTCTCCTCCAAGGGGG - Intronic
1186621899 X:11250537-11250559 TTCCCAAGGGGCCTCCAGAAAGG - Intronic
1194205808 X:91009745-91009767 TGCCCATGGATCCTCCAGGCTGG + Intergenic
1195174013 X:102297422-102297444 GTCCCAAGGGCCCTTCAGGGAGG - Intergenic
1195184852 X:102389671-102389693 GTCCCAAGGGCCCTTCAGGGAGG + Intronic
1198191871 X:134315427-134315449 ATCCCAAGGCTCCACCCAGGTGG + Intergenic
1198205455 X:134460543-134460565 TTCCCAGGGCTCCCCCGAGGAGG - Intronic
1199407265 X:147477135-147477157 TTCCCAAGGTTCTTCCTGGGAGG + Intergenic
1199863959 X:151826419-151826441 TTCACAGGGCTCCACTAGGGTGG + Intergenic
1199942545 X:152639611-152639633 CACCCAAGACACCTCCAGGGTGG + Intronic
1200551566 Y:4584556-4584578 TGCCCATGGATCCTCCAGGCTGG + Intergenic
1200667823 Y:6049510-6049532 TTCCCAAGGCTGGTCCAGAATGG - Intergenic
1200964432 Y:9023415-9023437 CTGCCAACGCACCTCCAGGGAGG + Intergenic