ID: 1006382582

View in Genome Browser
Species Human (GRCh38)
Location 6:33708509-33708531
Sequence CAGGGTGATCATTAGGACGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1006382577_1006382582 3 Left 1006382577 6:33708483-33708505 CCGGCAAAGGTGCACTGTGCACC 0: 1
1: 0
2: 2
3: 7
4: 127
Right 1006382582 6:33708509-33708531 CAGGGTGATCATTAGGACGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1006382582 Original CRISPR CAGGGTGATCATTAGGACGA AGG Intronic
No off target data available for this crispr