ID: 1006382897

View in Genome Browser
Species Human (GRCh38)
Location 6:33711155-33711177
Sequence CTTCAAATGCAGAATCTCTA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 266
Summary {0: 1, 1: 0, 2: 1, 3: 15, 4: 249}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1006382897_1006382899 8 Left 1006382897 6:33711155-33711177 CCCTAGAGATTCTGCATTTGAAG 0: 1
1: 0
2: 1
3: 15
4: 249
Right 1006382899 6:33711186-33711208 TGTTTTTTGATTTGTAGAGACGG No data
1006382897_1006382900 29 Left 1006382897 6:33711155-33711177 CCCTAGAGATTCTGCATTTGAAG 0: 1
1: 0
2: 1
3: 15
4: 249
Right 1006382900 6:33711207-33711229 GGAGTCCCACTATGTTGCCCAGG 0: 21
1: 907
2: 15637
3: 59046
4: 154132

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1006382897 Original CRISPR CTTCAAATGCAGAATCTCTA GGG (reversed) Intronic
900425461 1:2576372-2576394 CTCCAAATGCAGCATCACTGGGG + Intergenic
901613430 1:10517823-10517845 TTTCAAATACTGAATCCCTAAGG - Intronic
903396994 1:23009163-23009185 TTTTAAAAGCAGAATCTCTGGGG - Intergenic
906418697 1:45644043-45644065 CTTCAGAATCAGAATCTCCAGGG + Intronic
906940383 1:50250631-50250653 CTTCAAATGTAAACTCTCTGAGG - Intergenic
908589031 1:65608851-65608873 CTTCAATTCCAGATTCGCTATGG + Exonic
908616211 1:65925767-65925789 AATCAAATGCAAATTCTCTATGG - Intronic
909275653 1:73683120-73683142 CTTAATATTCAGAATCTATAAGG - Intergenic
911289070 1:96033690-96033712 CTTCATATGTAGAAACTCTTTGG + Intergenic
911436036 1:97859205-97859227 CTTAAAAAAAAGAATCTCTATGG + Intronic
911557813 1:99366793-99366815 ATTTAAATGCTGAGTCTCTAGGG - Intergenic
912931086 1:113962560-113962582 CTTAAAATGAAACATCTCTATGG + Intronic
913530856 1:119733285-119733307 CTTCAAATTCAGTAATTCTAGGG - Intronic
915476798 1:156157633-156157655 TTAAAAATGCAGATTCTCTAAGG + Intronic
916339690 1:163717953-163717975 CCTCATATCCAGAATCTATAGGG + Intergenic
916400211 1:164439512-164439534 CTCCAAATGCTGAACCTCTCAGG + Intergenic
917269192 1:173255008-173255030 CCACTAATTCAGAATCTCTAAGG - Intergenic
918308247 1:183266680-183266702 CTTCAAATGCACAACCCTTAAGG - Intronic
918877971 1:190074621-190074643 CCTAAAATCCAGAATCTATAAGG + Intergenic
919337469 1:196255792-196255814 ATTCTAATGCAGAATCTTTTGGG + Intronic
919523610 1:198620157-198620179 TTTAAACTTCAGAATCTCTAAGG - Intergenic
921179787 1:212623277-212623299 CTTCAAGAACTGAATCTCTAAGG + Intergenic
923929128 1:238673646-238673668 GTTGAAATGCAGAATCTCTAGGG + Intergenic
1065321072 10:24510649-24510671 CTTCAAAGGCAGGAGCTCTGTGG + Intronic
1066457708 10:35586156-35586178 CCTCCAATGCAGAACTTCTATGG - Intergenic
1068402597 10:56549554-56549576 TCTAAAATCCAGAATCTCTAAGG - Intergenic
1068449695 10:57170244-57170266 CTTAATATCCAGAATCTATAAGG + Intergenic
1070161481 10:73869201-73869223 CTCCTAAAGCAGAATCTCTGTGG + Intronic
1071169800 10:82850901-82850923 CTTTAAATTCAGTATGTCTATGG - Intronic
1071170126 10:82854511-82854533 CTTCAAATGCAGAAGGTATCTGG - Intronic
1072883688 10:99253719-99253741 CTTAATATCCAGAATCTATAAGG + Intergenic
1073546992 10:104358361-104358383 CTTCAAATGCAGATTCTTCCAGG - Exonic
1076481288 10:130786727-130786749 CCTCAAATGCGGAGTCTGTAGGG - Intergenic
1078180346 11:9005142-9005164 CTTAAAATGCAGTATCTCATTGG + Intergenic
1079338366 11:19590979-19591001 CTTCCTATACAGAATCTTTAGGG + Intronic
1081228957 11:40561304-40561326 ATTGGACTGCAGAATCTCTAAGG + Intronic
1083374784 11:62210750-62210772 CTTCACATTGAGAATCTTTAGGG + Intronic
1085556877 11:77431339-77431361 CTTCTATTGCATAATCTCTCAGG - Intronic
1086475735 11:87171141-87171163 CTTTAATTGCAGAATCTAAAAGG + Intronic
1088692939 11:112343348-112343370 CTTCAAATGCAGGATCACACTGG + Intergenic
1088705929 11:112464756-112464778 GTCCAAAGGCAGAAACTCTATGG + Intergenic
1090905679 11:131072697-131072719 TTTTAAATTCAGAATGTCTAGGG + Intergenic
1091044889 11:132316589-132316611 CTTAACATGCTAAATCTCTAGGG + Intronic
1092571478 12:9728085-9728107 ATTTATATGCAGAATCTCAAAGG - Intronic
1093334250 12:17881421-17881443 TTTAATATGCAGTATCTCTATGG - Intergenic
1093395020 12:18670531-18670553 CTTCATCTGCAAAATCTCCAGGG + Intergenic
1093409657 12:18849198-18849220 CTTCAAAGGCAGAATGTCATAGG - Intergenic
1094695756 12:32816968-32816990 GTTTAAATCCAGAATCTGTAAGG - Intronic
1095235778 12:39793773-39793795 CATGAAATGCATAATTTCTAGGG + Intronic
1096035449 12:48465177-48465199 CGTCTAATGCAGTATCTGTAAGG + Intergenic
1096248096 12:50007343-50007365 CTTCCAAGGCAGCATCTCAAAGG + Intronic
1097382368 12:58910276-58910298 CTACTAATTTAGAATCTCTAGGG + Intronic
1098622909 12:72626538-72626560 CTCCTAATTGAGAATCTCTAAGG - Intronic
1101295599 12:103420502-103420524 CTTCTAATGCAAACTCTCTAAGG + Intronic
1106352425 13:28945710-28945732 ATTCAAATCCAGAATCAATAAGG - Intronic
1106671628 13:31912240-31912262 CTGCAGATTCAGAATCTCCAGGG + Intergenic
1107235364 13:38162096-38162118 ATCCAAATGCACAATCGCTAAGG - Intergenic
1109646742 13:65268468-65268490 CTTAACATGCAGAATTTATAAGG - Intergenic
1110033625 13:70651567-70651589 CTTCTGCTCCAGAATCTCTAGGG + Intergenic
1110308069 13:74013593-74013615 CTTCAGATTCAAAATATCTAGGG + Intronic
1110740894 13:78995394-78995416 TTTCCAGTGCAGAATCTCTCAGG - Intergenic
1111280823 13:86021860-86021882 CTCCAAATGCAAAATTTCTTTGG - Intergenic
1111958731 13:94785865-94785887 CTTCTAATGCAGAATATCAGGGG - Intergenic
1112344793 13:98580057-98580079 CATAAAATGCATCATCTCTATGG - Intergenic
1112533564 13:100227937-100227959 CTTCAAATGAAAAATTTTTAAGG + Intronic
1115312656 14:31995070-31995092 CTTCACAGGCAGATTCTCAAAGG - Intergenic
1116635540 14:47390071-47390093 CCTCAAATGCTGAAGTTCTACGG - Intronic
1117074896 14:52092300-52092322 CTTCTAATACAGAATGTATATGG - Intergenic
1117125451 14:52618562-52618584 CTTCATTTGTAGAATTTCTAGGG + Intronic
1117709206 14:58506816-58506838 CTTTAAATGGAAAATATCTATGG + Intronic
1117750518 14:58917882-58917904 CTTCAAATCCAGGAACGCTAAGG + Intergenic
1118213263 14:63785501-63785523 CTTCATATCCAGAATCTATTAGG + Intergenic
1120669960 14:87352047-87352069 CCTCAAATGTTTAATCTCTAAGG + Intergenic
1123134440 14:106013964-106013986 CTACAAATTCAGAAGCTCTTCGG - Intergenic
1123171353 14:106375549-106375571 CTACAAATTCAGAAGCTCTTTGG - Intergenic
1128180152 15:65595197-65595219 CCTCAAATTCAGCATCTCTCTGG - Intronic
1129024493 15:72557427-72557449 CCTCATATCCAGAATCTATAAGG - Intronic
1131105397 15:89730527-89730549 CTTCACATACAGAAACTCTCTGG - Intronic
1131617604 15:94033219-94033241 CTGCTAACTCAGAATCTCTAGGG - Intergenic
1133341085 16:5036595-5036617 GTTCAAATGCAGAATTTCTGTGG - Intronic
1133628735 16:7597847-7597869 CTTCAAATGACTAATCTCTCTGG - Intronic
1134053424 16:11153808-11153830 CTACAAATGCATAATAGCTAGGG + Intronic
1134189155 16:12108046-12108068 TGTCAAATGGAAAATCTCTATGG - Intronic
1136231730 16:28889667-28889689 CTTCACAGGCAGAAGCTCTGGGG - Intronic
1137324041 16:47415053-47415075 CTTCAAATCAAGAATATCAAGGG + Intronic
1137736513 16:50728139-50728161 CTTCAAATGCTGAATGACCATGG + Intronic
1137797308 16:51232896-51232918 CTTCTAAATCAGAAACTCTAAGG + Intergenic
1137806738 16:51313658-51313680 CCTCAAATGGATAATCTCTTTGG + Intergenic
1139709333 16:68763829-68763851 CTTAAACATCAGAATCTCTAGGG - Intronic
1141411511 16:83837150-83837172 CTGGAACTGCAGAATCTCTTGGG + Intergenic
1143666594 17:8365677-8365699 CTTCACATGCAGAATCTCGCTGG + Intergenic
1145354256 17:22124398-22124420 TATCAAATCCAGAATCTCAACGG - Intergenic
1147516542 17:41123377-41123399 ATGCAAATACAGAATTTCTAAGG + Exonic
1148843625 17:50515448-50515470 GTTAAAGTGCAGAATCTCTGTGG - Intronic
1149747668 17:59114887-59114909 CTACAGAATCAGAATCTCTAGGG + Intronic
1153362490 18:4213275-4213297 CTTCACATGGAGATTCTCTTGGG + Intronic
1153562375 18:6384004-6384026 CTACCAAATCAGAATCTCTAAGG + Intronic
1153754453 18:8265866-8265888 CTGGAAATCCAGCATCTCTAAGG - Intronic
1155657010 18:28204319-28204341 GTTCCTTTGCAGAATCTCTAGGG + Intergenic
1156102686 18:33616920-33616942 CTTCAAATGCAGATACACTGAGG + Intronic
1157112235 18:44832340-44832362 CTTCAGAGTCAGAACCTCTAGGG - Intronic
1157954181 18:52077702-52077724 CATCAAAAGCAGTACCTCTAGGG - Intergenic
1158314071 18:56191281-56191303 ATTCAAATGCAGAAACACTAAGG - Intergenic
1159302818 18:66597703-66597725 CGACAAATCCAGAATCTATAAGG + Intronic
1159691849 18:71498263-71498285 GTTCAAAAGCAGACTCTATATGG - Intergenic
1161176062 19:2842521-2842543 CTTCAAATCCACACTTTCTAGGG - Intronic
1162249823 19:9432804-9432826 CTTCCAAAGCAAAAACTCTAAGG + Intronic
1164663632 19:30004596-30004618 CTCCAAATACAGAATTTTTATGG - Intronic
925032796 2:663974-663996 CTTCAAATTCACAATTCCTAAGG + Intergenic
925064548 2:920266-920288 CTTCAGATGCAACATCTCTAGGG - Intergenic
925721584 2:6833598-6833620 CTCCAAATGCAGCCACTCTAGGG + Intergenic
927457714 2:23271481-23271503 CTTACAAGGCAGAACCTCTAAGG + Intergenic
929123097 2:38499517-38499539 CTACAGAAGCAGAATCTGTAGGG + Intergenic
930331752 2:49994095-49994117 CTTCACAAGCAGAGTCTCTCAGG + Intronic
930688294 2:54331935-54331957 CTGCAAACTCAGAATCTCTGGGG - Intronic
933815364 2:86063762-86063784 CTTCAAGTTCATGATCTCTAAGG - Intronic
934705553 2:96475720-96475742 CTTCAAAAGCAGAAGTTATAAGG - Intergenic
938844146 2:135191442-135191464 TTTAAAATGTGGAATCTCTAGGG - Intronic
939032713 2:137095628-137095650 CTTCAATTCCAGAGTCCCTAGGG + Intronic
939046070 2:137251738-137251760 CTTCAAAATCAGAATCTCTTAGG - Intronic
939228845 2:139400127-139400149 CTGCAGATCCAGAATCTATAAGG + Intergenic
941411539 2:165162658-165162680 TTTCAAAAGCAGAATCGCTTGGG + Exonic
942596143 2:177593606-177593628 CTTCAAAGGCAGCAGCTCCAAGG - Intergenic
942763483 2:179427516-179427538 CTTGAGAAGCAGAAACTCTAAGG + Intergenic
943237477 2:185340532-185340554 CCTTAAATTCAGAATCTCTGAGG + Intergenic
943712965 2:191118306-191118328 CTTCAATCCCAGAATCTCAAAGG - Intronic
944709414 2:202322312-202322334 GTTCAAATGCAGAAGCTTTGGGG - Intergenic
945685463 2:212963915-212963937 CTGAAAATGCAGTTTCTCTAAGG + Intergenic
949002159 2:241621498-241621520 ACTGAAATGAAGAATCTCTAAGG + Intronic
1169002356 20:2177193-2177215 CTTCATATTCAGAACCCCTAGGG - Intergenic
1169526176 20:6428194-6428216 CTTCAAATGCCGAATGACCACGG + Intergenic
1170992189 20:21313183-21313205 CTTCAAGTGAAGAATCAGTAAGG + Intronic
1173174245 20:40752304-40752326 CTGCCATTTCAGAATCTCTAGGG + Intergenic
1173673264 20:44812308-44812330 CTTTAAAAGCAGAATCTCTCAGG - Intergenic
1174188229 20:48722031-48722053 ACTCAAATGCAGAAACTCAACGG + Intronic
1175109709 20:56638838-56638860 CTTAAAATACAGAACCTCCACGG - Exonic
1176994477 21:15539238-15539260 CATCACATGGAGAAGCTCTAAGG - Intergenic
1177372035 21:20217178-20217200 CTTCTAATGTGGAATCTTTAGGG - Intergenic
1177545280 21:22548895-22548917 CAGCAAATTCAGAACCTCTAGGG + Intergenic
1177551121 21:22623930-22623952 CTTCAATTTCAGAATTGCTATGG + Intergenic
1177921456 21:27157632-27157654 CTTCAAATGCCGAATGACTATGG + Intergenic
1178973533 21:37202045-37202067 CTTAAAATGCAGAATCTTTGAGG - Exonic
1180577877 22:16797434-16797456 CTTAAGATCCAGAATCTATAGGG + Intronic
1181869042 22:25883433-25883455 CTACTGATTCAGAATCTCTAAGG - Intronic
1182888797 22:33798896-33798918 CTTCCAATTCAGAATTTTTATGG - Intronic
951473688 3:23082346-23082368 GTTCAAATGCAGAAGGTCCATGG + Intergenic
951643852 3:24866049-24866071 CTTAAAATCCAGAATCCCTGTGG - Intergenic
952137278 3:30437390-30437412 CTTAATATGCTGACTCTCTAGGG - Intergenic
952662736 3:35871190-35871212 CTTTAAATGCAGATTCTGTTCGG - Intergenic
955539792 3:59962079-59962101 CTTCCAATGGAACATCTCTATGG - Intronic
956638672 3:71393761-71393783 TTTAAAGTTCAGAATCTCTAGGG + Intronic
957726377 3:84072308-84072330 CTTGAAAAGCAGGATCTTTAGGG + Intergenic
960314593 3:116160831-116160853 CTACTAAATCAGAATCTCTAAGG - Intronic
960878324 3:122318635-122318657 CTTTGGAGGCAGAATCTCTATGG + Intergenic
962779151 3:138694839-138694861 GTTGAAATCCAGAAGCTCTAGGG + Exonic
962930470 3:140031220-140031242 CTTCACATGCAGAATGTGGAGGG + Intronic
963617531 3:147560748-147560770 CTTAAAATGAACAATCTCCATGG - Intergenic
963690256 3:148490664-148490686 CTTCAAATGCAGCAACTAGATGG + Intergenic
963943819 3:151123174-151123196 CTTGATATGCAGAATGTTTAGGG - Intronic
964370057 3:155990994-155991016 CTTCAAATCCAGCAGCACTAGGG - Intergenic
964484012 3:157168833-157168855 CTTTACTTGAAGAATCTCTAAGG - Intergenic
965082467 3:164052112-164052134 ATTCAAAAGCAGAATATCGAGGG - Intergenic
965393711 3:168135988-168136010 GTTCAAATGGAGATTCTCCATGG + Intergenic
965569756 3:170160401-170160423 CTTCAAATGCATACTCCCTGAGG + Intronic
966761526 3:183423572-183423594 CTGGAAATGCAAAACCTCTATGG + Intronic
966888122 3:184387831-184387853 CCTCAAATGCAGTCTCTCTGTGG - Intronic
969997808 4:11332426-11332448 CTCCAAATGGACAATCTCTTTGG + Intergenic
971165240 4:24175962-24175984 CCTCAAATGCAAACTCTCTGGGG + Intergenic
973209664 4:47601906-47601928 CTTCAAATATACAATTTCTAAGG + Intronic
974441575 4:61925087-61925109 CCTCAAAAGCAGTATCTCTGTGG + Intronic
974512457 4:62861880-62861902 CTTCAAATGAAGATTAGCTATGG - Intergenic
974671028 4:65030291-65030313 CTTCATTTTCAGAAACTCTAGGG + Intergenic
975275862 4:72500492-72500514 TTTCATATCCAGAATCTATAGGG - Intronic
975620514 4:76291699-76291721 CTTCAAATACAAAATCCCTGGGG + Intronic
976344504 4:83985048-83985070 CTTCAAATGCCGTATCTCTGGGG + Intergenic
977025649 4:91815820-91815842 CAGCAAATGCTGAAACTCTAAGG - Intergenic
977127756 4:93192009-93192031 CTTCAAATGTAGAATATAAAGGG - Intronic
979197674 4:117940251-117940273 CTTCACATGGAGTATCTCAACGG + Intergenic
979275499 4:118810640-118810662 CTACAGAATCAGAATCTCTAAGG - Intronic
980872788 4:138628882-138628904 CATCAAAAGCATAATCTCTCTGG + Intergenic
981139257 4:141249356-141249378 CTTTAAATGCTGAATCTAAATGG + Intergenic
982569760 4:157033838-157033860 CTACTAAATCAGAATCTCTAGGG + Intergenic
982931481 4:161413172-161413194 CTTAATATTCAGAATCTATAGGG + Intronic
982990281 4:162264871-162264893 TTTAATATGCAGAATCTATAAGG + Intergenic
984406883 4:179344154-179344176 CTTCAAAAACAAAATCTCTGGGG + Intergenic
984623292 4:181977391-181977413 CTTCAAATGCAGAAAATCCTAGG - Intergenic
986284461 5:6349167-6349189 CTTCTGATGCAAAGTCTCTAAGG + Intergenic
986662005 5:10067562-10067584 TTTAAAATGAAGAATCTCTTGGG + Intergenic
986723352 5:10576387-10576409 CTTGAAATGCAGATTCTCAGGGG - Intronic
987741142 5:21910304-21910326 CATCAAATTCAGAAGCTCCAAGG + Intronic
990155203 5:52869088-52869110 TTTCAAAATCAGAATCTCTGAGG + Intronic
990608374 5:57432890-57432912 CTTCAATTTCAGATTCTTTATGG + Intergenic
991181536 5:63756895-63756917 CTCCAGAATCAGAATCTCTAAGG + Intergenic
992295150 5:75320187-75320209 CTCCAAATGCAGAACTTATAGGG - Intergenic
992713872 5:79489656-79489678 TTTAAAGGGCAGAATCTCTAAGG + Intronic
993759590 5:91776610-91776632 CTGCAAATGCAAAGTCTCTGGGG + Intergenic
994066300 5:95546267-95546289 CTTCAAATGGGCAATCACTAGGG + Intronic
994312034 5:98284487-98284509 ATTGAAATGCTGGATCTCTAGGG - Intergenic
994569246 5:101492561-101492583 CTTCAAATGAAGAATTTCCAGGG + Intergenic
995763802 5:115593670-115593692 GTTCAATTCCAGAATTTCTATGG + Intronic
996905687 5:128597021-128597043 CTCCAAATCCAGAATCTCTGGGG + Intronic
997292237 5:132746290-132746312 CTTAATATCCAGAATCTGTAAGG - Intergenic
999072697 5:148763780-148763802 CTTCAAAAGAAGAGTCTCTTGGG + Intergenic
1002417366 5:179127480-179127502 CATCAACTGCAGACTCTCTGGGG + Intronic
1004634801 6:17456483-17456505 CTTCATTGGCAGAAACTCTAGGG + Intronic
1004645416 6:17555492-17555514 ATTAAAATGCAGATTCTCTCTGG - Intronic
1005839835 6:29736403-29736425 TTTCCAATGCAGCATTTCTAAGG + Intronic
1005939010 6:30546997-30547019 CATCAATGGCAGAATCTCTGAGG + Intronic
1006382897 6:33711155-33711177 CTTCAAATGCAGAATCTCTAGGG - Intronic
1010399062 6:75427724-75427746 CTTCAAAAGCAGAATATCACTGG - Intronic
1010949743 6:82021554-82021576 CTTAAAATGCAGAATGTTTCAGG - Intergenic
1011579651 6:88846123-88846145 CTTCAAATCCACAATGCCTATGG + Intronic
1012684256 6:102224712-102224734 CTTCAAATGTAGGTTCTCTATGG + Intergenic
1014602348 6:123429423-123429445 CCTCAACTGCAGCCTCTCTAGGG - Intronic
1015745170 6:136502223-136502245 CAGCAAATGAAGAATCTCTTAGG + Intronic
1016082790 6:139876814-139876836 GACCAAATGCAGAATTTCTAAGG + Intergenic
1018356604 6:163023955-163023977 AACAAAATGCAGAATCTCTAGGG - Intronic
1018375386 6:163205823-163205845 CCTAAAATTCAGAATCTATAAGG + Intronic
1022165171 7:27752418-27752440 CTCCAGATGCTGAATCTCTCTGG - Intronic
1022262688 7:28721498-28721520 CTTCCAGGGCAGAAACTCTAGGG - Intronic
1023191076 7:37583801-37583823 CTTCAAATGCAGCAACTAGATGG + Intergenic
1023694048 7:42826330-42826352 ATTCAGATGCTGCATCTCTAAGG + Intergenic
1024987198 7:55205559-55205581 CTGAAAATGCAGAATACCTAAGG + Exonic
1026581174 7:71618689-71618711 CCTAAAATCCAGAATCTATAGGG - Intronic
1027554525 7:79647436-79647458 CTTAAAATTCAGAATCTGGATGG - Intergenic
1028719518 7:94012627-94012649 CTTCAAATGCAGTCTCAATAGGG - Intergenic
1030093482 7:105877190-105877212 CAACAACTGCAGAATCTCCATGG - Intronic
1030355395 7:108536965-108536987 GTTCTAATTCAGAATGTCTAGGG + Intronic
1030382294 7:108825985-108826007 CTGCAGAGCCAGAATCTCTAGGG - Intergenic
1030943373 7:115683277-115683299 CTTCAATTCCAGAAACTCTTAGG + Intergenic
1031557799 7:123199544-123199566 CTTGAACTGCAAAATCTCAAAGG + Intronic
1033063995 7:138135249-138135271 CTTCTAATGCAAAATGTGTAGGG - Intergenic
1038890498 8:31716747-31716769 TTTAAAATGCATAATCTTTAGGG + Intronic
1041015350 8:53587643-53587665 CTTTCAATGCTGAATTTCTAGGG + Intergenic
1043032810 8:75159198-75159220 ATTCATAAGCAGAATATCTAAGG - Intergenic
1044416741 8:91948252-91948274 TTTCAGAATCAGAATCTCTATGG - Intergenic
1044772913 8:95656094-95656116 CTTAATATCCAGAATCTGTAGGG - Intergenic
1044804590 8:95992180-95992202 CTGCAAATCCAGGATCTTTATGG + Intergenic
1045337140 8:101216117-101216139 CTTCAACTGCAGTATTTCTGGGG - Intergenic
1045603199 8:103742777-103742799 CCTCAAGGGCAGAATCTCTCAGG + Intronic
1047209235 8:122827597-122827619 CTTCAGAATCAGAATCTTTAGGG + Intronic
1047209238 8:122827638-122827660 CTTCAGAATCAGAATCTTTAGGG + Intronic
1047572831 8:126119207-126119229 GTTAATATGCAGAATATCTAAGG - Intergenic
1047871278 8:129085215-129085237 CTTAAAATGCAGTAGCTCAAAGG - Intergenic
1048862780 8:138736398-138736420 TTTCAAATGCAGCATCACCATGG - Intronic
1050266751 9:3898736-3898758 CTTCAGCAGCAGCATCTCTAGGG + Exonic
1050716336 9:8530744-8530766 ATTCACATTCAGAATCTCTCTGG - Intronic
1051851326 9:21512320-21512342 CTTCAAAAGCGGACACTCTAAGG - Intergenic
1055604032 9:77949398-77949420 ATTCAAATTCTGAATCTCTTGGG + Intronic
1055773275 9:79740056-79740078 CATCAAACGCAGAATCTCAAAGG - Intergenic
1056251531 9:84753383-84753405 CTGCTAAAGCAGAAACTCTAGGG - Intronic
1056759756 9:89406084-89406106 TTACAAAGGCAGAGTCTCTAAGG - Intronic
1057459387 9:95245975-95245997 CTGCAAGTGCAGAAAGTCTAAGG + Intronic
1059871659 9:118584864-118584886 CCTCAAATGCTGCATCTCTCTGG - Intergenic
1188572303 X:31602675-31602697 CTTCACATGCTGAATCTGGAAGG + Intronic
1188738936 X:33753424-33753446 TTTAATATCCAGAATCTCTAAGG - Intergenic
1189226502 X:39417823-39417845 CTTCAATTGTAGAATCACTTTGG - Intergenic
1189507755 X:41629408-41629430 CTTAGAATGAATAATCTCTAAGG - Intronic
1189712758 X:43831084-43831106 GTTCTAATGCAGAACCTCAAAGG - Intronic
1190679760 X:52815321-52815343 GTTCAAATGCAGACTTTCTTTGG + Intronic
1192682404 X:73265372-73265394 TTTTAAATGTAGAATCACTAAGG - Intergenic
1192924343 X:75740041-75740063 CTTAAAATGCAGAATCTTTGAGG + Intergenic
1196574684 X:117304366-117304388 CTTCAAATACAGAAGCACAAAGG + Intergenic
1197636421 X:128919847-128919869 CTACTAAACCAGAATCTCTATGG + Intergenic
1197828194 X:130613102-130613124 CCTCAAATACAGAAACTCTGAGG - Intergenic
1198715085 X:139549865-139549887 AATAAAATGAAGAATCTCTAAGG + Intronic